CN112746126B - SSR marker fingerprint of Hypsizigus marmoreus Finc-B-7 strain as well as construction method and application thereof - Google Patents

SSR marker fingerprint of Hypsizigus marmoreus Finc-B-7 strain as well as construction method and application thereof Download PDF

Info

Publication number
CN112746126B
CN112746126B CN202110153272.5A CN202110153272A CN112746126B CN 112746126 B CN112746126 B CN 112746126B CN 202110153272 A CN202110153272 A CN 202110153272A CN 112746126 B CN112746126 B CN 112746126B
Authority
CN
China
Prior art keywords
primer
strain
size
hypsizigus marmoreus
ssr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110153272.5A
Other languages
Chinese (zh)
Other versions
CN112746126A (en
Inventor
王楠
陈静
李金鑫
李兆鹏
阿依尼尕尔·买合木提
曹娜
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hebei Fengke Biotechnology Co ltd
SHANGHAI FINC BIO-TECH Inc
Original Assignee
SHANGHAI FINC BIO-TECH Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by SHANGHAI FINC BIO-TECH Inc filed Critical SHANGHAI FINC BIO-TECH Inc
Priority to CN202110153272.5A priority Critical patent/CN112746126B/en
Publication of CN112746126A publication Critical patent/CN112746126A/en
Application granted granted Critical
Publication of CN112746126B publication Critical patent/CN112746126B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6858Allele-specific amplification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses an SSR marker fingerprint of a Hypsizygus marmoreus Finc-B-7 strain, a construction method and application thereof, wherein the fingerprint consists of 6 pairs of SSR markers. The construction method comprises the following steps: (1) hypha culture; (2) extracting genome DNA; (3) detecting SSR molecular markers; and (4) detecting by capillary electrophoresis. The application comprises the following steps: and performing SSR marker amplification on the hypsizigus marmoreus strain, comparing the obtained banding pattern with the fingerprint spectrum, and obtaining the hypsizigus marmoreus Finc-B-7 strain if the banding pattern is consistent with the fingerprint spectrum. Compared with conventional morphological detection, antagonism test and fruiting test, the method has the advantages of short detection time, high accuracy and good repeatability, and has the specificity of the hypsizigus marmoreus Finc-B-7 strain in 56 collected main culture strains for cultivating hypsizigus marmoreus at home and abroad.

Description

SSR marker fingerprint of Hypsizigus marmoreus Finc-B-7 strain and construction method and application thereof
Technical Field
The invention belongs to the technical field of detection of hypsizigus marmoreus strains, and particularly relates to an SSR marker fingerprint of a hypsizigus marmoreus Finc-B-7 strain, and a construction method and application thereof.
Background
Hypsizigus marmoreus (Peck) H.E.Bigelow, a species of Basidiomycota, agaricales, lyophyllaceae, is named due to marble patches on the surface of its pileus. The seafood soup is attractive in appearance, crisp and tender in texture, unique in seafood flavor and economical in price, and is popular with consumers. The hypsizigus marmoreus not only contains abundant vitamins and 18 amino acids, but also has the functions of hemolysis, antioxidation, leukemia and lymphoma cell inhibition, blood fat reduction, inflammation resistance, antioxidation and the like in components such as micromolecular compounds, polysaccharide, polypeptide and the like contained in the hypsizigus marmoreus through recent research, and is edible and medicinal fungi with high economic value. Since the first industrialized culture enterprise of hypsizygus marmoreus in China established in 2001, hypsizygus marmoreus becomes one of novel edible fungi which are developed in markets of China quickly. The total industrial production of the hypsizigus marmoreus in 2019 is 32.8 ten thousand tons, the yield is increased by 58.63 percent in comparison with that in 2018, the yield accounts for 9.6 percent of the total industrial production of the edible fungi, and the highest rank is found in the total production of the edible fungi in industrial cultivation in China.
The high-quality strain plays a very important role in the industrial cultivation of the hypsizigus marmoreus. At present, hypsizigus marmoreus strains used by industrialized production enterprises in China are mainly introduced into Japan or further bred by hybridization on the basis of the introduced strains, the cultivated hypsizigus marmoreus has brown fruiting bodies called as crab-flavor mushrooms, and the cultivated hypsizigus marmoreus has white fruiting bodies called as white beech mushrooms or yulong mushrooms. Although the yield of factory production is increased year by year, part of strains still have the problems of long cultivation period, low yield per unit, poor appearance uniformity of single fruiting bodies, easy occurrence of canopies and the like, and the defects can cause the increase of production cost and reduce the market competitiveness of products. On the other hand, the strain diversity of the hypsizigus marmoreus factory production strain is not high, the product appearance is similar, and the diversified demands of market consumers cannot be met. The method has rich wild and natural culture resources of the hypsizigus marmoreus, efficiently utilizes the high-quality resources, expands the genetic basis of the strains, and is beneficial to breeding the high-yield, high-quality and special hypsizigus marmoreus strains in China.
With the promulgation and implementation of the protection law of new species of international plants, the establishment of a mature, rapid and accurate molecular biology identification technical system becomes a powerful means for protecting the intellectual property rights of edible fungus varieties.
Disclosure of Invention
The invention aims to solve the technical problem of providing an SSR marker fingerprint of a Hypsizygus marmoreus Finc-B-7 strain and a construction method and application thereof, wherein the fingerprint has the advantages of short detection time, high accuracy and good repeatability compared with conventional morphological detection, antagonism test and fruiting test.
Hypsizigus marmoreus (Hypsizygus marmoreus) Finc-B-7, which is deposited in China general microbiological culture Collection center (CGMCC) at 28 days 11 and 2016, with the address of No. 3 of Ministry of Western No.1 of Beijing republic of the republic of Yangye, and the number of deposit at the institute of microbiology of China academy of sciences, CGMCC No.13193.
The SSR marker fingerprint of the hypsizigus marmoreus 'Finc-B-7' strain consists of 6 pairs of SSR markers, SSR primers are developed based on simple repetitive sequence segments of hypsizigus marmoreus genomes, the SSR primers are good in amplification band type and high in repeatability, and detailed marker information is shown in a table 1:
TABLE 1 SSR tag detailed information List
Figure BDA0002932684450000021
The invention relates to a method for constructing an SSR marker fingerprint of a Hypsizigus marmoreus Finc-B-7 strain, which comprises the following steps:
(1) Hypha culture: inoculating Hypsizigus marmoreus strain to potato glucose agar solid culture medium, culturing at 22 deg.C for 10-14d, and collecting mycelium;
(2) Extraction of genomic DNA: the fungal DNA extraction kit is used, the genomic DNA is extracted according to the kit experimental steps, and 2 mu L of DNA is taken for carrying out 1.2% agarose gel electrophoresis detection. Detecting the concentration and purity of the total genome DNA by an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be consistent;
(3) SSR molecular marker primer development: selecting a polymorphic sequence to design an SSR primer and synthesizing according to the genome re-sequencing result of the hypsizigus marmoreus strain;
(4) Detection of SSR molecular markers: carrying out PCR amplification of gene SSR markers on the extracted DNA;
(5) And (3) electrophoresis detection: mixing the product obtained by PCR amplification with formamide sample adding buffer solution, denaturing, and detecting on a machine;
(6) GeneMapper data analysis.
The method for constructing the SSR marker fingerprint of the Hypsizigus marmoreus Finc-B-7 strain is characterized by comprising the following steps of: the step (2) of extracting the genome DNA comprises the following specific steps:
(1) Adding a fungus sample into liquid nitrogen for fully grinding;
(2) Rapidly adding 360 mu LBuffersSTE and 40 mu L Buffer SDS into the ground powder, rapidly vortexing and uniformly mixing, placing the centrifugal tube in a water bath at 65 ℃ for 15min, and reversing the centrifugal tube in the water bath process to mix the sample for a plurality of times;
(3) Adding 5 μ L RNase Solution into the lysate, mixing by vortex, and standing at room temperature for 15-30min;
(4) Adding 140 μ L Buffer PS, vortexing and shaking for 30s, and standing on ice for 10min;
(5) 13000g was centrifuged for 5min at room temperature, and 400. Mu.L of the supernatant was carefully transferred to a new centrifuge tube;
(6) Adding 600 mu L of Buffer PBD into the sample, and uniformly mixing by vortex for 30s;
(7) Loading the DNA binding column in a collecting tube, transferring half of the mixed solution to the column, and centrifuging at 8000g for 1min;
(8) Pouring off the filtrate, putting the column back into the collecting pipe, transferring the residual mixed solution into the column, and centrifuging for 1min at 8000 g;
(9) Pouring the filtrate and putting the column back into the collecting pipe, adding 600 mu L of Buffer GW2 into the column, and centrifuging for 1min at 8000 g;
(10) Repeating the step 9;
(11) Pouring off the filtrate, putting the column back into the collecting pipe, centrifuging for 2min at 10000g to remove the residual ethanol in the column;
(12) Transferring the column to a new 1.5mL centrifuge tube, adding 30. Mu.L of Buffer AE preheated to 65 ℃ to the center of the membrane of the column, standing at room temperature for 2min, and centrifuging at 10000g for 1min;
(13) mu.L of DNA was subjected to 1.2% agarose gel electrophoresis, 2. Mu.L of DNA was subjected to NanoDrop spectrophotometry, and the remaining DNA was stored at-20 ℃.
The PCR amplification system in the step (3) is as follows: total volume 10 μ L, including: 10 XPCR buffer1 uL, 2.5mmol/L dNTP 0.8 uL, 5U/uL TAKARA HSTaq enzyme 0.1 uL, 5 umol/L TP-M130.5 uL, 5 umol/L SSR mark specific primer total volume 0.6 uL respectively, concentration 20 ng-30 ng/uLThe template DNA taken is 1.2 mu L, ddH 2 O 5.2μL;
And (3) PCR reaction conditions: 5min at 95 ℃; 30s at 95 ℃, 30s at 59 ℃, 30s at 72 ℃ and 30 cycles; 5min at 95 ℃; 30s at 95 ℃, 30s at 53 ℃, 30s at 72 ℃ and 10 cycles; 30min at 60 ℃.
The sample adding buffer solution in the step (5) is 9 mu L of a molecular weight internal standard and formamide mixed solution (0.5; the amount of the PCR amplification product added was 1. Mu.L.
The specific process of denaturation in the step (5) is to denature at 95 ℃ for 3min, and then to cool in an ice-water mixture for 3min.
The electrophoresis in the step (5) has the following process parameters: the modified polyacrylamide gel is commercial POP7 gel, the electrophoresis buffer solution is 3730buffer EDTA, the injection voltage is 2000V, the operation voltage is 15000V, the sample injection time is 10s, the temperature is 60 ℃, the capillary length is 50cm, the power is 200W, the electrophoresis is performed for 20min, and the current and the power are dynamic.
The data analysis in the step (6) specifically comprises the following steps: and (3) importing the detected original data file into analysis software GeneMapper ID3.2, and performing group structure analysis, clustering and heterozygosity analysis and core germplasm resource calculation analysis by using software such as POPGENE, NTSYS and the like. Allele factors (Na, ne), nei's genetic diversity index (He), shannon's diversity information index (I) and gene observation heterozygosity (Ho) were analyzed.
TABLE 2 summary of allelic fragment information from SSR primer amplification
Figure BDA0002932684450000041
Figure BDA0002932684450000051
Figure BDA0002932684450000061
The invention discloses an application of SSR marker fingerprint of hypsizigus marmoreus 'Finc-B-7' strain, which is characterized in that 6 pairs of SSR primers developed by simple repetitive sequence segments of hypsizigus marmoreus genomes are utilized, a large number of SSR primers are screened, the number and the number of allelic fragments of the 6 pairs of SSR primers amplified in each hypsizigus marmoreus cultivated variety are determined and numbered (table 2) by performing banding amplification on the SSR primers of 56 collected hypsizigus marmoreus main cultivated varieties, and the 'Finc-B-7' strain can be effectively identified in 56 collected main cultivated varieties by the number combination of different SSR allelic sites. The relative molecular weight of the allelic site amplified by each SSR primer can be determined by analyzing through capillary electrophoresis combined software, the strain with the specific SSR allelic fragment combination of the strain 'Finc-B-7' is the strain 'Finc-B-7' of hypsizygus marmoreus, and the numbering combination of the strain is as follows: 17/(9+8)/5/6/(13+16)/(7+9+11+4).
The invention has the beneficial effects that: compared with conventional morphological detection, antagonism test and fruiting test, the method has the advantages of short detection time, high accuracy and good repeatability. The operation time required for detection is within 24h (including genome DNA extraction, PCR amplification, electrophoresis analysis and data analysis), while the time required for a conventional antagonism test is at least two weeks, and the time required for a fruiting test is at least 3 months; the method has specificity of 'Finc-B-7' in the collected 56 commercial hypsizigus marmoreus main culture strains, and has good application prospect.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the description of the embodiments will be briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without inventive exercise. Wherein:
FIG. 1 is a diagram of the relative molecular weight peaks of the allelic sites obtained by sequentially detecting the primer HMSSR5 in the selected hypsizigus marmoreus cultivation material 'Finc-B-7' and several main cultivation commercial varieties respectively;
FIG. 2 is a diagram of the peaks of the relative molecular weights of the allelic sites obtained by the primer HMSSR26 respectively and sequentially detected in the selected hypsizigus marmoreus cultivation material "Finc-B-7" and several main cultivation commercial varieties;
FIG. 3 is a diagram of the relative molecular weight peaks of the allelic sites obtained by sequentially detecting the primer HMSSR47 in the selected hypsizigus marmoreus cultivation material 'Finc-B-7' and several main cultivation commercial varieties respectively;
FIG. 4 is a diagram of the peaks of the relative molecular weights of the allelic sites obtained by the primer HMSSR48 respectively and sequentially detected in the selected hypsizigus marmoreus cultivation material "Finc-B-7" and several main cultivation commercial varieties;
FIG. 5 is a diagram of the peaks of the relative molecular weights of the allelic sites obtained by the primer HMSSR51 sequentially detected in the selected Hypsizygus marmoreus cultivation material "Finc-B-7" and several main cultivation commercial varieties respectively;
FIG. 6 is a diagram showing the relative molecular weight peaks of the allelic sites of the primer HMSSR59 detected in sequence in the selected Hypsizygus marmoreus cultivation material "Finc-B-7" and several main cultivation commercial varieties, respectively.
Detailed Description
In order to make the aforementioned objects, features and advantages of the present invention more comprehensible, embodiments accompanying specific embodiments of the present invention are described in detail below.
In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, but the present invention may be practiced in other ways than those specifically described and will be readily apparent to those of ordinary skill in the art without departing from the spirit of the present invention, and therefore the present invention is not limited to the specific embodiments disclosed below.
Furthermore, reference herein to "one embodiment" or "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one implementation of the invention. The appearances of the phrase "in one embodiment" in various places in the specification are not necessarily all referring to the same embodiment, nor are separate or alternative embodiments mutually exclusive of other embodiments.
Example 1:
(1) Hypha culture: inoculating Hypsizigus marmoreus strain to potato glucose agar solid culture medium, culturing at 22 deg.C for 10d, and collecting mycelium;
(2) Extraction of genomic DNA: the fungal DNA extraction kit is used, the genomic DNA is extracted according to the kit experimental steps, and 2 mu L of DNA is taken for carrying out 1.2% agarose gel electrophoresis detection. Detecting the concentration and purity of the total genome DNA by an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be consistent;
the process for extracting the genome DNA of hyphae by the CTAB method comprises the following steps:
(1) adding a fungus sample into liquid nitrogen for fully grinding;
(2) adding 360 mu L of Buffer STE and 40 mu L of Buffer SDS into the ground powder quickly, quickly whirling and uniformly mixing, placing the centrifuge tube in a water bath at 65 ℃ for 15min, and reversing the centrifuge tube in the water bath process to mix the sample for a plurality of times;
(3) adding 5 mu L of RNase Solution into the lysate, uniformly mixing by vortex, and standing for 15-30min at room temperature;
(4) adding 140 mu L of Buffer PS, vortexing and shaking for 30s, and standing on ice for 10min;
(5) 13000g was centrifuged for 5min at room temperature, and 400. Mu.L of the supernatant was carefully transferred to a new centrifuge tube;
(6) add 600. Mu.L Buffer PBD (diluted with absolute ethanol) to the sample, vortex and mix for 30s;
(7) loading the DNA binding column in a collecting tube, transferring half of the mixed solution to the column, and centrifuging at 8000g for 1min;
(8) pouring off the filtrate, putting the column back into the collecting pipe, transferring the residual mixed solution into the column, and centrifuging for 1min at 8000 g;
(9) pouring the filtrate and putting the column back into the collecting pipe, adding 600 μ L Buffer GW2 (diluted with absolute ethyl alcohol) into the column, and centrifuging at 8000g for 1min;
r repeats step 9;
Figure BDA0002932684450000081
pouring off the filtrate, putting the column back into the collecting pipe, centrifuging at 10000g for 2min to remove the residual ethanol in the column;
Figure BDA0002932684450000082
the column was transferred to a fresh 1.5mL centrifuge tube and 30. Mu.L of preheat addedBuffer AE at 65 ℃ reaches the center of the membrane of the column, standing at room temperature for 2min, and centrifuging at 10000g for 1min;
Figure BDA0002932684450000083
mu.L of DNA was subjected to 1.2% agarose gel electrophoresis, 2. Mu.L of DNA was subjected to NanoDrop spectrophotometry, and the remaining DNA was stored at-20 ℃.
(3) Detection of SSR molecular markers: carrying out PCR amplification of gene SSR markers on the extracted DNA;
the PCR amplification system is as follows: total volume 10 μ L, including: 10 XPCR buffer1 uL, 2.5mmol/L dNTP 0.8 uL, 5U/uL TAKARA HSTaq enzyme 0.1 uL, 5 umol/L TP-M130.5 uL, 5 umol/L SSR mark specific primer total volume 0.6 uL respectively, concentration 20 ng-30 ng/uL extracted template DNA 1.2 uL, ddH 2 O 5.2μL;
And (3) PCR reaction conditions: 5min at 95 ℃; 30s at 95 ℃, 30s at 59 ℃, 30s at 72 ℃ and 30 cycles; 5min at 95 ℃; 30s at 95 ℃, 30s at 53 ℃, 30s at 72 ℃ and 10 cycles; 30min at 60 ℃.
(4) Electrophoresis detection: mixing 1 μ L of the product obtained by PCR amplification with 9 μ L of sample buffer solution, denaturing at 95 deg.C for 3min, and cooling in ice water mixture for 3min; 3 mu L of sample is applied to a modified polyacrylamide gel for electrophoresis, the modified polyacrylamide gel is commercial POP7 gel, the electrophoresis buffer solution is 3730buffer EDTA, the injection voltage is 2000V, the operation voltage is 15000V, the sample injection time is 10s, the temperature is 60 ℃, the length of a capillary is 50cm, the power is 200W, the electrophoresis is 20min, the current and the power are dynamic,
(5) Analysis of results
Performing PCR amplification and capillary electrophoresis on the hypsizigus marmoreus strain by adopting 6 pairs of SSR primers, and finding a coincidence code combination by analyzing the allelic gene factors (Na, ne), the Nei's genetic diversity index (He), the shannon's diversity information index (I) and the gene observation heterozygosity (Ho) in combination with the peak diagram of the relative molecular weight of the allelic site: HMSSR5, HMSSR26, HMSSR47, HMSSR48, HMSSR51, HMSSR59, the corresponding banding patterns are: 17/(9 + 8)/5/6/(13 + 16)/(7 +9+11+ 4), and the strain is determined to be the Hypsizigus marmoreus Finc-B-7 strain. To ensure the accuracy of the identification, three replicates were recommended.
In the case of several main commercial varieties, the peak patterns of the relative molecular weights of the allelic sites obtained by sequential detection of 6 pairs of primers are shown in FIGS. 1 to 6 (sequentially (1 Finc-B-7 (2); K (3); B2 (4); 15-X2 (5); 14-X1 (6); 13-X6 (7); BS027 (8); X5 DTG at R); 9)
Figure BDA0002932684450000091
B4)。
The fingerprint spectrum of the invention refers to the combination of the primer and the band type thereof.
It should be noted that the above-mentioned embodiments are only for illustrating the technical solutions of the present invention and not for limiting, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, which should be covered by the claims of the present invention.
Sequence listing
<110> Shanghai Fengchi Biotechnology Ltd
<120> SSR marker fingerprint of Hypsizigus marmoreus Finc-B-7 strain, construction method and application thereof
<130> 2021020304-zf-wjn
<141> 2021-02-03
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cacaccttac gaggtgagca 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tgtttgatgt tagccgaacg 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gtgattgggt tcgtgtcgtc 20
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
acctcgagct caacttctgc 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
tctcatggaa cgacctggag 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tccaaatcca gactcttcgc 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gccgtgtgac accaaataca 20
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
acatctaacc gacccacgac 20
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
caccccctca tcctacacat 20
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
tggtcagaag aaacgtcgtg 20
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
cactgttcca gagtgggacc 20
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
agggcctttt cagagacgat 20

Claims (2)

1. A fingerprint identification method of SSR markers of hypsizigus marmoreus Finc-B-3 strains is characterized by comprising the following steps: the fingerprint consists of 6 SSR marker loci, and the specific sequences of 6 corresponding pairs of primers are as follows:
HMSSR5 forward primer: CACACCTTACGAGGTGAGCA;
reverse primer: tgtttgtgttagccgaacg;
HMSSR18 forward primer: GAGGATTAAGGGGACTGTCG;
reverse primer: CCTCATCCTCCGACTCTACG;
HMSSR22 forward primer: TGCTGGTGAGTGAGTGAGTGGAG;
reverse primer: ACGGCGACATATCTGCT;
HMSSR38 forward primer: TCTTCTTGTTCGGCGGTATC;
reverse primer: ATCCGGCACAGGTAAAGATG;
HMSSR47 forward primer: TCTCATGGAACGACCTGGAG;
reverse primer: TCCAAATCCAGACTTCGC;
HMSSR51 forward primer: CACCCCCTCATCCTACACAT;
reverse primer: tggtcagagaaaacgtcgtg;
the corresponding combination of the belt type numbers is as follows: (7 + 12)/4/(1 + 2)/(1 + 5)/(2 +3+ 6)/(2 + 3);
wherein the band type corresponding to the primer HMSSR5 is numbered 7+12, the size of the allelic gene fragment band corresponding to the primer HMSSR5 is 199 to 199.99bp, and the size of the allelic gene fragment band corresponding to the primer HMSSR5 is 237 to 237.99bp; the corresponding band type number of the primer HMSSR18 is 4, and the size of the corresponding allele fragment band is 262 to 262.99bp; the band type corresponding to the primer HMSSR22 is numbered 1+2, wherein the size of the allele fragment corresponding to the number 1 is 174 to 174.99bp, and the size of the allele fragment corresponding to the number 2 is 177 to 177.99bp; the band type corresponding to the primer HMSSR38 is numbered 1+5, wherein the size of the allelic gene fragment band corresponding to the number 1 is 171 to 171.99bp, and the size of the allelic gene fragment band corresponding to the number 5 is 179 to 179.99bp; the tape type corresponding to primer HMSSR47 is coded as 2+3+6, wherein the size of the allelic gene fragment corresponding to the coded 2 is 141 to 141.99bp, the size of the allelic gene fragment corresponding to the coded 3 is 144 to 144.99bp, and the size of the allelic gene fragment corresponding to the coded 6 is 155 to 155.99bp; the band type number corresponding to the primer HMSSR51 is 2+3, wherein the size of the allele fragment band corresponding to the number 2 is 185 to 185.99bp, and the size of the allele fragment band corresponding to the number 3 is 199 to 199.99bp;
the preservation number of the hypsizigus marmoreus Finc-B-3 strain is CGMCC No.11204.
2. The application of the SSR marked fingerprint of the Hypsizigus marmoreus Finc-B-3 strain according to claim 1 is characterized in that: the fingerprint of the SSR marker of the hypsizigus marmoreus Finc-B-3 strain is used for identifying the specific allelic variation of the hypsizigus marmoreus Finc-B-3 strain and/or identifying the specificity of the hypsizigus marmoreus Finc-B-3 strain.
CN202110153272.5A 2021-02-03 2021-02-03 SSR marker fingerprint of Hypsizigus marmoreus Finc-B-7 strain as well as construction method and application thereof Active CN112746126B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110153272.5A CN112746126B (en) 2021-02-03 2021-02-03 SSR marker fingerprint of Hypsizigus marmoreus Finc-B-7 strain as well as construction method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110153272.5A CN112746126B (en) 2021-02-03 2021-02-03 SSR marker fingerprint of Hypsizigus marmoreus Finc-B-7 strain as well as construction method and application thereof

Publications (2)

Publication Number Publication Date
CN112746126A CN112746126A (en) 2021-05-04
CN112746126B true CN112746126B (en) 2023-02-28

Family

ID=75653630

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110153272.5A Active CN112746126B (en) 2021-02-03 2021-02-03 SSR marker fingerprint of Hypsizigus marmoreus Finc-B-7 strain as well as construction method and application thereof

Country Status (1)

Country Link
CN (1) CN112746126B (en)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
"真姬菇微卫星分子标记的开发及其种质资源分析";董岩;<万方数据>;20101231;第四章、表4.1 *

Also Published As

Publication number Publication date
CN112746126A (en) 2021-05-04

Similar Documents

Publication Publication Date Title
CN112746125A (en) SSR marker fingerprint of hypsizigus marmoreus hunhua No. 8 strain and construction method and application thereof
CN113005219A (en) SSR marker fingerprint identification method of hypsizigus marmoreus Rongbai 001(F) strain, construction method and application thereof
CN112746126B (en) SSR marker fingerprint of Hypsizigus marmoreus Finc-B-7 strain as well as construction method and application thereof
CN112813183B (en) SSR marker fingerprint of Hypsizigus marmoreus Finc-B-6 strain and construction method and application thereof
CN112708696B (en) SSR marker fingerprint of Hypsizigus marmoreus Finc-F-4 strain and construction method and application thereof
CN112695129B (en) SSR marker fingerprint of hypsizigus marmoreus hunshi No. 12 strain and construction method and application thereof
CN112795687B (en) SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM21 strain as well as construction method and application thereof
CN112877457B (en) SSR (simple sequence repeat) labeled fingerprint spectrum of hypsizigus marmoreus HM6 strain as well as construction method and application of SSR labeled fingerprint spectrum
CN112708694B (en) SSR marker fingerprint of Hypsizigus marmoreus Finc-B-3 strain and construction method and application thereof
CN112813182B (en) SSR marker fingerprint of hypsizigus marmoreus Huzhen No. 23 strain as well as construction method and application thereof
CN112695130B (en) SSR marker fingerprint of hypsizigus marmoreus Huzhen No. 22 strain and construction method and application thereof
CN112795681B (en) SSR (simple sequence repeat) labeled fingerprint spectrum of hypsizigus marmoreus HM18 strain as well as construction method and application of SSR labeled fingerprint spectrum
CN112795688B (en) SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM13 strain as well as construction method and application thereof
CN112760406B (en) SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM22 strain as well as construction method and application thereof
CN112877458B (en) SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM36 strain as well as construction method and application thereof
CN112795686B (en) SSR marker fingerprint of hypsizigus marmoreus Huzhen 18 strain and construction method and application thereof
CN112795680B (en) SSR marker fingerprint of Hypsizigus marmoreus Finc-N-11 strain and construction method and application thereof
CN112708695B (en) SSR marker fingerprint of Hypsizigus marmoreus Finc-W-247 strain and construction method and application thereof
CN112746128B (en) SSR (simple sequence repeat) marker fingerprint of hypsizigus marmoreus HM3 strain, and construction method and application thereof
CN112695131B (en) SSR (simple sequence repeat) marker fingerprint of Shanghai Zhen 29 strain of hypsizigus marmoreus, construction method and application thereof
CN112795685A (en) SSR marker fingerprint of hypsizigus marmoreus Huzhen No. 11 strain and construction method and application thereof
CN112760404A (en) SSR marker fingerprint of Hypsizigus marmoreus Finc-B-5 strain and construction method and application thereof
CN112795683A (en) SSR marker fingerprint of hypsizigus marmoreus hunshi No. 20 strain and construction method and application thereof
CN112695127A (en) SSR marker fingerprint of hypsizigus marmoreus hunhua No. 2 strain and construction method and application thereof
CN112795682A (en) SSR marker fingerprint of hypsizigus marmoreus Huzhen No. 6 strain and construction method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20240404

Address after: 201401, No. 968 Gaofeng Road, Fengxian Modern Agricultural Park, Fengxian District, Shanghai (one photo multiple site enterprise)

Patentee after: Shanghai Finc Bio-tech Inc.

Country or region after: China

Patentee after: HEBEI FENGKE BIOTECHNOLOGY CO.,LTD.

Address before: 201400 no.968, Gaofeng Road, Fengxian Modern Agricultural Park, Fengxian District, Shanghai

Patentee before: Shanghai Finc Bio-tech Inc.

Country or region before: China