CN112813182B - SSR marker fingerprint of hypsizigus marmoreus Huzhen No. 23 strain as well as construction method and application thereof - Google Patents

Abstract

The invention discloses an SSR marker fingerprint of hypsizygus marmoreus Huyan No. 23 strain and a construction method and application thereof, wherein the fingerprint consists of 6 pairs of SSR markers. The construction method comprises the following steps: (1) hypha culture; (2) extracting genome DNA; (3) detecting SSR molecular markers; and (4) detecting by capillary electrophoresis. The application comprises the following steps: SSR marker amplification is carried out on the hypsizygus marmoreus strain, the obtained banding pattern is compared with the fingerprint spectrum, and the hypsizygus marmoreus strain Shanghai No. 23 strain is obtained if the banding pattern is consistent with the fingerprint spectrum. Compared with conventional morphological detection, antagonism test and fruiting test, the method has the advantages of short detection time, high accuracy and good repeatability, and has the specificity of the Huzhen No. 23 strain of hypsizygus marmoreus in the collected 56 main culture strains for hypsizygus marmoreus cultivation at home and abroad.

Description

SSR marker fingerprint of hypsizygus marmoreus hunger No. 23 strain as well as construction method and application thereof

Technical Field

The invention belongs to the technical field of detection of hypsizygus marmoreus strains, and particularly relates to an SSR marker fingerprint of hypsizygus marmoreus strain Huzhen No. 23, and a construction method and application thereof.

Background

Hypsizigus marmoreus (Peck) H.E.Bigelow, a species of Basidiomycota, agaricales, lyophyllaceae, is named due to marble patches on the surface of its pileus. The seafood soup is attractive in appearance, crisp and tender in texture, unique in seafood flavor and economical in price, and is popular with consumers. The hypsizigus marmoreus not only contains abundant vitamins and 18 amino acids, but also has the functions of hemolysis, antioxidation, leukemia and lymphoma cell inhibition, blood fat reduction, inflammation resistance, antioxidation and the like in components such as micromolecular compounds, polysaccharide, polypeptide and the like contained in the hypsizigus marmoreus through recent research, and is edible and medicinal fungi with high economic value. Since the first industrialized hypsizigus marmoreus cultivation enterprise in China established in 2001, hypsizigus marmoreus becomes one of the novel edible fungi which are rapidly developed in the market in China. The total industrial production of the hypsizigus marmoreus in 2019 is 32.8 ten thousand tons, the yield is increased by 58.63 percent in comparison with that in 2018, the yield accounts for 9.6 percent of the total industrial production of the edible fungi, and the highest rank is found in the total production of the edible fungi in industrial cultivation in China.

The high-quality strain plays a very important role in the industrial cultivation of hypsizigus marmoreus. At present, hypsizigus marmoreus strains used by industrialized production enterprises in China are mainly introduced into Japan or further bred by hybridization on the basis of the introduced strains, the cultivated hypsizigus marmoreus has brown fruiting bodies called as crab-flavor mushrooms, and the cultivated hypsizigus marmoreus has white fruiting bodies called as white beech mushrooms or yulong mushrooms. Although the yield of factory production is improved year by year, partial strains still have the problems of long cultivation period, low yield per unit, poor appearance uniformity of single fruiting body, easy occurrence of cap formation and the like, and the defects can cause the increase of production cost and reduce the market competitiveness of products. On the other hand, the strain diversity of the hypsizigus marmoreus factory production strain is not high, the product appearance is similar, and the diversified demands of market consumers cannot be met. The method has rich wild and natural hypsizigus marmoreus cultivation resources in China, efficiently utilizes the high-quality resources, expands the genetic basis of strains, and is beneficial to breeding of high-yield, high-quality and characteristic hypsizigus marmoreus strains in China.

With the promulgation and implementation of the protection law of new species of international plants, the establishment of a mature, rapid and accurate molecular biology identification technical system becomes a powerful means for protecting the intellectual property rights of edible fungus varieties.

Disclosure of Invention

The invention aims to solve the technical problem of providing an SSR marker fingerprint of the hypsizygus marmoreus strain Huzhen No. 23 and a construction method and application thereof, wherein the fingerprint has the advantages of short detection time, high accuracy and good repeatability compared with the conventional morphological detection, antagonistic test and fruiting test.

Hypsizygus marmoreus (Hypsizygus marmoreus) Huzhen No. 23 is preserved in Guangdong province microbial strain preservation center in 12.2.2020, and is addressed to Guangzhou city Jieli Zhonglu No. 100 college No. 59 building 5, guangdong province microbial research institute, and the preservation number is GDMCC No. 61407.

The SSR marker fingerprint of the hypsizigus marmoreus strain Huzhen No. 23 consists of 6 pairs of SSR markers, is an SSR primer developed based on simple repetitive sequence fragments of hypsizigus marmoreus genome, has good amplification band type and high repeatability, and has detailed marker information shown in a table 1:

TABLE 1 SSR tag detailed information List

The invention relates to a method for constructing an SSR marker fingerprint of a hypsizygus marmoreus strain Huzhen No. 23, which comprises the following steps:

(1) Hypha culture: inoculating Hypsizigus marmoreus strain to potato glucose agar solid culture medium, culturing at 22 deg.C for 10-14d, and collecting mycelium;

(2) Extraction of genomic DNA: the fungal DNA extraction kit is used, the genomic DNA is extracted according to the kit experimental steps, and 2 mu L of DNA is taken for carrying out 1.2% agarose gel electrophoresis detection. Detecting the concentration and purity of the total genome DNA by an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be consistent;

(3) SSR molecular marker primer development: selecting a polymorphic sequence to design an SSR primer and synthesizing according to the genome re-sequencing result of the hypsizigus marmoreus strain;

(4) Detection of SSR molecular markers: carrying out PCR amplification of gene SSR markers on the extracted DNA;

(5) And (3) electrophoresis detection: mixing the product obtained by PCR amplification with formamide sample adding buffer solution, denaturing, and detecting on a computer;

(6) GeneMapper data analysis.

The method for constructing the SSR marker fingerprint of the hypsizygus marmoreus hunger No. 23 strain is characterized by comprising the following steps of: the step (2) of extracting the genome DNA comprises the following specific steps:

(1) Adding a fungus sample into liquid nitrogen for fully grinding;

(2) Adding 360 μ l of Buffer STE and 40 μ l of Buffer SDS into the ground powder rapidly, quickly whirling and mixing uniformly, placing the centrifuge tube in a water bath at 65 ℃ for 15min, and reversing the centrifuge tube in the water bath process to mix the sample for several times;

(3) Adding 5 μ L RNase Solution into the lysate, mixing by vortex, and standing at room temperature for 15-30min;

(4) Adding 140 μ L Buffer PS, vortexing and shaking for 30s, and standing on ice for 10min;

(5) 13000g was centrifuged for 5min at room temperature, and 400. Mu.L of the supernatant was carefully transferred to a new centrifuge tube;

(6) Adding 600 mu.L Buffer PBD into the sample, and uniformly mixing for 30s by vortex;

(7) Loading the DNA binding column in a collecting tube, transferring half of the mixed solution to the column, and centrifuging at 8000g for 1min;

(8) Pouring off the filtrate, putting the column back into the collecting pipe, transferring the residual mixed solution into the column, and centrifuging for 1min at 8000 g;

(9) Pouring the filtrate, putting the column back into the collecting pipe, adding 600 uL Buffer GW2 into the column, and centrifuging for 1min at 8000 g;

(10) Repeating the step 9;

(11) Pouring off the filtrate, putting the column back into the collecting pipe, centrifuging for 2min at 10000g to remove the residual ethanol in the column;

(12) Transferring the column to a new 1.5ml centrifuge tube, adding 30 μ L of Buffer AE preheated to 65 deg.C to the center of the membrane of the column, standing at room temperature for 2min, and centrifuging at 10000g for 1min;

(13) mu.L of DNA was subjected to 1.2% agarose gel electrophoresis, 2. Mu.L of DNA was subjected to NanoDrop spectrophotometry, and the remaining DNA was stored at-20 ℃.

The PCR amplification system in the step (3) is as follows: total volume 10 μ L, including: 10 XPCR buffer1 uL, 2.5mmol/L dNTP 0.8 uL, 5U/uL TAKARA HSTaq enzyme 0.1 uL, 5 umol/L TP-M130.5 uL, 5 umol/L SSR mark specific primer total volume 0.6 uL each, concentration 20 ng-30 ng/uL extracted template DNA 1.2 uL，ddH ₂ O 5.2μL；

And (3) PCR reaction conditions: 5min at 95 ℃; 30second, at 95 ℃, 30second, at 72 ℃, 30second, for 30 cycles; 5min at 95 ℃; 30second at 95 ℃, 30second at 53 ℃, 30second at 72 ℃,10 cycles; 30min at 60 ℃.

The sample adding buffer solution in the step (5) is 9 mu L of a molecular weight internal standard and formamide mixed solution (0.5; the amount of the PCR amplification product added was 1. Mu.L.

The specific process of denaturation in the step (5) is to denature at 95 ℃ for 3min, and then to cool in an ice-water mixture for 3min.

The electrophoresis in the step (5) has the following process parameters: the modified polyacrylamide gel is commercial POP7 gel, the electrophoresis buffer solution is 3730buffer EDTA, the injection voltage is 2000V, the operation voltage is 15000V, the sample introduction time is 10s, the temperature is 60 ℃, the capillary length is 50cm, the power is 200W, the electrophoresis is 20min, and the current and the power are dynamic.

The data analysis in the step (6) is specifically as follows: and (3) importing the detected original data file into analysis software GeneMapper ID3.2, and performing group structure analysis, clustering and heterozygosity analysis and core germplasm resource calculation analysis by using POPGENE, NTSYS and other software. Allele factors (Na, ne), nei's genetic diversity index (He), shannon's diversity information index (I) and gene observation heterozygosity (Ho) were analyzed.

TABLE 2 summary of allelic fragment information from SSR primer amplification

The invention relates to application of SSR marker fingerprints of a hypsizygus marmoreus strain Hu Zhen 23, which is characterized in that 6 pairs of SSR primers developed by simple repetitive sequence fragments of hypsizygus marmoreus genomes are utilized, a large number of SSR primers are screened, the number of allelic fragments amplified by the 6 pairs of SSR primers in each hypsizygus marmoreus cultivated variety is determined and numbered (table 2) through SSR primer banding amplification of 56 collected hypsizygus marmoreus main cultivated varieties, and the strain Hu Zhen 23 can be effectively identified in the 56 collected main cultivated varieties through the numbered combination of different SSR allelic sites. The relative molecular weight of the allelic locus amplified by each SSR primer can be determined by analyzing by capillary electrophoresis combined with software, the strain with the Huzhen No. 23 strain specific SSR allelic fragment combination is the Hypsizygus marmoreus Huzhen No. 23 strain, and the serial number combination of the strain is as follows: 5/5/(4+6)/(2+9)/8/(9+6).

The invention has the beneficial effects that: compared with conventional morphological detection, antagonism test and fruiting test, the method has the advantages of short detection time, high accuracy and good repeatability. The operation time required for detection is within 24h (including genome DNA extraction, PCR amplification, electrophoresis analysis and data analysis), while the time required for a conventional antagonism test is at least two weeks, and the time required for a fruiting test is at least 3 months; the method has the specificity of the Huzhen No. 23 strain in the collected 56 commercial hypsizygus marmoreus main culture strains, and has good application prospect.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required to be used in the description of the embodiments are briefly introduced below, and it is obvious that the drawings in the description below are only some embodiments of the present invention, and it is obvious for those skilled in the art that other drawings can be obtained according to the drawings without inventive labor. Wherein:

FIG. 1 is a diagram showing the relative molecular weight peaks of the allelic sites of the primer HMSSR3 detected in sequence in the selected Hypsizygus marmoreus cultivation material "Huzhen No. 23" and several main cultivation commercial varieties, respectively;

FIG. 2 is a diagram showing the relative molecular weight peaks of the allelic sites of the primer HMSSR12 detected in sequence in the selected Hypsizygus marmoreus cultivation material "Huzhen No. 23" and several main cultivation commercial varieties, respectively;

FIG. 3 is a diagram showing the relative molecular weight peaks of the allelic sites of the primer HMSSR31 detected in sequence in the selected Hypsizygus marmoreus cultivation material "Huzhen No. 23" and several main cultivation commercial varieties, respectively;

FIG. 4 is a diagram showing the relative molecular weight peaks of the allelic sites of the primer HMSSR36 detected in sequence in the selected Hypsizygus marmoreus cultivation material "Huzhen No. 23" and several main cultivation commercial varieties, respectively;

FIG. 5 is a diagram showing the relative molecular weight peaks of the allelic sites of the primer HMSSR47 detected in sequence in the selected Hypsizygus marmoreus cultivation material "Huzhen No. 23" and several main cultivation commercial varieties, respectively;

FIG. 6 is a diagram of the allelic site relative molecular weight peaks obtained by sequential detection of the primer HMSSR48 in the selected hypsizygus marmoreus cultivation material "Huzhen No. 23" and several main cultivation commercial varieties, respectively.

Detailed Description

In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with examples are described in detail below.

In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, but the present invention may be practiced in other ways than those specifically described and will be readily apparent to those of ordinary skill in the art without departing from the spirit of the present invention, and therefore the present invention is not limited to the specific embodiments disclosed below.

Furthermore, reference herein to "one embodiment" or "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one implementation of the invention. The appearances of the phrase "in one embodiment" in various places in the specification are not necessarily all referring to the same embodiment, nor are separate or alternative embodiments mutually exclusive of other embodiments.

Example 1:

(1) Hypha culture: inoculating Hypsizigus marmoreus strain to potato glucose agar solid culture medium, culturing at 22 deg.C for 10d, and collecting mycelium;

(2) Extraction of genomic DNA: the fungal DNA extraction kit is used, the genomic DNA is extracted according to the kit experimental steps, and 2 mu L of DNA is taken for carrying out 1.2% agarose gel electrophoresis detection. Detecting the concentration and purity of the total genome DNA by an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be consistent;

the process for extracting the genome DNA of hyphae by the CTAB method comprises the following steps:

(1) adding a fungus sample into liquid nitrogen for fully grinding;

(2) adding 360 mu L of Buffer STE and 40 mu L of Buffer SDS into the ground powder quickly, quickly whirling and uniformly mixing, placing the centrifuge tube in a water bath at 65 ℃ for 15min, and reversing the centrifuge tube in the water bath process to mix the sample for a plurality of times;

(3) adding 5 mu L of RNase Solution into the lysate, uniformly mixing by vortex, and standing for 15-30min at room temperature;

(4) adding 140 μ L Buffer PS, vortexing and shaking for 30s, and standing on ice for 10min;

(5) 13000g was centrifuged for 5min at room temperature, 400. Mu.L of the supernatant was carefully transferred to a new centrifuge tube;

(6) add 600. Mu.L Buffer PBD (diluted with absolute ethanol) to the sample, vortex and mix for 30s;

(7) loading the DNA binding column in a collecting tube, transferring half of the mixed solution to the column, and centrifuging at 8000g for 1min;

(8) pouring off the filtrate, putting the column back into the collecting pipe, transferring the residual mixed solution into the column, and centrifuging for 1min at 8000 g;

(9) pouring the filtrate and putting the column back into the collecting pipe, adding 600 μ L Buffer GW2 (diluted with absolute ethyl alcohol) into the column, and centrifuging at 8000g for 1min;

r repeats step 9;

pouring off the filtrate, putting the column back into the collecting pipe, centrifuging for 2min at 10000g to remove the residual ethanol in the column;

transferring the column to a new 1.5ml centrifuge tube, adding 30 μ L of Buffer AE preheated to 65 deg.C to the center of the membrane of the column, standing at room temperature for 2min, and centrifuging at 10000g for 1min;

mu.L of DNA was subjected to 1.2% agarose gel electrophoresis, 2. Mu.L of DNA was subjected to NanoDrop spectrophotometry, and the remaining DNA was stored at-20 ℃.

(3) Detection of SSR molecular markers: carrying out PCR amplification of gene SSR markers on the extracted DNA;

the PCR amplification system is as follows: total volume 10 μ L, including: 10 XPCR buffer1 uL, 2.5mmol/L dNTP 0.8 uL, 5U/uL TAKARA HSTaq enzyme 0.1 uL, 5 umol/L TP-M130.5 uL, 5 umol/L SSR mark specific primer total volume 0.6 uL respectively, concentration 20 ng-30 ng/uL extracted template DNA 1.2 uL, ddH ₂ O 5.2μL；

And (3) PCR reaction conditions: 5min at 95 ℃; 30second, at 95 ℃, 30second, at 72 ℃, 30second, for 30 cycles; 5min at 95 ℃; 30second at 95 ℃, 30second at 53 ℃, 30second at 72 ℃,10 cycles; 30min at 60 ℃.

(4) And (3) electrophoresis detection: mixing 1 μ L of the product obtained by PCR amplification with 9 μ L of sample buffer solution, denaturing at 95 deg.C for 3min, and cooling in ice water mixture for 3min; applying 3 microlitres of sample to a modified polyacrylamide gel for electrophoresis, wherein the modified polyacrylamide gel is commercial POP7 gel, the electrophoresis buffer solution is 3730buffer EDTA, the injection voltage is 2000V, the operation voltage is 15000V, the sample injection time is 10s, the temperature is 60 ℃, the length of a capillary is 50cm, the power is 200W, the electrophoresis is 20min, and the current and the power are dynamic,

(5) Analysis of results

Performing PCR amplification and capillary electrophoresis on the hypsizigus marmoreus strain by adopting 6 pairs of SSR primers, and finding a coincidence code combination by analyzing the allelic gene factors (Na, ne), the Nei's genetic diversity index (He), the shannon's diversity information index (I) and the gene observation heterozygosity (Ho) in combination with the peak diagram of the relative molecular weight of the allelic site: HMSSR3, HMSSR12, HMSSR31, HMSSR36, HMSSR47, HMSSR48, the corresponding banding patterns being: 5/5/(4 + 6)/(2 + 9)/8/(9 + 6) to determine the strain as the Huzhen No. 23 hypsizygus marmoreus strain. To ensure the accuracy of the identification, three replicates were recommended.

Taking several main cultivation commercial varieties as examples, 6 pairs of primers are given for sequential detectionThe peak patterns of the relative molecular weights of the allelic sites obtained were shown in FIGS. 1 to 6 (in this order, (1) Huzhen No. 23 (2) K (3B 2 (4))

B4)。

The fingerprint spectrum of the invention refers to the combination of the primer and the band type thereof.

It should be noted that the above-mentioned embodiments are only for illustrating the technical solutions of the present invention and not for limiting, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, which should be covered by the claims of the present invention.

Sequence listing

<110> Shanghai city academy of agricultural sciences

<120> SSR marker fingerprint of hypsizygus marmoreus Hu No. 23 strain as well as construction method and application thereof

<130> 2021020507-zf-wjn

<141> 2021-02-05

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gcgaaaccat attcatgcgt 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

attacttgtc gtcggcagga 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggcacggaca tagacctcat 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtggtggtgt gacgacgtat 20

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

acgacgcacc gtggtttat 19

<210> 6

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gtagggtagc ggcatcgtt 19

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tcttcttgta gagcgcctcg 20

<210> 8

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ctctcgacgc gtgttcct 18

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tctcatggaa cgacctggag 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tccaaatcca gactcttcgc 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gccgtgtgac accaaataca 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

acatctaacc gacccacgac 20

Claims (2)

1. A fingerprint identification method of SSR markers of Hypsizygus marmoreus Huzhen No. 23 strain is characterized in that: the fingerprint consists of 6 SSR marker loci, and the specific sequences of 6 corresponding pairs of primers are as follows:

HMSSR3 forward primer: gcgaaaccatatttcatgcgt;

reverse primer: ATTACTTGTTCGTCGGCAGGA;

HMSSR12 forward primer: GGCACGGACATAGACCTCAT;

reverse primer: GTGGTGGTGTGACGACGTAT;

HMSSR31 forward primer: ACGACGCACCGTGGTTTAT;

reverse primer: GTAGGGTAGCGGCATCGTT;

HMSSR36 forward primer: TCTTCTTGTAGAGCGCCTCG;

reverse primer: CTCGACGCGTGTTCCT;

HMSSR47 forward primer: TCTCATGGAACGACCTGGAG;

reverse primer: TCCAAATCCAGACTTCGC;

HMSSR48 forward primer: gccgtgaacacaaataca;

reverse primer: acatctaacccgacccgacgac;

the corresponding combination of the belt type numbers is as follows: 5/5/(4 + 6)/(2 + 9)/8/(9 + 6);

wherein the corresponding band type number of the primer HMSSR3 is 5, and the band size of the corresponding allele segment is 140 to 140.99bp;

the corresponding band type number of the primer HMSSR12 is 5, and the band size of the corresponding allele segment is 224-224.99bp;

the banding pattern corresponding to the primer HMSSR31 is numbered 4+6, wherein the banding size of the allele segment corresponding to the numbering 4 is 153 to 153.99bp, and the banding size of the allele segment corresponding to the numbering 6 is 166 to 166.99bp;

the band type number corresponding to the primer HMSSR36 is 2+9, wherein the band size of the allele segment corresponding to the number 2 is 153 to 153.99bp, and the band size of the allele segment corresponding to the number 9 is 169 to 169.99bp;

the corresponding band type number of the primer HMSSR47 is 8, and the band size of the corresponding allele segment is 156 to 156.99bp;

the band type number corresponding to the primer HMSSR48 is 9+6, wherein the band size of the allele segment corresponding to the number 9 is 116 to 116.99bp, and the band size of the allele segment corresponding to the number 6 is 121 to 121.99bp;

the preservation number of the hypsizigus marmoreus Huzhen No. 23 strain is GDMCC No. 61407.

2. The use of the SSR-labeled fingerprint of hypsizygus marmoreus hunger No. 23 strain according to claim 1, wherein the SSR-labeled fingerprint comprises the following components: the SSR-labeled fingerprint of the hypsizygus marmoreus Huzhen No. 23 strain is used for identifying the specific allelic variation of the hypsizygus marmoreus Huzhen No. 23 strain and/or identifying the specificity of the hypsizygus marmoreus Huzhen No. 23 strain.

Images