CN112795680B - SSR marker fingerprint of Hypsizigus marmoreus Finc-N-11 strain and construction method and application thereof - Google Patents

SSR marker fingerprint of Hypsizigus marmoreus Finc-N-11 strain and construction method and application thereof Download PDF

Info

Publication number
CN112795680B
CN112795680B CN202110153274.4A CN202110153274A CN112795680B CN 112795680 B CN112795680 B CN 112795680B CN 202110153274 A CN202110153274 A CN 202110153274A CN 112795680 B CN112795680 B CN 112795680B
Authority
CN
China
Prior art keywords
primer
strain
hypsizigus marmoreus
size
ssr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110153274.4A
Other languages
Chinese (zh)
Other versions
CN112795680A (en
Inventor
王楠
王富强
李兆鹏
李金鑫
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SHANGHAI FINC BIO-TECH Inc
Original Assignee
SHANGHAI FINC BIO-TECH Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by SHANGHAI FINC BIO-TECH Inc filed Critical SHANGHAI FINC BIO-TECH Inc
Priority to CN202110153274.4A priority Critical patent/CN112795680B/en
Publication of CN112795680A publication Critical patent/CN112795680A/en
Application granted granted Critical
Publication of CN112795680B publication Critical patent/CN112795680B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6858Allele-specific amplification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses an SSR marker fingerprint of a Hypsizygus marmoreus Finc-N-11 strain, a construction method and application thereof, wherein the fingerprint consists of 6 pairs of SSR markers. The construction method comprises the following steps: (1) hypha culture; (2) extracting genome DNA; (3) detecting SSR molecular markers; and (4) detecting by capillary electrophoresis. The application comprises the following steps: and performing SSR marker amplification on the hypsizigus marmoreus strain, comparing the obtained banding pattern with the fingerprint spectrum, and obtaining the hypsizigus marmoreus Finc-N-11 strain if the banding pattern is consistent with the fingerprint spectrum. Compared with conventional morphological detection, antagonism test and fruiting test, the method has the advantages of short detection time, high accuracy and good repeatability, and has the specificity of the hypsizigus marmoreus Finc-N-11 strain in 56 collected main culture strains for cultivating hypsizigus marmoreus at home and abroad.

Description

SSR marker fingerprint of Hypsizigus marmoreus Finc-N-11 strain and construction method and application thereof
Technical Field
The invention belongs to the technical field of detection of hypsizigus marmoreus strains, and particularly relates to an SSR marker fingerprint of a hypsizigus marmoreus Finc-N-11 strain as well as a construction method and application thereof.
Background
Hypsizigus marmoreus (Peck) H.E.Bigelow, a species of Basidiomycota, agaricales, lyophyllaceae, is named due to marble streaks on the surface of its pileus. The seafood soup is attractive in appearance, crisp and tender in texture, unique in seafood flavor and economical in price, and is popular with consumers. The hypsizigus marmoreus not only contains abundant vitamins and 18 amino acids, but also has the functions of hemolysis, antioxidation, leukemia and lymphoma cell inhibition, blood fat reduction, inflammation resistance, antioxidation and the like in components such as small molecular compounds, polysaccharides and polypeptides contained in the hypsizigus marmoreus through research in recent years, and is a fungus which is used as both food and medicine and has high economic value. Since the first industrialized culture enterprise of hypsizygus marmoreus in China established in 2001, hypsizygus marmoreus becomes one of novel edible fungi which are developed in markets of China quickly. The total industrial production of the hypsizigus marmoreus in 2019 is 32.8 ten thousand tons, the yield is increased by 58.63 percent in comparison with that in 2018, the yield accounts for 9.6 percent of the total industrial production of the edible fungi, and the highest rank is found in the total production of the edible fungi in industrial cultivation in China.
The high-quality strain plays a very important role in the industrial cultivation of hypsizigus marmoreus. At present, hypsizigus marmoreus strains used by industrialized production enterprises in China are mainly introduced into Japan or further bred by hybridization on the basis of the introduced strains, the cultivated hypsizigus marmoreus has brown fruiting bodies called as crab-flavor mushrooms, and the cultivated hypsizigus marmoreus has white fruiting bodies called as white beech mushrooms or yulong mushrooms. Although the yield of factory production is improved year by year, partial strains still have the problems of long cultivation period, low yield per unit, poor appearance uniformity of single fruiting body, easy occurrence of cap formation and the like, and the defects can cause the increase of production cost and reduce the market competitiveness of products. On the other hand, the strain diversity of the hypsizigus marmoreus factory production strain is not high, the product appearance is similar, and the diversified demands of market consumers cannot be met. The method has rich wild and natural hypsizigus marmoreus cultivation resources in China, efficiently utilizes the high-quality resources, expands the genetic basis of strains, and is beneficial to breeding of high-yield, high-quality and characteristic hypsizigus marmoreus strains in China.
With the promulgation and implementation of the protection law of new species of international plants, the establishment of a mature, rapid and accurate molecular biology identification technical system becomes a powerful means for protecting the intellectual property rights of edible fungus varieties.
Disclosure of Invention
The invention aims to solve the technical problem of providing an SSR marker fingerprint of a Hypsizygus marmoreus Finc-N-11 strain and a construction method and application thereof, wherein the fingerprint has the advantages of short detection time, high accuracy and good repeatability compared with conventional morphological detection, antagonism test and fruiting test.
Hypsizigus marmoreus Finc-N-11 was deposited at Guangdong province center for microorganism culture collection at 12.2.2020, with the address of Michelia furiosa No. 100, michelia furiosa No. 59, lou 5, guangdong province institute for microorganisms, and with the collection number GDMCC No. 61404.
The SSR marker fingerprint of the hypsizigus marmoreus 'Finc-N-11' strain consists of 6 pairs of SSR markers, SSR primers are developed based on simple repetitive sequence segments of hypsizigus marmoreus genomes, the SSR primers are good in amplification band type and high in repeatability, and detailed marker information is shown in a table 1:
TABLE 1 SSR tag detailed information List
Figure BDA0002932683900000021
The invention relates to a method for constructing an SSR marker fingerprint of a Hypsizigus marmoreus Finc-N-11 strain, which comprises the following steps:
(1) Hypha culture: inoculating Hypsizigus marmoreus strain to potato glucose agar solid culture medium, culturing at 22 deg.C for 10-14d, and collecting mycelium;
(2) Extraction of genomic DNA: the fungal DNA extraction kit is used, the genomic DNA is extracted according to the kit experimental steps, and 2 mu L of DNA is taken for carrying out 1.2% agarose gel electrophoresis detection. Detecting the concentration and purity of the total genome DNA by an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be consistent;
(3) SSR molecular marker primer development: selecting a polymorphic sequence to design an SSR primer and synthesizing according to the genome re-sequencing result of the hypsizigus marmoreus strain;
(4) Detection of SSR molecular markers: carrying out PCR amplification of gene SSR markers on the extracted DNA;
(5) And (3) electrophoresis detection: mixing the product obtained by PCR amplification with formamide sample adding buffer solution, denaturing, and detecting on a computer;
(6) GeneMapper data analysis.
3. The method for constructing an SSR marker fingerprint of a fidc-N-11 strain of hypsizygus marmoreus according to claim 2, which is characterized in that: the step (2) of extracting the genome DNA comprises the following specific steps:
(1) Adding a fungus sample into liquid nitrogen for fully grinding;
(2) Adding 360 mu l of BufferSTE and 40 mu l of Buffer SDS into the ground powder rapidly, quickly swirling and mixing uniformly, placing the centrifuge tube in a water bath at 65 ℃ for 15min, and reversing the centrifuge tube in the water bath process to mix the sample for a plurality of times;
(3) Adding 5 mu L of RNase Solution into the lysate, uniformly mixing by vortex, and standing for 15-30min at room temperature;
(4) Adding 140 μ L Buffer PS, vortexing and shaking for 30s, and standing on ice for 10min;
(5) 13000g was centrifuged for 5min at room temperature, and 400. Mu.L of the supernatant was carefully transferred to a new centrifuge tube;
(6) Adding 600 mu.L Buffer PBD into the sample, and uniformly mixing for 30s by vortex;
(7) Loading the DNA binding column in a collecting tube, transferring half of the mixed solution to the column, and centrifuging at 8000g for 1min;
(8) Pouring off the filtrate, loading the column back into the collecting pipe, transferring the rest mixed solution into the column, and centrifuging at 8000g for 1min;
(9) Pouring the filtrate, putting the column back into the collecting pipe, adding 600 uL Buffer GW2 into the column, and centrifuging for 1min at 8000 g;
(10) Repeating the step 9;
(11) Pouring off the filtrate, putting the column back into the collecting pipe, centrifuging for 2min at 10000g to remove the residual ethanol in the column;
(12) Transferring the column to a new 1.5ml centrifuge tube, adding 30 μ L of Buffer AE preheated to 65 deg.C to the center of the membrane of the column, standing at room temperature for 2min, and centrifuging at 10000g for 1min;
(13) mu.L of DNA was subjected to 1.2% agarose gel electrophoresis, 2. Mu.L of DNA was subjected to NanoDrop spectrophotometry, and the remaining DNA was stored at-20 ℃.
The PCR amplification system in the step (3) is as follows: total volume 10 μ Ι _, comprising: 10 XPCR buffer1 uL, 2.5mmol/L dNTP 0.8 uL, 5U/uL TAKARA HSTaq enzyme 0.1 uL, 5 umol/L TP-M130.5 uL, 5 umol/L SSR mark specific primer total volume each 0.6 uL, concentration 20 ng-30 ng/uL extracted template DNA 1.2 uL, ddH 2 O 5.2μL;
And (3) PCR reaction conditions: 5min at 95 ℃; 30second, at 95 ℃, 30second, at 59 ℃, 30second, at 72 ℃, for 30 cycles; 5min at 95 ℃; 30second at 95 ℃, 30second at 53 ℃, 30second at 72 ℃ for 10 cycles; 30min at 60 ℃.
The sample adding buffer solution in the step (5) is 9 mu L of a mixed solution of a molecular weight internal standard and formamide (0.5; the amount of the PCR amplification product added was 1. Mu.L.
The specific process of denaturation in the step (5) is to denature at 95 ℃ for 3min, and then to cool in an ice-water mixture for 3min.
The electrophoresis in the step (5) has the following process parameters: the modified polyacrylamide gel is commercial POP7 gel, the electrophoresis buffer solution is 3730buffer EDTA, the injection voltage is 2000V, the operation voltage is 15000V, the sample injection time is 10s, the temperature is 60 ℃, the capillary length is 50cm, the power is 200W, the electrophoresis is performed for 20min, and the current and the power are dynamic.
The data analysis in the step (6) is specifically as follows: and (3) importing the detected original data file into analysis software GeneMapper ID3.2, and performing group structure analysis, clustering and heterozygosity analysis and core germplasm resource calculation analysis by using POPGENE, NTSYS and other software. Allele factors (Na, ne), nei's genetic diversity index (He), shannon's diversity information index (I) and gene observation heterozygosity (Ho) were analyzed.
TABLE 2 summary of allelic fragment information from SSR primer amplification
Figure BDA0002932683900000041
Figure BDA0002932683900000051
Figure BDA0002932683900000061
The invention discloses an application of SSR marker fingerprint of hypsizigus marmoreus 'Finc-N-11' strain, which is characterized in that 6 pairs of SSR primers developed by simple repetitive sequence segments of hypsizigus marmoreus genomes are utilized, a large number of SSR primers are screened, the number and the number of allelic fragments of the 6 pairs of SSR primers amplified in each hypsizigus marmoreus cultivated variety are determined and numbered (table 2) by performing banding amplification on the SSR primers of 56 collected hypsizigus marmoreus main cultivated varieties, and the 'Finc-N-11' strain can be effectively identified in 56 collected main cultivated varieties by the number combination of different SSR allelic sites. The relative molecular weight of the amplified allelic locus of each SSR primer can be determined by analyzing by capillary electrophoresis combined software, the strain with the specific SSR allelic fragment combination of the strain 'Finc-N-11' is the strain 'Finc-N-11' of hypsizigus marmoreus, and the numbering combination of the strain is as follows: 18/7/(1+4)/(1+8)/(14+16)/(2+4).
The invention has the beneficial effects that: compared with conventional morphological detection, antagonism test and fruiting test, the method has the advantages of short detection time, high accuracy and good repeatability. The operation time required for detection is within 24h (including genome DNA extraction, PCR amplification, electrophoresis analysis and data analysis), while the time required for conventional antagonistic tests is at least two weeks, and the time required for fruiting tests is at least 3 months; the method has specificity of 'Finc-N-11' in the collected 56 commercial hypsizigus marmoreus main cultivation strains, and has good application prospect.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the description of the embodiments will be briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without inventive exercise. Wherein:
FIG. 1 is a diagram of the peaks of the relative molecular weights of the allelic sites obtained by the primer HMSSR5 respectively and sequentially detected in the selected hypsizigus marmoreus cultivation material "Finc-N-11" and several main cultivation commercial varieties;
FIG. 2 is a diagram of the peaks of the relative molecular weights of the allelic sites obtained by the primer HMSSR18 respectively and sequentially detected in the selected hypsizigus marmoreus cultivation material "Finc-N-11" and several main cultivation commercial varieties;
FIG. 3 is a diagram of the relative molecular weight peaks of the allelic sites obtained by the primer HMSSR22 respectively and sequentially detected in the selected hypsizigus marmoreus cultivation material 'Finc-N-11' and several main cultivation commercial varieties;
FIG. 4 is a diagram of the peaks of the relative molecular weights of the allelic sites obtained by the primer HMSSR32 respectively and sequentially detected in the selected hypsizigus marmoreus cultivation material "Finc-N-11" and several main cultivation commercial varieties;
FIG. 5 is a diagram of the peaks of the relative molecular weights of the allelic sites obtained by the primer HMSSR51 sequentially detected in the selected Hypsizygus marmoreus cultivation material "Finc-N-11" and several main cultivation commercial varieties respectively;
FIG. 6 is a diagram showing the relative molecular weight peaks of the allelic sites of the primer HMSSR59 detected in sequence in the selected Hypsizygus marmoreus cultivation material "Finc-N-11" and several main cultivation commercial varieties, respectively.
Detailed Description
In order to make the aforementioned objects, features and advantages of the present invention more comprehensible, embodiments accompanying specific embodiments of the present invention are described in detail below.
In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, but the present invention may be practiced in other ways than those specifically described and will be readily apparent to those of ordinary skill in the art without departing from the spirit of the present invention, and therefore the present invention is not limited to the specific embodiments disclosed below.
Furthermore, reference herein to "one embodiment" or "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one implementation of the invention. The appearances of the phrase "in one embodiment" in various places in the specification are not necessarily all referring to the same embodiment, nor are separate or alternative embodiments mutually exclusive of other embodiments.
Example 1:
(1) Hypha culture: inoculating Hypsizigus marmoreus strain to potato glucose agar solid culture medium, culturing at 22 deg.C for 10d, and collecting mycelium;
(2) Extraction of genomic DNA: the fungal DNA extraction kit is used, the genomic DNA is extracted according to the kit experimental steps, and 2 mu L of DNA is taken for carrying out 1.2% agarose gel electrophoresis detection. Detecting the concentration and purity of the total genome DNA by an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be consistent;
the CTAB method for extracting genome DNA of hyphae comprises the following steps:
(1) adding a fungus sample into liquid nitrogen for fully grinding;
(2) adding 360 mu L of Buffer STE and 40 mu L of Buffer SDS into the ground powder rapidly, quickly whirling and uniformly mixing, placing the centrifugal tube in a water bath at 65 ℃ for 15min, and reversing the centrifugal tube in the water bath process to mix the sample for a plurality of times;
(3) adding 5 μ L RNase Solution into the lysate, mixing by vortex, and standing at room temperature for 15-30min;
(4) adding 140 mu L of Buffer PS, vortexing and shaking for 30s, and standing on ice for 10min;
(5) 13000g was centrifuged for 5min at room temperature, 400. Mu.L of the supernatant was carefully transferred to a new centrifuge tube;
(6) add 600. Mu.L Buffer PBD (diluted with absolute ethanol) to the sample, vortex for 30s;
(7) loading the DNA binding column in a collecting tube, transferring half of the mixed solution to the column, and centrifuging at 8000g for 1min;
(8) pouring off the filtrate, putting the column back into the collecting pipe, transferring the residual mixed solution into the column, and centrifuging for 1min at 8000 g;
(9) pouring the filtrate and putting the column back into the collecting pipe, adding 600 μ L Buffer GW2 (diluted with absolute ethyl alcohol) into the column, and centrifuging at 8000g for 1min;
r repeats step 9;
Figure BDA0002932683900000081
pouring off the filtrate, putting the column back into the collecting pipe, centrifuging at 10000g for 2min to remove the residual ethanol in the column;
Figure BDA0002932683900000082
transferring the column to a new 1.5ml centrifuge tube, adding 30 μ L of Buffer AE preheated to 65 deg.C to the center of the membrane of the column, standing at room temperature for 2min, centrifuging at 10000g for 1min;
Figure BDA0002932683900000083
mu.L of DNA was subjected to 1.2% agarose gel electrophoresis, 2. Mu.L of DNA was subjected to NanoDrop spectrophotometry, and the remaining DNA was stored at-20 ℃.
(3) Detection of SSR molecular markers: carrying out PCR amplification of gene SSR markers on the extracted DNA;
the PCR amplification system is as follows: total volume 10 μ L, including: 10 XPCR buffer1 uL, 2.5mmol/L dNTP 0.8 uL, 5U/uL TAKARA HSTaq enzyme 0.1 uL, 5 umol/L TP-M130.5 uL, 5 umol/L SSR mark specific primer total volume each 0.6 uL, concentration 20 ng-30 ng/uL extracted template DNA 1.2 uL, ddH 2 O 5.2μL;
And (3) PCR reaction conditions: 5min at 95 ℃; 30second, at 95 ℃, 30second, at 59 ℃, 30second, at 72 ℃, for 30 cycles; 5min at 95 ℃; 30second at 95 ℃, 30second at 53 ℃, 30second at 72 ℃ for 10 cycles; 30min at 60 ℃.
(4) And (3) electrophoresis detection: mixing 1 μ L of the product obtained by PCR amplification with 9 μ L of sample buffer solution, denaturing at 95 deg.C for 3min, and cooling in ice water mixture for 3min; 3 mu L of sample is applied to a modified polyacrylamide gel for electrophoresis, the modified polyacrylamide gel is commercial POP7 gel, the electrophoresis buffer solution is 3730buffer EDTA, the injection voltage is 2000V, the operation voltage is 15000V, the sample injection time is 10s, the temperature is 60 ℃, the length of a capillary is 50cm, the power is 200W, the electrophoresis is 20min, the current and the power are dynamic,
(5) Analysis of results
Adopting 6 pairs of SSR primers to carry out PCR amplification and capillary electrophoresis on hypsizigus marmoreus strains, and finding a matched numbering combination by analyzing allele factors (Na, ne), nei's genetic diversity index (He), shannon's diversity information index (I) and gene observation heterozygosity (Ho) and combining relative molecular weight peak maps of allele sites: HMSSR5, HMSSR18, HMSSR22, HMSSR32, HMSSR51, HMSSR59, the corresponding banding patterns being: 18/7/(1 + 4)/(1 + 8)/(14 + 16)/(2 + 4) to determine the strain as the 'Finc-N-11' strain of the hypsizigus marmoreus. To ensure the accuracy of the identification, three replicates were recommended.
Is mainly composed ofTaking the commercial variety as an example, the peak patterns of the relative molecular weights of the allelic sites obtained by sequential detection of 6 pairs of primers are shown in FIGS. 1 to 6 (sequentially (1): finc-N-11 (2); (3); B2 (4); 15-X2 (5); 14-X1 (6); 13-X6 (7); H2 (8); BS027 (9); X5. RTM DTG)
Figure BDA0002932683900000091
B4)。
The fingerprint spectrum of the invention refers to the combination of the primer and the band type thereof.
It should be noted that the above-mentioned embodiments are only for illustrating the technical solutions of the present invention and not for limiting, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, which should be covered by the claims of the present invention.
Sequence listing
<110> Shanghai Fengchi Biotechnology Ltd
<120> SSR marker fingerprint of Hypsizigus marmoreus Finc-N-11 strain, construction method and application thereof
<130> 2021020306-zf-wjn
<141> 2021-02-03
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cacaccttac gaggtgagca 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tgtttgatgt tagccgaacg 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gaggattgaa gggactgtcg 20
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cctcatcctc cgactctacg 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
tgctggtgag tgagttggag 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
acggcgacat aatctgctct 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
aacctccagt cacaacctgc 20
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ccttgcttct tgtcggatgt 20
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
caccccctca tcctacacat 20
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
tggtcagaag aaacgtcgtg 20
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
cactgttcca gagtgggacc 20
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
agggcctttt cagagacgat 20

Claims (2)

1. A fingerprint identification method of SSR markers of Hypsizigus marmoreus Finc-N-11 strains is characterized by comprising the following steps: the fingerprint consists of 6 SSR marker loci, and the specific sequences of 6 pairs of corresponding primers are as follows:
HMSSR5 forward primer: CACACCTTACGAGGTGAGCA;
reverse primer: tgtttgtgttagccgaacg;
HMSSR18 forward primer: GAGGATTGAAGGGACTGTCG;
reverse primer: CCTCATCCTCCGACTCTACG;
HMSSR22 forward primer: TGCTGGTGAGTGAGTGAGTGGAG;
reverse primer: ACGGCGACATATCTGCT;
HMSSR32 forward primer: AACCTCCAGTCACAACCTGC;
reverse primer: CCTTGCTTGTCGGATGT;
HMSSR51 forward primer: CACCCCCTCATCCTACACAT;
reverse primer: tggtcagagaaaacgtcgtg;
HMSSR59 forward primer: cactgttccagagatgggacc;
reverse primer: AGGGCCTTTTTCAGAGACGACGAT;
the corresponding combination of the belt type numbers is as follows: 18/7/(1 + 4)/(1 + 8)/(14 + 16)/(2 + 4);
wherein the corresponding band type number of the primer HMSSR5 is 18, and the band size of the corresponding allele segment is 213 to 213.99bp;
the corresponding band type number of the primer HMSSR18 is 7, and the corresponding allelic gene fragment has the band size of 259 to 259.99bp;
the band type number corresponding to the primer HMSSR22 is 1+4, wherein the band size of the allele segment corresponding to the number 1 is 174 to 174.99bp, and the band size of the allele segment corresponding to the number 4 is 188 to 188.99bp;
the banding pattern corresponding to the primer HMSSR32 is numbered 1+8, wherein the banding size of the allele segment corresponding to the numbering 1 is 224 to 224.99bp, and the banding size of the allele segment corresponding to the numbering 8 is 237 to 237.99bp;
the tape type corresponding to the primer HMSSR51 is numbered 14+16, wherein the stripe size of the allele segment corresponding to the primer HMSSR51 is 190 to 190.99bp, and the stripe size of the allele segment corresponding to the primer HMSSR51 is 206 to 206.99bp;
the band type number corresponding to the primer HMSSR59 is 2+4, wherein the size of the band of the allele segment corresponding to the number 2 is 149 to 149.99bp, and the size of the band of the allele segment corresponding to the number 4 is 160 to 160.99bp;
the preservation number of the hypsizigus marmoreus Finc-N-11 strain is GDMCCNo:61404.
2. The application of the SSR marked fingerprint of the Hypsizigus marmoreus Finc-N-11 strain according to claim 1 is characterized in that: the fingerprint of the SSR marker of the hypsizigus marmoreus Finc-N-11 strain is used for identifying the specific allelic variation of the hypsizigus marmoreus Finc-N-11 strain and/or identifying the specificity of the hypsizigus marmoreus Finc-N-11 strain.
CN202110153274.4A 2021-02-03 2021-02-03 SSR marker fingerprint of Hypsizigus marmoreus Finc-N-11 strain and construction method and application thereof Active CN112795680B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110153274.4A CN112795680B (en) 2021-02-03 2021-02-03 SSR marker fingerprint of Hypsizigus marmoreus Finc-N-11 strain and construction method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110153274.4A CN112795680B (en) 2021-02-03 2021-02-03 SSR marker fingerprint of Hypsizigus marmoreus Finc-N-11 strain and construction method and application thereof

Publications (2)

Publication Number Publication Date
CN112795680A CN112795680A (en) 2021-05-14
CN112795680B true CN112795680B (en) 2023-02-28

Family

ID=75814126

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110153274.4A Active CN112795680B (en) 2021-02-03 2021-02-03 SSR marker fingerprint of Hypsizigus marmoreus Finc-N-11 strain and construction method and application thereof

Country Status (1)

Country Link
CN (1) CN112795680B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106801093A (en) * 2017-02-07 2017-06-06 上海市农业科学院 A kind of SSR marker finger-print of fragrant No. 1 strain in mushroom Jiangxi and its construction method and application
CN112280687A (en) * 2020-09-21 2021-01-29 东营市菇健生物科技有限公司 Mushroom-Jian-Hypsizygus marmoreus GJ5 strain, SSR marker primer and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106801093A (en) * 2017-02-07 2017-06-06 上海市农业科学院 A kind of SSR marker finger-print of fragrant No. 1 strain in mushroom Jiangxi and its construction method and application
CN112280687A (en) * 2020-09-21 2021-01-29 东营市菇健生物科技有限公司 Mushroom-Jian-Hypsizygus marmoreus GJ5 strain, SSR marker primer and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
真姬菇微卫星分子标记的开发及其种质资源分析;董岩;《万方数据》;20101231;第四章、表4.1 *

Also Published As

Publication number Publication date
CN112795680A (en) 2021-05-14

Similar Documents

Publication Publication Date Title
CN113005219A (en) SSR marker fingerprint identification method of hypsizigus marmoreus Rongbai 001(F) strain, construction method and application thereof
CN112746125A (en) SSR marker fingerprint of hypsizigus marmoreus hunhua No. 8 strain and construction method and application thereof
CN112941224A (en) Identification method of SSR (simple sequence repeat) marker fingerprint of golden 6046 strain of flammulina velutipes, construction method and application thereof
CN112795680B (en) SSR marker fingerprint of Hypsizigus marmoreus Finc-N-11 strain and construction method and application thereof
CN112877458B (en) SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM36 strain as well as construction method and application thereof
CN112760406B (en) SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM22 strain as well as construction method and application thereof
CN112795687B (en) SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM21 strain as well as construction method and application thereof
CN112708696B (en) SSR marker fingerprint of Hypsizigus marmoreus Finc-F-4 strain and construction method and application thereof
CN112877457B (en) SSR (simple sequence repeat) labeled fingerprint spectrum of hypsizigus marmoreus HM6 strain as well as construction method and application of SSR labeled fingerprint spectrum
CN112813183B (en) SSR marker fingerprint of Hypsizigus marmoreus Finc-B-6 strain and construction method and application thereof
CN112695129B (en) SSR marker fingerprint of hypsizigus marmoreus hunshi No. 12 strain and construction method and application thereof
CN112795681B (en) SSR (simple sequence repeat) labeled fingerprint spectrum of hypsizigus marmoreus HM18 strain as well as construction method and application of SSR labeled fingerprint spectrum
CN112708694B (en) SSR marker fingerprint of Hypsizigus marmoreus Finc-B-3 strain and construction method and application thereof
CN112695130B (en) SSR marker fingerprint of hypsizigus marmoreus Huzhen No. 22 strain and construction method and application thereof
CN112746126B (en) SSR marker fingerprint of Hypsizigus marmoreus Finc-B-7 strain as well as construction method and application thereof
CN112708695B (en) SSR marker fingerprint of Hypsizigus marmoreus Finc-W-247 strain and construction method and application thereof
CN112795688B (en) SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM13 strain as well as construction method and application thereof
CN112813182B (en) SSR marker fingerprint of hypsizigus marmoreus Huzhen No. 23 strain as well as construction method and application thereof
CN112795686B (en) SSR marker fingerprint of hypsizigus marmoreus Huzhen 18 strain and construction method and application thereof
CN112695127A (en) SSR marker fingerprint of hypsizigus marmoreus hunhua No. 2 strain and construction method and application thereof
CN112695131A (en) SSR marker fingerprint of hypsizigus marmoreus hunger No. 29 strain and construction method and application thereof
CN112695132A (en) SSR marker fingerprint of hypsizigus marmoreus hunshi No. 27 strain and construction method and application thereof
CN112795685A (en) SSR marker fingerprint of hypsizigus marmoreus Huzhen No. 11 strain and construction method and application thereof
CN112795682A (en) SSR marker fingerprint of hypsizigus marmoreus Huzhen No. 6 strain and construction method and application thereof
CN112760404A (en) SSR marker fingerprint of Hypsizigus marmoreus Finc-B-5 strain and construction method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant