CN112760406B - SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM22 strain as well as construction method and application thereof - Google Patents

Abstract

The invention discloses an SSR marker fingerprint of hypsizigus marmoreus HM22 strain and a construction method and application thereof. The construction method comprises the following steps: (1) hypha culture; (2) extracting genome DNA; (3) detecting SSR molecular markers; and (4) detecting by capillary electrophoresis. The application comprises the following steps: and performing SSR marker amplification on the hypsizigus marmoreus strain, comparing the obtained banding pattern with the fingerprint spectrum, and obtaining the hypsizigus marmoreus HM22 strain when the banding pattern is consistent with the fingerprint spectrum. Compared with conventional morphological detection, antagonism test and fruiting test, the method has the advantages of short detection time, high accuracy and good repeatability, and has the specificity of hypsizigus marmoreus HM22 strain in the collected 56 hypsizigus marmoreus cultivation main culture strains at home and abroad.

Description

SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM22 strain as well as construction method and application thereof

Technical Field

The invention belongs to the technical field of detection of hypsizigus marmoreus strains, and particularly relates to an SSR marker fingerprint of a hypsizigus marmoreus HM22 strain, and a construction method and application thereof.

Background

Hypsizigus marmoreus (Peck) H.E.Bigelow, a species of Basidiomycota, agaricales, lyophyllaceae, is named due to marble patches on the surface of its pileus. The seafood soup is attractive in appearance, crisp and tender in texture, unique in seafood flavor and economical in price, and is popular with consumers. The hypsizigus marmoreus not only contains abundant vitamins and 18 amino acids, but also has the functions of hemolysis, antioxidation, leukemia and lymphoma cell inhibition, blood fat reduction, inflammation resistance, antioxidation and the like in components such as micromolecular compounds, polysaccharide, polypeptide and the like contained in the hypsizigus marmoreus through recent research, and is edible and medicinal fungi with high economic value. Since the first industrialized hypsizigus marmoreus cultivation enterprise in China established in 2001, hypsizigus marmoreus becomes one of the novel edible fungi which are rapidly developed in the market in China. The total industrial production of the hypsizigus marmoreus in 2019 is 32.8 ten thousand tons, the yield is increased by 58.63 percent in comparison with that in 2018, the yield accounts for 9.6 percent of the total industrial production of the edible fungi, and the highest rank is found in the total production of the edible fungi in industrial cultivation in China.

The high-quality strain plays a very important role in the industrial cultivation of hypsizigus marmoreus. At present, hypsizigus marmoreus strains used by industrialized production enterprises in China are mainly introduced into Japan or further hybridized and bred on the basis of the introduced strains, the cultured hypsizigus marmoreus fruiting bodies are brown and are called as hypsizigus marmoreus, and the fruiting bodies are white and are also called as white hypsizigus marmoreus or hypsizigus marmoreus. Although the yield of factory production is improved year by year, partial strains still have the problems of long cultivation period, low yield per unit, poor appearance uniformity of single fruiting body, easy occurrence of cap formation and the like, and the defects can cause the increase of production cost and reduce the market competitiveness of products. On the other hand, the industrialized production strains of the hypsizigus marmoreus are not high in diversity and similar in product appearance, so that the diversified requirements of market consumers cannot be met. The method has rich wild and natural hypsizigus marmoreus cultivation resources in China, efficiently utilizes the high-quality resources, expands the genetic basis of strains, and is beneficial to breeding of high-yield, high-quality and characteristic hypsizigus marmoreus strains in China.

With the promulgation and implementation of the protection law of new species of international plants, the establishment of a mature, rapid and accurate molecular biology identification technical system becomes a powerful means for protecting the intellectual property rights of edible fungus varieties.

Disclosure of Invention

The invention aims to solve the technical problem of providing an SSR marker fingerprint of hypsizigus marmoreus HM22 strain and a construction method and application thereof, wherein the fingerprint has the advantages of short detection time, high accuracy and good repeatability compared with conventional morphological detection, antagonistic test and fruiting test.

Hypsizygus marmoreus (Hypsizygus marmoreus) HM22 is deposited in Guangdong province microbial strain collection center in 12.2.2020, and is located in Guangzhou city, mieli Zhonglu 100 # Lou 5 th, guangdong province microbial research institute, and the deposit number is GDMCC No. 61415.

The SSR marker fingerprint of hypsizigus marmoreus HM22 strain of the invention consists of 6 pairs of SSR markers, is an SSR primer developed based on hypsizigus marmoreus genome simple repetitive sequence fragments, has good amplification band type and high repeatability, and has detailed marker information shown in a table 1:

TABLE 1 SSR tag detailed information List

The invention relates to a method for constructing an SSR marker fingerprint spectrum of hypsizigus marmoreus HM22 strain, which comprises the following steps:

(1) Hypha culture: inoculating Hypsizigus marmoreus strain to potato glucose agar solid culture medium, culturing at 22 deg.C for 10-14d, and collecting mycelium;

(2) Extraction of genomic DNA: the fungal DNA extraction kit is used, the genomic DNA is extracted according to the kit experimental steps, and 2 mu L of DNA is taken for carrying out 1.2% agarose gel electrophoresis detection. Detecting the concentration and purity of the total genome DNA by an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be consistent;

(3) SSR molecular marker primer development: selecting a polymorphic sequence to design an SSR primer and synthesizing according to the genome re-sequencing result of the hypsizigus marmoreus strain;

(4) Detection of SSR molecular markers: carrying out PCR amplification of gene SSR markers on the extracted DNA;

(5) And (3) electrophoresis detection: mixing the product obtained by PCR amplification with formamide sample adding buffer solution, denaturing, and detecting on a computer;

(6) GeneMapper data analysis.

The construction method of the SSR marker fingerprint spectrum of the hypsizigus marmoreus HM22 strain is characterized by comprising the following steps: the step (2) of extracting the genome DNA comprises the following specific steps:

(1) Adding a fungus sample into liquid nitrogen for fully grinding;

(2) Adding 360 mu l of BufferSTE and 40 mu l of Buffer SDS into the ground powder rapidly, quickly swirling and mixing uniformly, placing the centrifuge tube in a water bath at 65 ℃ for 15min, and reversing the centrifuge tube in the water bath process to mix the sample for a plurality of times;

(3) Adding 5 mu L of RNase Solution into the lysate, uniformly mixing by vortex, and standing for 15-30min at room temperature;

(4) Adding 140 mu L of Buffer PS, vortexing and shaking for 30s, and standing on ice for 10min;

(5) 13000g was centrifuged for 5min at room temperature, and 400. Mu.L of the supernatant was carefully transferred to a new centrifuge tube;

(6) Adding 600 mu L of Buffer PBD into the sample, and uniformly mixing by vortex for 30s;

(7) Loading the DNA binding column in a collecting tube, transferring half of the mixed solution to the column, and centrifuging at 8000g for 1min;

(8) Pouring off the filtrate, putting the column back into the collecting pipe, transferring the residual mixed solution into the column, and centrifuging for 1min at 8000 g;

(9) Pouring the filtrate and putting the column back into the collecting pipe, adding 600 mu L of Buffer GW2 into the column, and centrifuging for 1min at 8000 g;

(10) Repeating the step 9;

(11) Pouring off the filtrate, putting the column back into the collecting pipe, centrifuging for 2min at 10000g to remove the residual ethanol in the column;

(12) Transferring the column to a new 1.5ml centrifuge tube, adding 30 μ L of Buffer AE preheated to 65 deg.C to the center of the membrane of the column, standing at room temperature for 2min, and centrifuging at 10000g for 1min;

(13) mu.L of DNA was used for 1.2% agarose gel electrophoresis detection, 2. Mu.L of DNA was used for NanoDrop spectrophotometry, and the remaining DNA was stored at-20 ℃.

The PCR amplification system in the step (3) is as follows: total volume 10 μ L, including: 10 XPCR buffer1 uL, 2.5mmol/L dNTP 0.8 uL, 5U/uL TAKARA HSTaq enzyme 0.1 uL, 5 umol/L TP-M130.5 uL, 5 umol/L SSR mark specific primer total volume each 0.6 uL, concentration 20 ng-30 ng/uL extracted template DNA 1.2 uL, ddH ₂ O 5.2μL；

And (3) PCR reaction conditions: 5min at 95 ℃; 30second, at 95 ℃, 30second, at 72 ℃, 30second, for 30 cycles; 5min at 95 ℃; 30second at 95 ℃, 30second at 53 ℃, 30second at 72 ℃,10 cycles; 30min at 60 ℃.

The sample adding buffer solution in the step (5) is 9 mu L of a molecular weight internal standard and formamide mixed solution (0.5; the amount of the PCR amplification product added was 1. Mu.L.

The specific process of denaturation in the step (5) is to denature at 95 ℃ for 3min, and then to cool in an ice-water mixture for 3min.

The electrophoresis in the step (5) has the following process parameters: the modified polyacrylamide gel is commercial POP7 gel, the electrophoresis buffer solution is 3730buffer EDTA, the injection voltage is 2000V, the operation voltage is 15000V, the sample injection time is 10s, the temperature is 60 ℃, the capillary length is 50cm, the power is 200W, the electrophoresis is performed for 20min, and the current and the power are dynamic.

The data analysis in the step (6) is specifically as follows: and (3) importing the detected original data file into analysis software GeneMapper ID3.2, and performing group structure analysis, clustering and heterozygosity analysis and core germplasm resource calculation analysis by using software such as POPGENE, NTSYS and the like. Allele factors (Na, ne), nei's genetic diversity index (He), shannon's diversity information index (I) and gene observation heterozygosity (Ho) were analyzed.

TABLE 2 summary of allelic fragment information from SSR primer amplification

The invention relates to application of an SSR (simple sequence repeat) marker fingerprint of hypsizygus marmoreus HM22 strain, which is characterized in that 6 pairs of SSR primers developed by utilizing hypsizygus marmoreus genome simple repeated sequence segments are used for screening a large number of SSR primers, the number of allelic segments amplified by the 6 pairs of SSR primers in each hypsizygus marmoreus cultivated variety is determined and numbered (table 2) by performing banding amplification on the collected SSR primers of 56 main hypsizygus marmoreus cultivated varieties, and the HM22 strain can be effectively identified in the collected 56 main cultivated varieties by the combination of the numbers of different SSR allelic sites. The relative molecular weight of the allelic sites amplified by each SSR primer can be determined by analyzing capillary electrophoresis combined software, the strain with the specific SSR allelic fragment combination of the 'HM 22' strain is the hypsizigus marmoreus 'HM 22' strain, and the numbering combination of the strain is as follows: (2+4)/10/8/7/(2+4)/2.

The invention has the beneficial effects that: compared with conventional morphological detection, antagonism test and fruiting test, the method has the advantages of short detection time, high accuracy and good repeatability. The operation time required for detection is within 24h (including genome DNA extraction, PCR amplification, electrophoresis analysis and data analysis), while the time required for conventional antagonistic tests is at least two weeks, and the time required for fruiting tests is at least 3 months; the method has the specificity of 'HM 22' strain in 56 commercially available hypsizigus marmoreus main cultivation strains, and has good application prospect.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the description of the embodiments will be briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without inventive exercise. Wherein:

FIG. 1 is a diagram showing the relative molecular weight peaks of allelic loci obtained by sequentially detecting primers HMSSR3 in selected hypsizigus marmoreus cultivation material HM22 and several main cultivation commercial varieties respectively;

FIG. 2 is a diagram showing the relative molecular weight peaks of the allelic sites obtained by sequentially detecting the primer HMSSR5 in the selected hypsizigus marmoreus cultivation material HM22 and several main cultivation commercial varieties respectively;

FIG. 3 is a diagram showing the relative molecular weight peaks of the allelic sites obtained by sequentially detecting the primer HMSSR11 in the selected hypsizygus marmoreus cultivation material HM22 and several main cultivation commercial varieties respectively;

FIG. 4 is a diagram showing the relative molecular weight peaks of the allelic sites sequentially detected by the primer HMSSR35 in the selected Hypsizygus marmoreus cultivation material "HM22" and several main cultivation commercial varieties, respectively;

FIG. 5 is a diagram showing the relative molecular weight peaks of the allelic sites sequentially detected by the primer HMSSR38 in the selected Hypsizygus marmoreus cultivation material "HM22" and several main cultivation commercial varieties, respectively;

FIG. 6 is a diagram showing the relative molecular weight peaks of the allelic sites of the primer HMSSR61 sequentially detected in the selected Hypsizygus marmoreus cultivation material "HM22" and several main cultivation commercial varieties, respectively.

Detailed Description

In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with examples are described in detail below.

In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, but the present invention may be practiced in other ways than those specifically described and will be readily apparent to those of ordinary skill in the art without departing from the spirit of the present invention, and therefore the present invention is not limited to the specific embodiments disclosed below.

Furthermore, reference herein to "one embodiment" or "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one implementation of the invention. The appearances of the phrase "in one embodiment" in various places in the specification are not necessarily all referring to the same embodiment, nor are separate or alternative embodiments mutually exclusive of other embodiments.

Example 1:

(1) Hypha culture: inoculating Hypsizigus marmoreus strain to potato glucose agar solid culture medium, culturing at 22 deg.C for 10d, and collecting mycelium;

(2) Extraction of genomic DNA: the fungal DNA extraction kit is used, the genomic DNA is extracted according to the kit experimental steps, and 2 mu L of DNA is taken for carrying out 1.2% agarose gel electrophoresis detection. Detecting the concentration and purity of the total genome DNA by an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be consistent;

the CTAB method for extracting genome DNA of hyphae comprises the following steps:

(1) adding a fungus sample into liquid nitrogen for fully grinding;

(2) adding 360 mu L of Buffer STE and 40 mu L of Buffer SDS into the ground powder quickly, quickly whirling and uniformly mixing, placing the centrifuge tube in a water bath at 65 ℃ for 15min, and reversing the centrifuge tube in the water bath process to mix the sample for a plurality of times;

(3) adding 5 μ L RNase Solution into the lysate, mixing by vortex, and standing at room temperature for 15-30min;

(4) adding 140 μ L Buffer PS, vortexing and shaking for 30s, and standing on ice for 10min;

(5) 13000g was centrifuged for 5min at room temperature, and 400. Mu.L of the supernatant was carefully transferred to a new centrifuge tube;

(6) add 600. Mu.L Buffer PBD (diluted with absolute ethanol) to the sample, vortex and mix for 30s;

(7) loading the DNA binding column in a collecting tube, transferring half of the mixed solution to the column, and centrifuging at 8000g for 1min;

(8) pouring off the filtrate, loading the column back into the collecting pipe, transferring the rest mixed solution into the column, and centrifuging at 8000g for 1min;

(9) pouring the filtrate and putting the column back into the collecting pipe, adding 600 μ L Buffer GW2 (diluted with absolute ethyl alcohol) into the column, and centrifuging at 8000g for 1min;

r repeats step 9;

pouring off the filtrate, putting the column back into the collecting pipe, centrifuging at 10000g for 2min to remove the residual ethanol in the column;

transferring the column to a new 1.5ml centrifuge tube, adding 30 μ L of Buffer AE preheated to 65 deg.C to the center of the membrane of the column, standing at room temperature for 2min, centrifuging at 10000g for 1min;

mu.L of DNA was subjected to 1.2% agarose gel electrophoresis, 2. Mu.L of DNA was subjected to NanoDrop spectrophotometry, and the remaining DNA was stored at-20 ℃.

(3) Detection of SSR molecular markers: carrying out PCR amplification of gene SSR markers on the extracted DNA;

the PCR amplification system is as follows: total volume 10 μ Ι _, comprising: 10 XPCR buffer1 uL, 2.5mmol/L dNTP 0.8 uL, 5U/uL TAKARA HSTaq enzyme 0.1 uL, 5 umol/L TP-M13.5 uL, 5 umol/L SSR mark specific primer total volume each 0.6 uL, concentration 20 ng-30 ng/uL extracted template DNA 1.2 uL, ddH ₂ O 5.2μL；

And (3) PCR reaction conditions: 5min at 95 ℃; 30second, at 95 ℃, 30second, at 72 ℃, 30second, for 30 cycles; 5min at 95 ℃; 30second at 95 ℃, 30second at 53 ℃, 30second at 72 ℃,10 cycles; 30min at 60 ℃.

(4) And (3) electrophoresis detection: mixing 1 μ L of the product obtained by PCR amplification with 9 μ L of sample buffer solution, denaturing at 95 deg.C for 3min, and cooling in ice water mixture for 3min; 3 mu L of sample is applied to a modified polyacrylamide gel for electrophoresis, the modified polyacrylamide gel is commercial POP7 gel, the electrophoresis buffer solution is 3730buffer EDTA, the injection voltage is 2000V, the operation voltage is 15000V, the sample injection time is 10s, the temperature is 60 ℃, the length of a capillary is 50cm, the power is 200W, the electrophoresis is 20min, the current and the power are dynamic,

(5) Analysis of results

Adopting 6 pairs of SSR primers to carry out PCR amplification and capillary electrophoresis on hypsizigus marmoreus strains, and finding a matched numbering combination by analyzing allele factors (Na, ne), nei's genetic diversity index (He), shannon's diversity information index (I) and gene observation heterozygosity (Ho) and combining relative molecular weight peak maps of allele sites: HMSSR3, HMSSR5, HMSSR11, HMSSR35, HMSSR38, HMSSR61, the corresponding banding patterns are: (2 + 4)/10/8/7/(2 + 4)/2 strains, and then the strains are determined to be hypsizigus marmoreus "HM22" strains. To ensure the accuracy of the identification, three replicates were recommended.

Taking several main commercial varieties as examples, the peak patterns of the relative molecular weights of the allelic sites obtained by sequential detection of 6 pairs of primers are shown in FIGS. 1-6 (sequentially (1 HM22 (2); (1) K (3); (4); B2); 15-X2 (5); 14-X1 (6); (7); (8); BS027 (9); X5. RTM. DTG)

B4)。

The fingerprint spectrum of the invention refers to the combination of the primer and the band type thereof.

It should be noted that the above-mentioned embodiments are only for illustrating the technical solutions of the present invention and not for limiting, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, which should be covered by the claims of the present invention.

Sequence listing

<110> Shanghai city academy of agricultural sciences

<120> SSR marker fingerprint spectrum of hypsizigus marmoreus HM22 strain and construction method and application thereof

<130> 2021020406-zf-wjn

<141> 2021-02-04

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gcgaaaccat attcatgcgt 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

attacttgtc gtcggcagga 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cacaccttac gaggtgagca 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tgtttgatgt tagccgaacg 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggagtttgag ttgaggcagc 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgaaccaga ccaaagaccg 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tccgtgagag gacggagtag 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ctcagcaacg acgaacaacc 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tcttcttgtt cggcggtatc 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

atccggcaca ggtaaagatg 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cttccttgtc ccgacatgat 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ggctcggcct tagtgtgtaa 20

Claims (2)

1. A fingerprint identification method of an SSR mark of hypsizigus marmoreus HM22 strain is characterized in that:

the fingerprint consists of 6 SSR marker loci, and the specific sequences of 6 pairs of corresponding primers are as follows:

HMSSR3 forward primer: GCGAAACCATATTCATGCGT;

reverse primer: ATTACTTGTCGTCGCAGGA;

HMSSR5 forward primer: CACACCTTACGAGGTGAGCA;

reverse primer: tgtttgtgttagccgaacg;

HMSSR11 forward primer: GGAGTTTGAGTTTGAGTGAGGCAGC;

reverse primer: atgaaccagccaaagaccg;

HMSSR35 forward primer: TCCGTGAGAGGACGGAGAGTAG;

reverse primer: ctcagcacgacgaacacc;

HMSSR38 forward primer: TCTTCTTGTTCGGCGGTATC;

reverse primer: ATCCGGCACAGGTAAAGATG;

HMSSR61 forward primer: CTTCCTTGTCCCGACATGAT;

reverse primer: GGCTCGGCCTTAGTGTGTAA;

the corresponding combination of the belt type numbers is as follows: (2 + 4)/10/8/7/(2 + 4)/2;

the tape type corresponding to the primer HMSSR3 is numbered 2+4, the stripe size of the allele segment corresponding to the number 2 is 141 to 141.99bp, and the stripe size of the allele segment corresponding to the number 4 is 147 to 147.99bp;

the corresponding band type number of the primer HMSSR5 is 10, and the band size of the corresponding allele segment is 214-214.99bp;

the corresponding band type number of the primer HMSSR11 is 8, and the band size of the corresponding allele segment is 288 to 288.99bp;

the corresponding band type number of the primer HMSSR35 is 7, and the band size of the corresponding allele segment is 130 to 130.99bp;

the banding pattern corresponding to the primer HMSSR38 is numbered 2+4, wherein the banding size of the allele segment corresponding to the numbering 2 is 174 to 174.99bp, and the banding size of the allele segment corresponding to the numbering 4 is 177 to 177.99bp;

the corresponding band type number of the primer HMSSR61 is 2, and the corresponding allelic gene fragment has the band size of 143 to 143.99bp;

the preservation number of the hypsizigus marmoreus HM22 strain is GDMCC No:61415.

2. use of the SSR-labeled fingerprint of the hypsizigus marmoreus HM22 strain according to claim 1, which is characterized in that: the SSR-labeled fingerprint spectrum of the hypsizigus marmoreus HM22 strain is used for identifying the specific allelic variation of the hypsizigus marmoreus HM22 strain and/or identifying the specificity of the hypsizigus marmoreus HM22 strain.

Images