CN112877458B - SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM36 strain as well as construction method and application thereof - Google Patents
SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM36 strain as well as construction method and application thereof Download PDFInfo
- Publication number
- CN112877458B CN112877458B CN202110158841.5A CN202110158841A CN112877458B CN 112877458 B CN112877458 B CN 112877458B CN 202110158841 A CN202110158841 A CN 202110158841A CN 112877458 B CN112877458 B CN 112877458B
- Authority
- CN
- China
- Prior art keywords
- strain
- primer
- hypsizigus marmoreus
- ssr
- size
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an SSR marker fingerprint of hypsizigus marmoreus HM36 strain and a construction method and application thereof, wherein the fingerprint consists of 6 pairs of SSR markers. The construction method comprises the following steps: (1) hypha culture; (2) extracting genome DNA; (3) detecting SSR molecular markers; and (4) detecting by capillary electrophoresis. The application comprises the following steps: and performing SSR marker amplification on the hypsizigus marmoreus strain, comparing the obtained banding pattern with the fingerprint spectrum, and obtaining the hypsizigus marmoreus HM36 strain if the banding pattern is consistent with the fingerprint spectrum. Compared with conventional morphological detection, antagonism test and fruiting test, the method has the advantages of short detection time, high accuracy and good repeatability, and has the specificity of hypsizigus marmoreus HM36 strain in the collected 56 hypsizigus marmoreus cultivation main culture strains at home and abroad.
Description
Technical Field
The invention belongs to the technical field of detection of hypsizigus marmoreus strains, and particularly relates to an SSR marker fingerprint of a hypsizigus marmoreus HM36 strain and a construction method and application thereof.
Background
Hypsizigus marmoreus (Peck) H.E.Bigelow, a species of Basidiomycota, agaricales, lyophyllaceae, is named due to marble streaks on the surface of its pileus. The seafood soup is attractive in appearance, crisp and tender in texture, unique in seafood flavor and economical in price, and is popular with consumers. The hypsizigus marmoreus not only contains abundant vitamins and 18 amino acids, but also has the functions of hemolysis, antioxidation, leukemia and lymphoma cell inhibition, blood fat reduction, inflammation resistance, antioxidation and the like in components such as micromolecular compounds, polysaccharide, polypeptide and the like contained in the hypsizigus marmoreus through recent research, and is edible and medicinal fungi with high economic value. Since the first industrialized culture enterprise of hypsizygus marmoreus in China established in 2001, hypsizygus marmoreus becomes one of novel edible fungi which are developed in markets of China quickly. The total industrial production of the hypsizigus marmoreus in 2019 is 32.8 ten thousand tons, the yield is increased by 58.63 percent in comparison with that in 2018, the yield accounts for 9.6 percent of the total industrial production of the edible fungi, and the highest rank is found in the total production of the edible fungi in industrial cultivation in China.
The high-quality strain plays a very important role in the industrial cultivation of the hypsizigus marmoreus. At present, hypsizigus marmoreus strains used by industrialized production enterprises in China are mainly introduced into Japan or further bred by hybridization on the basis of the introduced strains, the cultivated hypsizigus marmoreus has brown fruiting bodies called as crab-flavor mushrooms, and the cultivated hypsizigus marmoreus has white fruiting bodies called as white beech mushrooms or yulong mushrooms. Although the yield of factory production is improved year by year, partial strains still have the problems of long cultivation period, low yield per unit, poor appearance uniformity of single fruiting body, easy occurrence of cap formation and the like, and the defects can cause the increase of production cost and reduce the market competitiveness of products. On the other hand, the industrialized production strains of the hypsizigus marmoreus are not high in diversity and similar in product appearance, so that the diversified requirements of market consumers cannot be met. The method has rich wild and natural hypsizigus marmoreus cultivation resources in China, efficiently utilizes the high-quality resources, expands the genetic basis of strains, and is beneficial to breeding of high-yield, high-quality and characteristic hypsizigus marmoreus strains in China.
With the promulgation and implementation of the protection law of new species of international plants, the establishment of a mature, rapid and accurate molecular biology identification technical system becomes a powerful means for protecting the intellectual property rights of edible fungus varieties.
Disclosure of Invention
The invention aims to solve the technical problem of providing an SSR marker fingerprint of hypsizigus marmoreus HM36 strain and a construction method and application thereof, wherein the fingerprint has the advantages of short detection time, high accuracy and good repeatability compared with conventional morphological detection, antagonistic test and fruiting test.
Hypsizigus marmoreus (Hypsizygusgurmoreus) HM36 is deposited at Guangdong province microbial culture collection center at 12/2/2020, and is assigned to Zhou Luo No. 59, building 5, michelia Tokyo 100, guangdong province, and the collection number is GDMCC No. 61416.
The SSR marker fingerprint of hypsizigus marmoreus HM36 strain consists of 6 pairs of SSR markers, SSR primers are developed based on simple repeated sequence segments of hypsizigus marmoreus genomes, the SSR primers are good in amplification band type and high in repeatability, and detailed marker information is shown in a table 1:
TABLE 1SSR tag detailed information List
The invention relates to a method for constructing an SSR marker fingerprint spectrum of hypsizigus marmoreus HM36 strain, which comprises the following steps:
(1) Hypha culture: inoculating Hypsizigus marmoreus strain to potato glucose agar solid culture medium, culturing at 22 deg.C for 10-14d, and collecting mycelium;
(2) Extraction of genomic DNA: the fungal DNA extraction kit is used, the genomic DNA is extracted according to the kit experimental steps, and 2 mu L of DNA is taken for carrying out 1.2% agarose gel electrophoresis detection. Detecting the concentration and purity of the total genome DNA by an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be consistent;
(3) SSR molecular marker primer development: selecting a polymorphic sequence design SSR primer and synthesizing according to the genome re-sequencing result of the hypsizigus marmoreus strain;
(4) Detection of SSR molecular markers: carrying out PCR amplification of gene SSR markers on the extracted DNA;
(5) And (3) electrophoresis detection: mixing the product obtained by PCR amplification with formamide sample adding buffer solution, denaturing, and detecting on a machine;
(6) GeneMapper data analysis.
The method for constructing the SSR marker fingerprint spectrum of the hypsizigus marmoreus HM36 strain is characterized by comprising the following steps of: the step (2) of extracting the genome DNA comprises the following specific steps:
(1) Adding a fungus sample into liquid nitrogen for fully grinding;
(2) Adding 360 mu l of BufferSTE and 40 mu l of Buffer SDS into the ground powder rapidly, quickly swirling and mixing uniformly, placing the centrifuge tube in a water bath at 65 ℃ for 15min, and reversing the centrifuge tube in the water bath process to mix the sample for a plurality of times;
(3) Adding 5 mu L of RNase Solution into the lysate, uniformly mixing by vortex, and standing for 15-30min at room temperature;
(4) Adding 140 μ L Buffer PS, vortexing and shaking for 30s, and standing on ice for 10min;
(5) 13000g was centrifuged for 5min at room temperature, and 400. Mu.L of the supernatant was carefully transferred to a new centrifuge tube;
(6) Adding 600 mu.L Buffer PBD into the sample, and uniformly mixing for 30s by vortex;
(7) Loading the DNA binding column in a collecting tube, transferring half of the mixed solution to the column, and centrifuging at 8000g for 1min;
(8) Pouring off the filtrate, putting the column back into the collecting pipe, transferring the residual mixed solution into the column, and centrifuging for 1min at 8000 g;
(9) Pouring the filtrate and putting the column back into the collecting pipe, adding 600 mu L of Buffer GW2 into the column, and centrifuging for 1min at 8000 g;
(10) Repeating the step 9;
(11) Pouring off the filtrate, putting the column back into the collecting pipe, centrifuging at 10000g for 2min to remove the residual ethanol in the column;
(12) Transferring the column to a new 1.5ml centrifuge tube, adding 30 μ L of Buffer AE preheated to 65 deg.C to the center of the membrane of the column, standing at room temperature for 2min, centrifuging at 10000g for 1min;
(13) mu.L of DNA was used for 1.2% agarose gel electrophoresis detection, 2. Mu.L of DNA was used for NanoDrop spectrophotometry, and the remaining DNA was stored at-20 ℃.
The PCR amplification system in the step (3) is as follows: total volume 10 μ L, including: 10 XPCR buffer1 uL, 2.5mmol/L dNTP 0.8 uL, 5U/uL TAKARA HSTaq enzyme 0.1 uL, 5 umol/L TP-M130.5 uL, 5 umol/L SSR mark specific primer total volume 0.6 uL respectively, concentration 20 ng-30 ng/uL extracted template DNA 1.2 uL, ddH 2 O 5.2μL；
And (3) PCR reaction conditions: 5min at 95 ℃; 30second at 95 ℃, 30second at 60 ℃, 30second at 72 ℃ for 30 cycles; 5min at 95 ℃; 30second at 95 ℃, 30second at 53 ℃, 30second at 72 ℃ for 10 cycles; 30min at 60 ℃.
The sample adding buffer solution in the step (5) is 9 mu L of a molecular weight internal standard and formamide mixed solution (0.5; the amount of the PCR amplification product added was 1. Mu.L.
The specific process of denaturation in the step (5) is to denature at 95 ℃ for 3min, and then to cool in an ice-water mixture for 3min.
The electrophoresis in the step (5) has the following process parameters: the modified polyacrylamide gel is commercial POP7 gel, the electrophoresis buffer solution is 3730buffer EDTA, the injection voltage is 2000V, the operation voltage is 15000V, the sample introduction time is 10s, the temperature is 60 ℃, the capillary length is 50cm, the power is 200W, the electrophoresis is 20min, and the current and the power are dynamic.
The data analysis in the step (6) is specifically as follows: and (3) importing the detected original data file into analysis software GeneMapper ID3.2, and performing group structure analysis, clustering and heterozygosity analysis and core germplasm resource calculation analysis by using POPGENE, NTSYS and other software. Allele factors (Na, ne), nei's genetic diversity index (He), shannon's diversity information index (I) and gene observation heterozygosity (Ho) were analyzed.
TABLE 2 summary of allelic fragment information from SSR primer amplification
The invention discloses an application of an SSR marker fingerprint of hypsizygus marmoreus HM36 strain, which is characterized in that 6 pairs of SSR primers developed by simple repetitive sequence segments of hypsizygus marmoreus genomes are utilized, a large number of SSR primers are screened, the number of allelic segments amplified by the 6 pairs of SSR primers in each hypsizygus marmoreus cultivar is determined and numbered (table 2) by performing banding amplification on the SSR primers of 56 collected main hypsizygus marmoreus cultivars, and the HM36 strain can be effectively identified in the 56 collected main cultivars by the combination of the numbers of different SSR allelic sites. The relative molecular weight of the amplified allelic locus of each SSR primer can be determined by analyzing by capillary electrophoresis combined software, the strain with the specific SSR allelic fragment combination of the strain HM36 is the hypsizigus marmoreus strain HM36, and the numbering combination of the strain is as follows: 1/2/(1+2)/(1+2)/(1+3)/(2+5).
The invention has the beneficial effects that: compared with conventional morphological detection, antagonism test and fruiting test, the method has the advantages of short detection time, high accuracy and good repeatability. The operation time required for detection is within 24h (including genome DNA extraction, PCR amplification, electrophoresis analysis and data analysis), while the time required for a conventional antagonism test is at least two weeks, and the time required for a fruiting test is at least 3 months; the method has the specificity of 'HM 36' strains in the collected 56 commercial hypsizigus marmoreus main culture strains, and has good application prospect.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the description of the embodiments will be briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without inventive exercise. Wherein:
FIG. 1 is a diagram showing the relative molecular weight peaks of allelic loci obtained by sequentially detecting primers HMSSR5 in selected hypsizigus marmoreus cultivation material HM36 and several main cultivation commercial varieties respectively;
FIG. 2 is a diagram of the peak of the relative molecular weight of the allelic site obtained by the primer HMSSR11 respectively and sequentially detected in the selected hypsizigus marmoreus cultivation material HM36 and several main cultivation commercial varieties;
FIG. 3 is a diagram showing the relative molecular weight peaks of the allelic sites sequentially detected by the primer HMSSR22 in the selected Hypsizygus marmoreus cultivation material "HM36" and several main cultivation commercial varieties, respectively;
FIG. 4 is a diagram showing the relative molecular weight peaks of the allelic sites sequentially detected by the primer HMSSR26 in the selected Hypsizygus marmoreus cultivation material "HM36" and several main cultivation commercial varieties, respectively;
FIG. 5 is a diagram showing the relative molecular weight peaks of the allelic sites sequentially detected by the primer HMSSR31 in the selected Hypsizygus marmoreus cultivation material "HM36" and several main cultivation commercial varieties, respectively;
FIG. 6 is a diagram showing the relative molecular weight peaks of the allelic sites of the primer HMSSR35 detected in sequence in the selected Hypsizygus marmoreus cultivation material "HM36" and several main cultivation commercial varieties, respectively.
Detailed Description
In order to make the aforementioned objects, features and advantages of the present invention more comprehensible, embodiments accompanying specific embodiments of the present invention are described in detail below.
In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, but the present invention may be practiced in other ways than those specifically described and will be readily apparent to those of ordinary skill in the art without departing from the spirit of the present invention, and therefore the present invention is not limited to the specific embodiments disclosed below.
Furthermore, the references herein to "one embodiment" or "an embodiment" refer to a particular feature, structure, or characteristic that may be included in at least one implementation of the present invention. The appearances of the phrase "in one embodiment" in various places in the specification are not necessarily all referring to the same embodiment, nor are separate or alternative embodiments mutually exclusive of other embodiments.
Example 1:
(1) Hypha culture: inoculating Hypsizigus marmoreus strain to potato glucose agar solid culture medium, culturing at 22 deg.C for 10d, and collecting mycelium;
(2) Extraction of genomic DNA: extracting genome DNA by using a fungus DNA extraction kit according to the kit experiment steps, and taking 2 mu L of DNA to carry out 1.2% agarose gel electrophoresis detection. Detecting the concentration and purity of the total genome DNA by an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be consistent;
the CTAB method for extracting genome DNA of hyphae comprises the following steps:
(1) adding a fungus sample into liquid nitrogen for fully grinding;
(2) adding 360 mu L of Buffer STE and 40 mu L of Buffer SDS into the ground powder rapidly, quickly whirling and uniformly mixing, placing the centrifugal tube in a water bath at 65 ℃ for 15min, and reversing the centrifugal tube in the water bath process to mix the sample for a plurality of times;
(3) adding 5 μ L RNase Solution into the lysate, mixing by vortex, and standing at room temperature for 15-30min;
(4) adding 140 mu L of Buffer PS, vortexing and shaking for 30s, and standing on ice for 10min;
(5) 13000g was centrifuged for 5min at room temperature, 400. Mu.L of the supernatant was carefully transferred to a new centrifuge tube;
(6) add 600. Mu.L Buffer PBD (diluted with absolute ethanol) to the sample, vortex for 30s;
(7) loading the DNA binding column in a collecting tube, transferring half of the mixed solution to the column, and centrifuging at 8000g for 1min;
(8) pouring off the filtrate, putting the column back into the collecting pipe, transferring the residual mixed solution into the column, and centrifuging for 1min at 8000 g;
(9) pouring the filtrate and putting the column back into the collecting pipe, adding 600 μ L Buffer GW2 (diluted with absolute ethyl alcohol) into the column, and centrifuging at 8000g for 1min;
r repeats step 9;
(3) Detection of SSR molecular markers: carrying out PCR amplification of gene SSR markers on the extracted DNA;
the PCR amplification system is as follows: total volume 10 μ Ι _, comprising: 10 XPCR buffer1 uL, 2.5mmol/L dNTP 0.8 uL, 5U/uL TAKARA HSTaq enzyme 0.1 uL, 5 umol/L TP-M130.5 uL, 5 umol/L SSR mark specific primer total volume each 0.6 uL, concentration 20 ng-30 ng/uL extracted template DNA 1.2 uL, ddH 2 O 5.2μL；
And (3) PCR reaction conditions: 5min at 95 ℃; 30second at 95 ℃, 30second at 60 ℃, 30second at 72 ℃ for 30 cycles; 5min at 95 ℃; 30second at 95 ℃, 30second at 53 ℃, 30second at 72 ℃ for 10 cycles; 30min at 60 ℃.
(4) And (3) electrophoresis detection: mixing 1 μ L of the product obtained by PCR amplification with 9 μ L of sample buffer solution, denaturing at 95 deg.C for 3min, and cooling in ice water mixture for 3min; 3 mu L of sample is applied to a modified polyacrylamide gel for electrophoresis, the modified polyacrylamide gel is commercial POP7 gel, the electrophoresis buffer solution is 3730buffer EDTA, the injection voltage is 2000V, the operation voltage is 15000V, the sample injection time is 10s, the temperature is 60 ℃, the length of a capillary is 50cm, the power is 200W, the electrophoresis is 20min, the current and the power are dynamic,
(5) Analysis of results
Adopting 6 pairs of SSR primers to carry out PCR amplification and capillary electrophoresis on hypsizigus marmoreus strains, and finding a matched numbering combination by analyzing allele factors (Na, ne), nei's genetic diversity index (He), shannon's diversity information index (I) and gene observation heterozygosity (Ho) and combining relative molecular weight peak maps of allele sites: HMSSR5, HMSSR11, HMSSR22, HMSSR26, HMSSR31, HMSSR35, the corresponding banding patterns being: 1/2/(1 + 2)/(1 + 3)/(2 + 5), and the strain is the hypsizigus marmoreus "HM36" strain. To ensure the accuracy of the identification, three replicates were recommended.
Taking several main-cultivated commercial varieties as examples, 6 pairs of primers are given and detected in sequencePeak patterns of relative molecular weights at sites, as shown in FIGS. 1 to 6 (HM36 (2); (1) K (3); (4); B2 (5); 14-X1 (6); 13-X6 (7); BS027 (9); X5D (DTG))
B4)。
The fingerprint spectrum of the invention refers to the combination of the primer and the band type thereof.
It should be noted that the above-mentioned embodiments are only for illustrating the technical solutions of the present invention and not for limiting, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, which should be covered by the claims of the present invention.
Sequence listing
<110> Shanghai city academy of agricultural sciences
<120> SSR marker fingerprint spectrum of hypsizigus marmoreus HM36 strain, construction method and application thereof
<130> 2021020407-zf-wjn
<141> 2021-02-04
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cacaccttac gaggtgagca 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tgtttgatgt tagccgaacg 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ggagtttgag ttgaggcagc 20
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
atgaaccaga ccaaagaccg 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
tgctggtgag tgagttggag 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
acggcgacat aatctgctct 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gtgattgggt tcgtgtcgtc 20
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
acctcgagct caacttctgc 20
<210> 9
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
acgacgcacc gtggtttat 19
<210> 10
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
gtagggtagc ggcatcgtt 19
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
tccgtgagag gacggagtag 20
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
ctcagcaacg acgaacaacc 20
Claims (2)
1. A fingerprint identification method of an SSR marker of hypsizigus marmoreus HM36 strain is characterized by comprising the following steps:
the fingerprint consists of 6 SSR marker loci, and the specific sequences of 6 corresponding pairs of primers are as follows:
HMSSR5 forward primer: CACACCTTACGAGGTGAGCA;
reverse primer: tgtttgtgtgttagccgaacg;
HMSSR11 forward primer: GGAGTTTGAGTGAGGCAGC;
reverse primer: atgaaccagccaaagaccg;
HMSSR22 forward primer: TGCTGGTGAGTGAGTGAGTGGAG;
reverse primer: ACGGCGACATATCTGCT;
HMSSR26 forward primer: GTGATTGGGTTCGTGTCGTC;
reverse primer: ACCTCGAGCTCAACTTCTGC;
HMSSR31 forward primer: acgacgcaccgtgttat;
reverse primer: GTAGGGTAGCGGCATCGTT;
HMSSR35 forward primer: TCCGTGAGAGGACGGAGAGTAG;
reverse primer: ctcagcacgacgaacacc;
the corresponding combination of the belt type numbers is as follows: 1/2/(1 + 2)/(1 + 3)/(2 + 5);
wherein the corresponding band type number of the primer HMSSR5 is 1, and the band size of the corresponding allele segment is 176-176.99bp;
the corresponding band type number of the primer HMSSR11 is 2, and the band size of the corresponding allele fragment is 266 to 266.99bp;
the banding pattern corresponding to the primer HMSSR22 is numbered 1+2, wherein the banding size of the allelic gene segment corresponding to the numbering 1 is 174 to 174.99bp, and the banding size of the allelic gene segment corresponding to the numbering 2 is 177 to 177.99bp;
the banding pattern corresponding to the primer HMSSR26 is numbered 1+2, wherein the banding size of the allele segment corresponding to the numbering 1 is 120 to 120.99bp, and the banding size of the allele segment corresponding to the numbering 2 is 126 to 126.99bp;
the band type number corresponding to the primer HMSSR31 is 1+3, wherein the band size of the allele segment corresponding to the number 1 is 152 to 152.99bp, and the band size of the allele segment corresponding to the number 3 is 165 to 165.99bp;
the band type number corresponding to the primer HMSSR35 is 2+5, wherein the size of the band of the allele segment corresponding to the number 2 is 125 to 125.99bp, and the size of the band of the allele segment corresponding to the number 5 is 128 to 128.99bp;
the preservation number of the hypsizigus marmoreus HM36 strain is GDMCC No. 61416.
2. The use of the SSR-labeled fingerprint of the hypsizigus marmoreus HM36 strain according to claim 1, which is characterized in that: the SSR-labeled fingerprint spectrum of the hypsizigus marmoreus HM36 strain is used for identifying the specific allelic variation of the hypsizigus marmoreus HM36 strain and/or identifying the specificity of the hypsizigus marmoreus HM36 strain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110158841.5A CN112877458B (en) | 2021-02-04 | 2021-02-04 | SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM36 strain as well as construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110158841.5A CN112877458B (en) | 2021-02-04 | 2021-02-04 | SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM36 strain as well as construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112877458A CN112877458A (en) | 2021-06-01 |
| CN112877458B true CN112877458B (en) | 2023-02-28 |
Family
ID=76057385
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110158841.5A Active CN112877458B (en) | 2021-02-04 | 2021-02-04 | SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM36 strain as well as construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112877458B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101684487A (en) * | 2008-09-24 | 2010-03-31 | 上海市农业科学院 | Method for identifying industrially cultivated strains of hypsizygus marmoreus by using SSR molecular marker |
| CN102181559A (en) * | 2011-04-28 | 2011-09-14 | 山东省农业科学院农业资源与环境研究所 | Specific primer system of EST (expressed sequence tag)-SSR (simple sequence repeat) molecular markers for Pleurotus ostreatus and application of specific primer system |
-
2021
- 2021-02-04 CN CN202110158841.5A patent/CN112877458B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101684487A (en) * | 2008-09-24 | 2010-03-31 | 上海市农业科学院 | Method for identifying industrially cultivated strains of hypsizygus marmoreus by using SSR molecular marker |
| CN102181559A (en) * | 2011-04-28 | 2011-09-14 | 山东省农业科学院农业资源与环境研究所 | Specific primer system of EST (expressed sequence tag)-SSR (simple sequence repeat) molecular markers for Pleurotus ostreatus and application of specific primer system |
Non-Patent Citations (1)
| Title |
|---|
| 真姬菇微卫星分子标记的开发及其种质资源分析;董岩;《万方数据》;20101231;第四章、表4.1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112877458A (en) | 2021-06-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112746125A (en) | SSR marker fingerprint of hypsizigus marmoreus hunhua No. 8 strain and construction method and application thereof | |
| CN113005219A (en) | SSR marker fingerprint identification method of hypsizigus marmoreus Rongbai 001(F) strain, construction method and application thereof | |
| CN112877458B (en) | SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM36 strain as well as construction method and application thereof | |
| CN112941224A (en) | Identification method of SSR (simple sequence repeat) marker fingerprint of golden 6046 strain of flammulina velutipes, construction method and application thereof | |
| CN112795687B (en) | SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM21 strain as well as construction method and application thereof | |
| CN112877457B (en) | SSR (simple sequence repeat) labeled fingerprint spectrum of hypsizigus marmoreus HM6 strain as well as construction method and application of SSR labeled fingerprint spectrum | |
| CN112695130B (en) | SSR marker fingerprint of hypsizigus marmoreus Huzhen No. 22 strain and construction method and application thereof | |
| CN112795681B (en) | SSR (simple sequence repeat) labeled fingerprint spectrum of hypsizigus marmoreus HM18 strain as well as construction method and application of SSR labeled fingerprint spectrum | |
| CN112760406B (en) | SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM22 strain as well as construction method and application thereof | |
| CN112795688B (en) | SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM13 strain as well as construction method and application thereof | |
| CN112795680B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-N-11 strain and construction method and application thereof | |
| CN112708696B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-F-4 strain and construction method and application thereof | |
| CN112695129B (en) | SSR marker fingerprint of hypsizigus marmoreus hunshi No. 12 strain and construction method and application thereof | |
| CN112813182B (en) | SSR marker fingerprint of hypsizigus marmoreus Huzhen No. 23 strain as well as construction method and application thereof | |
| CN112746126B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-B-7 strain as well as construction method and application thereof | |
| CN112813183B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-B-6 strain and construction method and application thereof | |
| CN112708694B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-B-3 strain and construction method and application thereof | |
| CN112795686B (en) | SSR marker fingerprint of hypsizigus marmoreus Huzhen 18 strain and construction method and application thereof | |
| CN112708695B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-W-247 strain and construction method and application thereof | |
| CN112695131B (en) | SSR (simple sequence repeat) marker fingerprint of Shanghai Zhen 29 strain of hypsizigus marmoreus, construction method and application thereof | |
| CN112746128B (en) | SSR (simple sequence repeat) marker fingerprint of hypsizigus marmoreus HM3 strain, and construction method and application thereof | |
| CN112795682B (en) | SSR (simple sequence repeat) marker fingerprint of Shanghai Zhen 6 strain of hypsizigus marmoreus, construction method and application thereof | |
| CN112760407A (en) | SSR marker fingerprint spectrum of hypsizigus marmoreus HM37 strain as well as construction method and application thereof | |
| CN112795685A (en) | SSR marker fingerprint of hypsizigus marmoreus Huzhen No. 11 strain and construction method and application thereof | |
| CN112695127A (en) | SSR marker fingerprint of hypsizigus marmoreus hunhua No. 2 strain and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |