CN112126702A - White beech mushroom GJ7 strain and SSR marker primer and application thereof - Google Patents
White beech mushroom GJ7 strain and SSR marker primer and application thereof Download PDFInfo
- Publication number
- CN112126702A CN112126702A CN202010998461.8A CN202010998461A CN112126702A CN 112126702 A CN112126702 A CN 112126702A CN 202010998461 A CN202010998461 A CN 202010998461A CN 112126702 A CN112126702 A CN 112126702A
- Authority
- CN
- China
- Prior art keywords
- ssr
- strain
- primer
- artificial sequence
- identifying
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a white beech mushroom GJ7 strain, SSR marker primers and application thereof, wherein the biological preservation number of the white beech mushroom GJ7 strain is CCTCC M2020473; the SSR marker primers comprise 5 pairs of SSR specific marker primer combinations; the invention utilizes the SSR specific marker primer to form a fingerprint. The detection steps of the application are as follows: extracting the genome DNA of hypha or fruiting body of the strain to be detected; performing SSR molecular marker amplification; carrying out electrophoresis detection; comparing the electrophoresis strip with the fingerprint, and obtaining the strain which is consistent with the fingerprint, namely the mushroom Jianbai mushroom GJ7 strain. Compared with conventional morphological detection, antagonism experiment and fruiting experiment methods, the SSR fingerprint spectrum constructed by the method has the advantages of short detection time, high accuracy, good repeatability and the like, and can distinguish the GJ7 strain of the white beech mushroom from 23 main culture varieties of hypsizigus marmoreus.
Description
Technical Field
The invention belongs to the technical field of edible fungus strain detection, and particularly relates to a white beech mushroom GJ7 strain and SSR labeled primers and application thereof.
Background
White beech mushroom (Hypsizygus marmoreus) is white Hypsizigus marmoreus belonging to Agaricales, Tricholomataceae, Hypsizigus, white, fine and smooth in texture, fresh and fragrant in taste, rich in nutrition, and contains a large amount of polysaccharides, proteins and various trace elements, and has high economic value and market potential.
The strain in the industrial cultivation is the key for ensuring the high and stable yield of the white jade mushroom, and the No. 7 strain of the white jade mushroom has the advantages of high yield, stable strain character, high concentration of liquid strain, strong activity, regular fruiting, good taste and the like, which are independently researched and developed in a laboratory. The edible fungus has the characteristic of asexual propagation, and the strain can be obtained by simply carrying out tissue separation on the sporophore. Therefore, the strengthening of identification and protection of the strains is the basis of the industrial and industrialized process of the edible fungi.
The different varieties of white beech mushrooms have large differences among different strains in taste quality, yield, production period, cultivation conditions (culture medium composition, temperature, illumination, pH, humidity) and the like, so the primary task in the process of industrially cultivating and producing the white beech mushrooms is to accurately and quickly determine the strain information of the white beech mushrooms and set the industrial production conditions according to the different white beech mushroom varieties. The development of a rapid, accurate and efficient method for identifying the edible fungus strains is needed, and the accuracy of the strains of the edible fungus strains is ensured.
The strain is the basis and guarantee of the development of the edible fungus industry, and directly influences the yield and the quality of fruiting. At present, the variety of white beech mushrooms in the market is more, the strain management system is not perfect, the quality of the white beech mushrooms is uneven, and the degeneration speed of the white beech mushroom strains is accelerated, so that a method and a technology for rapidly and accurately identifying the white beech mushroom strains are urgently needed.
With the development of molecular biology techniques, the popularization of PCR and sequencing techniques has made it possible to use differences in DNA level for strain identification. At present, more than ten molecular marking methods for strain identification exist. Because simple repeat sequences (SSRs) in fungi are distributed less and show polymorphism, the fungi have the advantages of simple operation, rapidness, high accuracy and the like and are widely concerned. However, the SSR marker technology has less research on the application of the Hypsizygus marmoreus, and the polymorphism analysis of 27 Hypsizygus marmoreus strains is carried out by using 7 pairs of primers on the board of the university of Nanjing agriculture and the like. However, since there is no genomic sequence information of Hypsizigus marmoreus at that time, and SSR primers thereof were designed with reference to genomic sequences of Lentinus edodes, Pleurotus ostreatus and Coprinus cinereus, the specificity of the primers was not high, and the strain GJ7 of Hypsizigus marmoreus could not be distinguished from other strains.
Disclosure of Invention
Aiming at the problems that different white beech mushroom strains have different cultivation and growth conditions, the quality of different white beech mushroom strains has larger difference and the like, the invention aims to provide a white beech mushroom GJ7 strain with healthy mushroom and SSR marker primers thereof.
The second purpose of the invention is to provide the application of the SSR marker primer in the identification of the white beech mushroom GJ7 strain.
In order to realize the purpose, the invention adopts the following technical scheme to realize the purpose:
the invention provides a white beech mushroom GJ7 strain (Hypsizygus marmoreus) with a preservation number of CCTCC M2020473.
The invention also provides SSR labeled primers of the pleurotus citrinopileatus GJ7 strain, wherein the SSR labeled primers comprise the following 5 pairs of primers:
SSR-18 forward primer: GCCGCCCAACGCAGTC, respectively;
SSR-18 reverse primer: CGTTACAGTTCCTCCAGACCTAC, respectively;
SSR-35 forward primer: GGGCATTGGTTGCGAGGT, respectively;
SSR-35 reverse primer: CCGAGAAACAGGACGACGAC, respectively;
SSR-46 forward primer: GCTGCTGCTGCTGCTGCT, respectively;
SSR-46 reverse primer: CGCCATACCCCTGCTGC, respectively;
SSR-52 forward primer: CCACCACCGCACGCAAC, respectively;
SSR-52 reverse primer: TCTTCCCCTCCTTCCCCG, respectively;
SSR-139 forward primer: AACAAGAAAAGAGGGTTATGCG, respectively;
SSR-139 reverse primer: ATCTCGCATATCCCGCCA are provided.
The invention also provides application of the SSR marker primer in identifying the strain GJ7 of the white beech mushroom.
Further: the authentication method comprises the following steps:
(1) extracting the genome DNA of hypha or fruiting body of the strain to be detected;
(2) SSR molecular marker detection: taking the extracted genome DNA as a template, and respectively carrying out PCR reaction by using 5 pairs of specific primers;
(3) detecting a specific strip of the PCR product by electrophoresis; and determining the pleurotus nebrodensis GJ7 strain according to the combination of the allelic fragments by controlling the number and the relative molecular weight of the allelic fragments corresponding to each SSR primer.
Further: the reaction system of the PCR in the step (2) is as follows: the total volume is 15 muL, 1 muL of forward primer, 1 muL of reverse primer, 0.8 muL of genome DNA, 7.5 muL of 2 XTaq enzyme mix and 4.7 muL of deionized water;
the reaction conditions of PCR were: 180s at 95 ℃; 35 cycles of 95 ℃ for 15s, 56 ℃ for 20s, 72 ℃ for 60 s; extension at 72 ℃ for 5 min; keeping the temperature at 4 ℃.
Further: the corresponding allelic fragment of the SSR-18 primer is one, and the molecular weight is 240 bp.
Further: the number of the allelic fragments corresponding to the SSR-35 primers is three, and the molecular weights are 1 → 210bp respectively; 2 → 270 bp; 3 → 1000 bp.
Further: the number of the allelic fragments corresponding to the SSR-46 primer is two, and the molecular weights are respectively 1 → 875 bp; 2 → 2100 bp.
Further: the number of the allelic fragments corresponding to the SSR-52 primer is two, and the molecular weights are respectively 1 → 300 bp; 2 → 1800 bp.
Further: the number of the allelic fragments corresponding to the SSR-139 primer is two, and the molecular weights are respectively 1 → 1500 bp; 2 → 3000 bp.
Compared with the prior art, the invention has the advantages and the technical effects that:
1. compared with the conventional methods such as morphological identification, hypha confrontation and antagonistic culture experiments, the method has the advantages of short detection time, low detection cost, high accuracy, good repeatability and the like.
2. Compared with other methods for identifying the bacterial strain by molecular markers, the method has the advantages of simple operation, low cost, strong specificity and the like.
3. The SSR sequence related by the invention is directly analyzed from the genome DNA sequence of the Hypsizygus marmoreus, the specificity of the primer is good, compared with the existing SSR molecular marking method of Hypsizygus marmoreus, the specificity of the SSR marked specific primer is stronger, only 5 pairs of primers are used, and the cost is further reduced.
4. The white beech mushroom variety aimed by the invention is a white beech mushroom which is widely sold in the market and is cultivated in an industrialized way, and has stronger pertinence. The method has important significance for identifying, protecting and developing the white beech mushroom strain resources.
On the basis of white beech mushroom genome sequencing, 141 SSR marker sequences are found on the genome, specific primers with consistent annealing temperature are designed, 24 common disease-resistant, heat-resistant and high-yield strains on the market can be identified, and the method has important reference value and guiding significance for factory cultivation and accurate strain tracking and tracing of white beech mushroom.
Drawings
FIG. 1 is SSR marker fingerprint spectrum of white mushroom GJ7 strain.
Detailed Description
The technical solution of the present invention will be described in further detail with reference to the following examples.
Example 1: development and application of SSR marker primers of pleurotus eryngii GJ7 strain
The white beech mushroom GJ7 strain is an industrial white beech mushroom strain independently developed in a laboratory, and has the advantages of high yield, stable strain character, high liquid strain concentration, strong activity, regular fruiting, good taste and the like.
The strain GJ7 of the mushroom white jade mushroom developed by the invention is preserved, and the preservation unit is as follows: china center for type culture Collection; address: wuhan, Wuhan university; the preservation date is as follows: 9, 7 days in 2020; the preservation number of the Hypsizygus marmoreus GJ7 strain is CCTCC M2020473.
(1) White beech mushroom SSR marker sequence analysis and primer design:
extracting the genome of the pleurotus jacobsonii GJ7 strain, performing whole genome sequencing to obtain a genome with the size of 41.3M, searching an SSR marker sequence in the genome sequence by using SSRHUNTER1.3 software, and setting the search conditions as follows: the number of the nucleotides is 2, 3, 4, 5 and 6, and the repetition frequency is more than or equal to 5. 141 SSR marker sequences meeting the conditions are searched in total, primers are designed in sequence information containing SSR markers by using primer design software Primer3.0, and 20 pairs of primers are designed in total, wherein the designed primer information is shown in Table 1.
TABLE 120 list of SSR-tagged primer information
(2) Hypha culture:
transferring the collected strains (strain information is shown in Table 2) into potato glucose culture medium, culturing at 20-24 deg.C for 5 days, and collecting mycelia.
TABLE 2 Strain information
(3) Extracting genome DNA:
scraping 100mg of hypha from a solid culture medium plate, placing the hypha in liquid nitrogen, grinding the hypha into powder, quickly transferring the powder into a precooled 1.5mL centrifuge tube, adding 600 mu L of lysis buffer solution, and violently and uniformly mixing;
putting the sample into a 65 ℃ water bath kettle for warm bath for 10 minutes, and reversing and uniformly mixing the sample for 2-3 times;
adding 140 mu L FG2 buffer, mixing vigorously, centrifuging at 12000g for 10 min, sucking the supernatant out by a pipette, placing in a new centrifuge tube, adding isopropanol with the same volume and fully swirling to precipitate the DNA;
centrifuging at 10000g for 2 min, carefully removing supernatant, air drying excess water, adding 300 μ L of 60 deg.C preheated sterile water for resuspension, adding 4 μ LRNase, and mixing;
adding 150 μ L buffer FG3 and 300 μ L absolute ethyl alcohol, mixing uniformly by vortex, transferring to a Hibind purification column, centrifuging at 10000g for 1 min to combine with DNA, and discarding waste liquid;
add 700. mu.L of DNA wash buffer to the purification column, centrifuge at 10000g for 1 min, repeat this step 2 times;
13000g centrifugation for 2 minutes, completely dry DNA, add 50-100 u L deionized water to the purification column, room temperature placed for 2-4 minutes, 10000g centrifugation for 1 minute to collect genome DNA. Storing in a refrigerator at-20 deg.C.
(4) Detection of SSR molecular markers:
the genomic DNAs extracted as described above were used as templates, and PCR amplification was carried out using 20 pairs of primers, respectively.
The reaction system of PCR is: the total volume was 15. mu.L, 1. mu.L of forward primer, 1. mu.L of reverse primer, 0.8. mu.L of genomic DNA, 7.5. mu.L of 2 XTaq enzyme mix, 4.7. mu.L deionized water.
The reaction conditions of PCR were: 180s at 95 ℃; 35 cycles of 95 ℃ for 15s, 56 ℃ for 20s, 72 ℃ for 60 s; extension at 72 ℃ for 5 min; keeping the temperature at 4 ℃.
(5) And (3) electrophoresis detection:
the PCR product (10. mu.L) was added to 1. mu.L of 10 XBuffer, and the mixed sample was added to an electrophoresis gel with an electrophoresis buffer of 1 XTBE, a voltage of 100V, a current of 50mA, a power of 50W, an electrophoresis time of 20 minutes, and EB staining observation.
(6) And (3) strain identification: comparing PCR amplification bands, determining the number and relative molecular weight of the allelic fragments corresponding to each SSR primer by contrasting a marker, and obtaining the information of the allelic fragments as shown in Table 3: the ratio of the strains to the strains is 1: 3: 2, and the strains which accord with the combination of the equal position segments can be determined to be the mushroom healthy white beech mushroom GJ7 strain. To ensure the accuracy of the identification, three replicates are recommended.
TABLE 3 summary of allelic fragment information from SSR primer amplification
Example 2: SSR marker fingerprint spectrum of fruiting bodies of different parts of No. 7 white mushroom
The SSR marker is 141 simple repeat sequences (SSR) found on genome DNA by utilizing SSRhunter1.3 software after white beech mushroom whole genome sequencing, specific primers are designed according to upstream and downstream gene sequences, and polymorphic marker fragments are obtained by running electrophoresis after PCR amplification of collected white beech mushroom strains. The SSR marker has the advantages of simple detection method, less requirement on sample quantity, no requirement on sampling position, good repeatability, short detection time and the like. The invention screens a large amount of SSR primers to finally obtain 5 pairs of primers with high polymorphism and good specificity, and the fragment combination obtained by utilizing the 5 pairs of primers can identify the strains of 24 commercially available white beech mushrooms and hypsizygus marmoreus and high-yield, heat-resistant and disease-resistant strains screened in laboratories.
The SSR marker fingerprint of the white beech mushroom GJ7 strain provided by the invention consists of the 5 pairs of SSR marker primers, is a specific primer developed based on a simple repeat sequence (SSR) of a white beech mushroom genome, has clear amplification band type, good specificity and high repeatability, and the detailed information of the marker primers is shown in Table 4.
TABLE 4 primer sequences in SSR marker fingerprinting
(1) Extracting genome DNA;
respectively taking 100mg of sporocarp (stipe and pileus) of different parts, freezing in liquid nitrogen, grinding into powder, quickly transferring the powder into a precooled 1.5mL centrifuge tube, adding 600 mu L of lysis buffer solution, and violently and uniformly mixing;
putting the sample into a 65 ℃ water bath kettle for warm bath for 10 minutes, and reversing and uniformly mixing the sample for 2-3 times;
adding 140 mu L FG2 buffer, mixing vigorously, centrifuging at 12000g for 10 min, sucking the supernatant out by a pipette, placing in a new centrifuge tube, adding isopropanol with the same volume and fully swirling to precipitate the DNA;
centrifuging at 10000g for 2 min, carefully removing supernatant, air drying excess water, adding 300 μ L of 60 deg.C preheated sterile water for resuspension, adding 4 μ LRNase, and mixing;
adding 150 μ L buffer FG3 and 300 μ L absolute ethyl alcohol, mixing uniformly by vortex, transferring to a Hibind purification column, centrifuging at 10000g for 1 min to combine with DNA, and discarding waste liquid;
add 700. mu.L of DNA wash buffer to the purification column, centrifuge at 10000g for 1 min, repeat this step 2 times;
13000g centrifugation for 2 minutes, completely dry DNA, add 50-100 u L deionized water to the purification column, room temperature placed for 2-4 minutes, 10000g centrifugation for 1 minute to collect genome DNA. Storing in a refrigerator at-20 deg.C.
(2) SSR molecular marker detection: using the extracted genomic DNA as a template, and performing PCR reaction by using 5 pairs of specific primers as shown in Table 4 respectively;
the reaction system of PCR is: the total volume is 15 muL, 1 muL of forward primer, 1 muL of reverse primer, 0.8 muL of genome DNA, 7.5 muL of 2 XTaq enzyme mix and 4.7 muL of deionized water;
the reaction conditions of PCR were: 180s at 95 ℃; 35 cycles of 95 ℃ for 15s, 56 ℃ for 20s, 72 ℃ for 60 s; extension at 72 ℃ for 5 min; keeping the temperature at 4 ℃.
(3) Electrophoresis detection of the specific bands of the PCR product: and comparing the PCR amplification bands, determining the number and relative molecular weight of the allelic fragments corresponding to each SSR primer by contrasting a marker to obtain the allelic fragment information shown in the table 4, and determining the strain conforming to the combination of the allelic fragments as the white mushroom GJ7 strain. To ensure the accuracy of the identification, three replicates are recommended.
The invention also provides application of SSR marker fingerprint of the white beech mushroom GJ7 strain, which is characterized in that 5 pairs of SSR primers developed by simple repetitive sequence segments of white beech mushroom genomes are utilized, and the number of allelic segments amplified by the 5 pairs of SSR primers in the white beech mushroom GJ7 strain is determined and numbered (table 4) by analyzing the banding patterns of the SSR primers of 24 collected white beech mushroom and hypsizygus marmoreus cultivars, the white beech mushroom GJ7 strain can be effectively identified by the combination of the numbers of different SSR allelic segments (figure 1), and the combination of the numbers of the allelic segments of the strain is determined as follows: 1(1+2+3)(1+2)(1+2)(1+2).
The above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions.
Sequence listing
<110> mushroom health Biotech Co Ltd of Dongying City
<120> mushroom white-tonifying jade mushroom GJ7 strain, SSR marker primer and application thereof
<160> 40
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 1
agcttgtacg acgaggtctc tg 22
<210> 2
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 2
aaggcgtaaa gtcattcatc g 21
<210> 3
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 3
gttgagaaga aggaagaggt gga 23
<210> 4
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 4
aaattccctt acctgttgac tcg 23
<210> 5
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 5
cggatgcagc ctagacctt 19
<210> 6
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 6
tcgtcaagtg acaggccg 18
<210> 7
<211> 17
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 7
ttccgccctt gcgagat 17
<210> 8
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 8
ggaatgaaaa tcaactcacc act 23
<210> 9
<211> 16
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 9
gccgcccaac gcagtc 16
<210> 10
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 10
cgttacagtt cctccagacc tac 23
<210> 11
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 11
caacgctctg tcatgagtcc a 21
<210> 12
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 12
ggctctagat ctgcggtcaa 20
<210> 13
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 13
gtctatcacg catacaccgc t 21
<210> 14
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 14
gtgttgtagg tgtgggtggc 20
<210> 15
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 15
atacttccca ctggtgacga gc 22
<210> 16
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 16
tcctcagcat ctacataacc acc 23
<210> 17
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 17
gggcattggt tgcgaggt 18
<210> 18
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 18
ccgagaaaca ggacgacgac 20
<210> 19
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 19
gctgctgctg ctgctgct 18
<210> 20
<211> 17
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 20
cgccataccc ctgctgc 17
<210> 21
<211> 17
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 21
ccaccaccgc acgcaac 17
<210> 22
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 22
tcttcccctc cttccccg 18
<210> 23
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 23
gggccaccct ctttttgc 18
<210> 24
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 24
gttactgacg tggcggttct 20
<210> 25
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 25
acgacgaggt cagaggcag 19
<210> 26
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 26
gctcaacagt tattcctcag tgc 23
<210> 27
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 27
catgtttcct tcgtccatat tgt 23
<210> 28
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 28
ctttatttca ggcccccatt a 21
<210> 29
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 29
tcatgcagcg ccaaggat 18
<210> 30
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 30
gcaggaagaa aatgggatca ag 22
<210> 31
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 31
gggttttgct gttgctgct 19
<210> 32
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 32
gttataatgc tggaaccgtc g 21
<210> 33
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 33
aaggttggct ggcagtgtg 19
<210> 34
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 34
tgagaagaaa aatagccaaa agg 23
<210> 35
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 35
ctggcagatt ttgaacaagt gg 22
<210> 36
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 36
tccgattttg ggcattttg 19
<210> 37
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 37
ctcctgtctc tattcccatt ctg 23
<210> 38
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 38
aggtagagaa caagcagagg agag 24
<210> 39
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 39
aacaagaaaa gagggttatg cg 22
<210> 40
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 40
atctcgcata tcccgcca 18
Claims (10)
1. A white beech mushroom GJ7 strain (Hypsizygus marmoreus) with preservation number of CCTCC M2020473.
2. The SSR-labeled primer for the pleurotus javanicus GJ7 strain according to claim 1, which is characterized in that: the SSR marker primers comprise the following 5 pairs of primers:
SSR-18 forward primer: GCCGCCCAACGCAGTC, respectively;
SSR-18 reverse primer: CGTTACAGTTCCTCCAGACCTAC, respectively;
SSR-35 forward primer: GGGCATTGGTTGCGAGGT, respectively;
SSR-35 reverse primer: CCGAGAAACAGGACGACGAC, respectively;
SSR-46 forward primer: GCTGCTGCTGCTGCTGCT, respectively;
SSR-46 reverse primer: CGCCATACCCCTGCTGC, respectively;
SSR-52 forward primer: CCACCACCGCACGCAAC, respectively;
SSR-52 reverse primer: TCTTCCCCTCCTTCCCCG, respectively;
SSR-139 forward primer: AACAAGAAAAGAGGGTTATGCG, respectively;
SSR-139 reverse primer: ATCTCGCATATCCCGCCA are provided.
3. The use of the SSR marker primers of claim 2 for identifying the strain Pleurotus citrinopileatus GJ 7.
4. The use of SSR marker primers according to claim 3 for identifying the strain Hypsizygus marmoreus GJ7, characterized in that: the authentication method comprises the following steps:
(1) extracting the genome DNA of hypha or fruiting body of the strain to be detected;
(2) SSR molecular marker detection: taking the extracted genome DNA as a template, and respectively carrying out PCR reaction by using 5 pairs of specific primers;
(3) detecting a specific strip of the PCR product by electrophoresis; and determining the pleurotus nebrodensis GJ7 strain according to the combination of the allelic fragments by controlling the number and the relative molecular weight of the allelic fragments corresponding to each SSR primer.
5. The use of SSR marker primers according to claim 4 for identifying the strain Hypsizygus marmoreus GJ7, characterized in that: the reaction system of the PCR in the step (2) is as follows: the total volume is 15 muL, 1 muL of forward primer, 1 muL of reverse primer, 0.8 muL of genome DNA, 7.5 muL of 2 XTaq enzyme mix and 4.7 muL of deionized water;
the reaction conditions of PCR were: 180s at 95 ℃; 35 cycles of 95 ℃ for 15s, 56 ℃ for 20s, 72 ℃ for 60 s; extension at 72 ℃ for 5 min; keeping the temperature at 4 ℃.
6. The use of SSR marker primers according to claim 4 for identifying the strain Hypsizygus marmoreus GJ7, characterized in that: the corresponding allelic fragment of the SSR-18 primer is one, and the molecular weight is 240 bp.
7. The use of SSR marker primers according to claim 4 for identifying the strain Hypsizygus marmoreus GJ7, characterized in that: the number of the allelic fragments corresponding to the SSR-35 primers is three, and the molecular weights are 1 → 210bp respectively; 2 → 270 bp; 3 → 1000 bp.
8. The use of SSR marker primers according to claim 4 for identifying the strain Hypsizygus marmoreus GJ7, characterized in that: the number of the allelic fragments corresponding to the SSR-46 primer is two, and the molecular weights are respectively 1 → 875 bp; 2 → 2100 bp.
9. The use of SSR marker primers according to claim 4 for identifying the strain Hypsizygus marmoreus GJ7, characterized in that: the number of the allelic fragments corresponding to the SSR-52 primer is two, and the molecular weights are respectively 1 → 300 bp; 2 → 1800 bp.
10. The use of SSR marker primers according to claim 4 for identifying the strain Hypsizygus marmoreus GJ7, characterized in that: the number of the allelic fragments corresponding to the SSR-139 primer is two, and the molecular weights are respectively 1 → 1500 bp; 2 → 3000 bp.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010998461.8A CN112126702B (en) | 2020-09-21 | 2020-09-21 | White beech mushroom GJ7 strain and SSR marker primer and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010998461.8A CN112126702B (en) | 2020-09-21 | 2020-09-21 | White beech mushroom GJ7 strain and SSR marker primer and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112126702A true CN112126702A (en) | 2020-12-25 |
| CN112126702B CN112126702B (en) | 2022-06-10 |
Family
ID=73841956
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010998461.8A Active CN112126702B (en) | 2020-09-21 | 2020-09-21 | White beech mushroom GJ7 strain and SSR marker primer and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112126702B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112695130A (en) * | 2021-02-05 | 2021-04-23 | 上海市农业科学院 | SSR marker fingerprint of hypsizigus marmoreus Huzhen No. 22 strain and construction method and application thereof |
| CN112695129A (en) * | 2021-02-05 | 2021-04-23 | 上海市农业科学院 | SSR marker fingerprint of hypsizigus marmoreus hunshi No. 12 strain and construction method and application thereof |
| CN112760407A (en) * | 2021-02-04 | 2021-05-07 | 上海市农业科学院 | SSR marker fingerprint spectrum of hypsizigus marmoreus HM37 strain as well as construction method and application thereof |
| CN112795686A (en) * | 2021-02-05 | 2021-05-14 | 上海市农业科学院 | SSR marker fingerprint of hypsizigus marmoreus Huzhen 18 strain and construction method and application thereof |
| CN112795682A (en) * | 2021-02-04 | 2021-05-14 | 上海市农业科学院 | SSR marker fingerprint of hypsizigus marmoreus Huzhen No. 6 strain and construction method and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103289997A (en) * | 2013-01-25 | 2013-09-11 | 上海丰科生物科技股份有限公司 | Molecular marker of pure white Hypsizygus marmoreus Finc-W-62 strain, its acquisition method and application |
| CN103503780A (en) * | 2013-01-25 | 2014-01-15 | 上海丰科生物科技股份有限公司 | New pure white hypsizigus marmoreus strain |
| CN105368976A (en) * | 2015-12-18 | 2016-03-02 | 广东省微生物研究所 | Characteristic nucleotide sequence, nucleic acid molecule primers, kit and method for distinguishing white hypsizigus marmoreus |
| KR20190070641A (en) * | 2017-12-13 | 2019-06-21 | 대한민국(농촌진흥청장) | A composition for discrimination of beech mushroom varieties |
-
2020
- 2020-09-21 CN CN202010998461.8A patent/CN112126702B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103289997A (en) * | 2013-01-25 | 2013-09-11 | 上海丰科生物科技股份有限公司 | Molecular marker of pure white Hypsizygus marmoreus Finc-W-62 strain, its acquisition method and application |
| CN103503780A (en) * | 2013-01-25 | 2014-01-15 | 上海丰科生物科技股份有限公司 | New pure white hypsizigus marmoreus strain |
| CN105368976A (en) * | 2015-12-18 | 2016-03-02 | 广东省微生物研究所 | Characteristic nucleotide sequence, nucleic acid molecule primers, kit and method for distinguishing white hypsizigus marmoreus |
| KR20190070641A (en) * | 2017-12-13 | 2019-06-21 | 대한민국(농촌진흥청장) | A composition for discrimination of beech mushroom varieties |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112760407A (en) * | 2021-02-04 | 2021-05-07 | 上海市农业科学院 | SSR marker fingerprint spectrum of hypsizigus marmoreus HM37 strain as well as construction method and application thereof |
| CN112795682A (en) * | 2021-02-04 | 2021-05-14 | 上海市农业科学院 | SSR marker fingerprint of hypsizigus marmoreus Huzhen No. 6 strain and construction method and application thereof |
| CN112695130A (en) * | 2021-02-05 | 2021-04-23 | 上海市农业科学院 | SSR marker fingerprint of hypsizigus marmoreus Huzhen No. 22 strain and construction method and application thereof |
| CN112695129A (en) * | 2021-02-05 | 2021-04-23 | 上海市农业科学院 | SSR marker fingerprint of hypsizigus marmoreus hunshi No. 12 strain and construction method and application thereof |
| CN112795686A (en) * | 2021-02-05 | 2021-05-14 | 上海市农业科学院 | SSR marker fingerprint of hypsizigus marmoreus Huzhen 18 strain and construction method and application thereof |
| CN112695130B (en) * | 2021-02-05 | 2023-02-28 | 上海市农业科学院 | SSR marker fingerprint of hypsizigus marmoreus Huzhen No. 22 strain and construction method and application thereof |
| CN112695129B (en) * | 2021-02-05 | 2023-02-28 | 上海市农业科学院 | SSR marker fingerprint of hypsizigus marmoreus hunshi No. 12 strain and construction method and application thereof |
| CN112795686B (en) * | 2021-02-05 | 2023-02-28 | 上海市农业科学院 | SSR marker fingerprint of hypsizigus marmoreus Huzhen 18 strain and construction method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112126702B (en) | 2022-06-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112280687B (en) | Hypsizygus marmoreus GJ5 strain and SSR marker primer and application thereof | |
| CN112126702B (en) | White beech mushroom GJ7 strain and SSR marker primer and application thereof | |
| CN101684487B (en) | Method for identifying industrially cultivated strains of hypsizygus marmoreus by using SSR molecular marker | |
| CN116042896B (en) | Index molecular marker for identifying SP-A strain of She Xiu cocci and application | |
| CN106367496B (en) | kiwi species associated specific single nucleotide molecular marker, detection primer group and application thereof | |
| CN101323878B (en) | Method for identifying indica rice and japonica rice by inserting or deleting molecular marker in rice DNA | |
| CN115927728A (en) | SSR molecular marker primer combination and method for identifying morchella esculenta ZJYDJ001 strain | |
| CN113151567B (en) | SSR molecular marker and method for identifying Lepista sordida N006# strain | |
| CN109750113B (en) | Method for analyzing endophytic bacteria flora of plants | |
| CN109868329B (en) | Screening, quarantine and identification method of colletotrichum specific primers | |
| CN114107541B (en) | DNA bar code for screening index of total soluble amino acid content of agrocybe aegerita | |
| WO2023087784A1 (en) | Dna barcode for screening floccularia luteovirens using content of total polyphenol as index | |
| CN114292938A (en) | SSR fingerprint identification method and construction method of stropharia rugoso-annulata strain | |
| CN106755541B (en) | Molecular marker, primer and probe for identifying lyophyllum decastes | |
| CN111057751A (en) | Method for detecting number of soil fungi based on real-time fluorescent quantitative PCR | |
| KR101149437B1 (en) | Genetic markers for Xanthomonas oryzae pv.oryzae, primers for the markers, and method for detecting and discriminating Xanthomonas oryzae pv.oryzae | |
| CN106868145B (en) | Molecular marker, primer and probe for identifying tricholoma plumbum | |
| CN105256050B (en) | The compound group EST-SSR molecular labelings special primer system of Pleurotus eryngii and its application | |
| Ramli et al. | AN ITS GENE-MEDIATED MOLECULAR DETECTION OF FUNGI ASSOCIATED WITH NATURAL AND ARTIFICIAL AGARWOOD FROM Aquilaria malaccensis | |
| CN108546738A (en) | Sea tangle sporophyte seedling pcr template preparation method and amplification method | |
| CN109666761B (en) | Specific DNA fragment for identifying thelephora ganbajun zang, amplification primer, preparation method and application thereof | |
| CN114517238B (en) | SSR molecular marker and method for identifying tremella aurantialba ZJJJE 001 strain | |
| CN112980994B (en) | Identification method of SSR marker fingerprint of needle mushroom strain and construction method and application thereof | |
| CN114045358B (en) | Primer composition for detecting twelve potato disease pathogenic bacteria based on loop-mediated isothermal amplification technology and detection method | |
| CN114958875B (en) | Screening and application of reference gene metG of citrus yellow-long pathogen |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |