CN113151567B - SSR molecular marker and method for identifying Lepista sordida N006# strain - Google Patents

Abstract

The invention discloses an SSR molecular marker and a method for identifying Lepista sordida N006# strain, wherein the SSR molecular marker is the following combination of 4 pairs of SSR molecular markers: LXSSR 001, LXSSR 004, LXSSR 015 and LXSSR 041, and the nucleotide sequences corresponding to the primers LXSSR 001 and LXSSR 004 are respectively shown by SEQ ID NO.1 and SEQ ID NO. 2. The method for identifying Lepista sordida N006 strain by adopting the SSR molecular marker comprises the following steps: 1) Extracting DNA of Lepista sordida N006# strain and other strains of Lepista sordida; 2) Carrying out PCR amplification by using the extracted DNA as a template according to the SSR molecular marker primer; 3) And (3) carrying out capillary electrophoresis detection on the amplified product, comparing a fluorescence detection peak image, constructing a UPGMA tree according to the data, and carrying out cluster analysis. Compared with conventional morphological detection, fruiting experiments and antagonism experiments, the method for identifying Lepista sordida through the SSR molecular markers has the advantages of high accuracy, good repeatability, simplicity and convenience in operation and the like, and can be used for quickly identifying the strain N006#.

Description

SSR molecular marker and method for identifying Lepista sordida N006# strain

Technical Field

The invention belongs to the field of edible fungus molecular biology, and particularly relates to an SSR molecular marker and an SSR molecular marker method for identifying Lepista sordida N006# strain.

Background

Lepistasoda (Schumach.) Singer also named "Lepisasoda", lepiscasoda, lepista sordida ", etc., belonging to Tricholomataceae (Tricolomataceae), lepista (Tricholomataceae)Lepista). The fungus is a rare fungus for both medicine and food, has rich protein content and various amino acids, especially rich calcium, iron, zinc, potassium, phosphorus and vitamin C, and has trace element selenium content 10 to 20 times that of wild fungus such as Collybia albuminosa, craib, boletus serohilus, rhodococcus rhodochrous, etc. The market price of the fresh mushrooms is about 60 to 120 yuan/kg, and the cultivation and popularization prospect is very wide.

The earliest written record of the lepista sordida in China begins from the report of the lepista sordida cultivation in the early 90 s of the 20 th century, in recent years, the artificial cultivation technology of the lepista sordida is preliminarily mature, and a certain scale of demonstration planting area is formed in the regions of Sichuan, hunan, yunnan, guizhou, heilongjiang and the like in China, so that the economic benefit is good. However, the research of China on the breeding of the new Lepista sordida species is still not perfect enough, and a commercial cultured strain is lacked, the cultured strain is obtained by gradually breeding after being domesticated by wild strains in various domestic production areas, different genetic backgrounds exist among the wild strains, individual differences are large, and long-term strain breeding practice proves that the strain domesticated by the wild fruiting bodies is not necessarily an ideal strain with strong activity, stable genetic characteristics, quick fruiting and high yield.

Therefore, after the excellent strains verified by tests are obtained, the strains of the excellent strains need to be accurately identified so as to conveniently distinguish different strains, thereby avoiding the phenomenon that the selected excellent strains of the lepista sordida are mixed with other same strains to cause the phenomenon of same name and different names or the phenomenon of same name and different name in the production, management and market circulation processes. The SSR molecular marker has the advantages of wide distribution, specific loci, high repeatability and the like in gene pairs, and can be used for carrying out high-precision identification on variation among different varieties of strains of the same species.

At present, reports of applying SSR molecular markers based on whole genes to Lepista sordida germplasm resource diversity are not seen.

Disclosure of Invention

The first purpose of the invention is to provide an SSR molecular marker for identifying the lepista sordida N006# strain, and the second purpose of the invention is to provide a method for identifying the lepista sordida N006# strain by using the SSR molecular marker.

The Lepista sordida N006 strain is preserved in China general microbiological culture Collection center (CGMCC) at 2016, 6 and 1; the preservation number is CGMCC NO.12507.

The first purpose of the invention is realized by the SSR molecular marker for identifying the Lepista sordida N006# strain, which comprises the following 4 pairs of SSR molecular marker combinations: LXSSR 001, LXSSR 004, LXSSR 015 and LXSSR 041, wherein the nucleotide sequences corresponding to LXSSR 001 and LXSSR 004 are shown as SEQ ID NO.1 and SEQ ID NO. 2, respectively.

The second purpose of the invention is realized by adopting the SSR molecular marker to identify Lepista sordida N006 strain, which comprises the following steps:

1) Extracting DNA of Lepista sordida N006 strain and other strain Lepista sordida strains;

2) Performing PCR amplification according to the SSR molecular marker primer by taking the extracted DNA as a template;

3) And (3) performing capillary electrophoresis detection on the amplification product obtained in the step (2), comparing a fluorescence detection peak image, constructing a UPGMA tree according to the data, and performing cluster analysis.

The invention uses SSR molecular marker primers to perform PCR specific amplification on Lepista sordida strain N006# and other Lepista sordida strains Z2, GZ, JX and the like with different geographical sources, and combines an accurate quantitative capillary electrophoresis fluorescence detection method to generate a specific map. The invention discloses 4 pairs of unique SSR primers, and combines fingerprint spectrum analysis of Lepista sordida of other variety strains to accurately and quickly identify the Lepista sordida strain N006#.

The invention has the beneficial effects that:

1) Compared with conventional morphological detection and antagonism experiments, the identification method of the Lepista sordida N006# strain provided by the invention has the advantages of high accuracy, good repeatability, simplicity and convenience in operation and the like, can be used for quickly distinguishing the strain N006# from other strains of Lepista sordida, and can be used for quickly identifying the strain N006#.

2) The SSR molecular markers can be used for quickly identifying in a hypha stage, fruiting is not required to be judged according to fruiting body agronomic characters, the time and the strength are saved, subjective misjudgment is avoided, and different strain strains of the Lepista sordida can be accurately identified, so that the phenomenon that the excellent strain of the selected Lepista sordida is mixed with other same strains in the production, management and market circulation processes to cause the phenomenon of same name and different names is avoided, and the intellectual property rights of the Lepista sordida are effectively protected. The method has important significance for identifying the authenticity of the variety in the production process of the Lepista sordida.

3) The SSR molecular marker method for Lepista sordida provided by the invention can make up for the blank of specific molecular markers of Lepista sordida, and provides a powerful research tool for genetic diversity, colony genetics and germplasm identification research of the Lepista sordida.

Drawings

FIG. 1 is a capillary electrophoresis diagram of the Lepista sordida N006 strain amplified by the SSR molecular marker primers of 4 pairs of the invention, and a, b, c and d diagrams are capillary electrophoresis diagrams of LXSSR 001, LXSSR 004, SSSR015 and LXSSR 041 amplified strain N006 strain;

FIG. 2 is a capillary electrophoresis diagram of the Lepista sordida GZ strain amplified by the SSR molecular marker primers of 4 pairs of the invention, and diagrams a, b, c and d are capillary electrophoresis diagrams of the LXSSSSR 001, LXSSSSR 004, SSSR015 and LXSSSSR 041 amplified strain GZ respectively;

FIG. 3 is a capillary electrophoresis diagram of the Lepista sordida Z2 strain amplified by the SSR molecular marker primers of 4 pairs of the invention, and diagrams a, b, c and d are capillary electrophoresis diagrams of the LXSSR 001, LXSSR 004, SSSR015 and LXSSR 041 amplified strain Z2 respectively;

FIG. 4 is a capillary electrophoresis diagram of a Lepista sordida JX strain amplified by a pair of SSR molecular marker primers respectively according to the invention, and diagrams a, b, c and d are capillary electrophoresis diagrams of strains JX amplified by primers LXSSR 001, LXSSR 004, LXSSR 015 and LXSSR 041 respectively;

FIG. 5 shows genetic distance UPGMA tree of 4 Lepista sordida strains constructed based on SSR molecular markers.

Detailed Description

The present invention will be further described with reference to the following specific examples.

Example 1 determination of SSR molecular markers and primers of Lepista sordida

Designing 50 pairs of SSR site primers as primary screening primers according to the whole genome DNA of Lepista sordida, adding primer sequences of 16 basic groups of universal tags to 5' ends of all forward primers F during synthesis, and carrying a plurality of Tag sequences when DNA is amplified for the first time. And (3) performing fluorescent primer PCR on the ideal PCR product of the second round screening amplification strip, wherein the primers are Tag modified primers and corresponding reverse R primers. The purpose can be achieved by using 3 primers of a modified primer of Tag, an F primer with a Tag sequence and an R primer which can be amplified together in a multiplex mode, a fluorescent PCR product which is amplified well finally is used for detecting by a 3730xl sequencer, obtained data are analyzed by Genemapper software, and 4 pairs of primers with high specificity and good polymorphism are screened out according to the analysis result, as shown in Table 1.

TABLE 1 primer sequence information for SSR molecular markers

Example 2 identification of Lepista sordida strains by using SSR molecular markers provided by the invention

1. DNA extraction

The TSINGKE plant DNA extraction kit (universal type) is used, and the specific steps are as follows:

1.1 placing Spin Colu2 in Collection Tube, adding 250 μ l Buffer BL, and centrifuging at 12000rpm/min for 1min to activate the silica gel membrane;

1.2 taking 4 Lepista sordida strain samples (no more than 20 mg) such as GZ, Z2, JX, N006# and the like, drying mycelium, adding liquid nitrogen, and fully grinding. Grinding, placing in a 1.5 ml centrifuge tube, adding 400 μ l Buffer gP1, performing vortex oscillation for 1min, performing water bath at 65 ℃ for 10 to 30min, taking out, reversing, and mixing uniformly for full cracking;

1.3 adding 150 μ l Buffer gP2, vortex oscillating for 1min, ice bath for 5min;

1.4 Centrifuging at 12000rpm/min for 5min, and transferring the supernatant into a new centrifuge tube;

1.5 Adding absolute ethyl alcohol with the same volume as the supernatant, immediately and fully oscillating and uniformly mixing, transferring all liquid into Spin Colu2, centrifuging at 12000rpm/min for 30s, and discarding waste liquid;

1.6 Adding 150 μ l Buffer Pw (absolute ethyl alcohol is added before use) into Spin Colu2, centrifuging at 12000rpm/min for 30s, and discarding waste liquid;

1.7 Adding 150 mu l of Wash Buffer (absolute ethyl alcohol is added before use) into Spin Colu2, centrifuging at 12000rpm/min for 30s, and discarding waste liquid;

1.8 Repeating the operation step 7;

1.9 putting Spin Colu2 back into the Collection Tube, centrifuging at 12000rpm/min for 2min, uncovering and airing for 1 min;

1.10 taking out Spin Colu2, putting the Spin Colu2 into a clean centrifuge tube, adding 50-100 mu l of TE Buffer (preheating the TE Buffer at 65 ℃) at the center of an adsorption film, standing for 2min at 20-25 ℃, and centrifuging for 2min at 12000 rpm/min.

2. SSR-PCR (simple sequence repeat-polymerase chain reaction) screening amplification and product detection

2.1 Fluorescent primer synthesis and PCR amplification

SSR-PCR amplification is carried out on all sample DNA by using 4 pairs of screened specific primers, and the components of an amplification system and reaction conditions are shown in Table 2: the synthesis of fluorescent primers and the sequencing of PCR products are completed by the department of Ongji Biotechnology Limited.

TABLE 2 PCR amplification System and reaction conditions

The above amplification system was amplified according to the following amplification procedure (see table 3):

TABLE 3 PCR amplification procedure

The information of the 4 Lepista sordida strains is shown in Table 4:

TABLE 4 Lepista sordida strains Source information

2.2 Electrophoretic detection

And (3) carrying out agarose gel electrophoresis (2 ul of sample +6ul of bromophenol blue) on the amplified PCR product, obtaining an identification gel image under the voltage of 300V for 12 minutes, determining the concentration of the template through the gel image, and adding water to dilute the template to the concentration required by capillary electrophoresis.

2.3 Capillary detection

2.3.1 internal standards of didi and GS500 were expressed as 130:1, mixing to prepare mix;

2.3.2 Mix was dispensed using a domestic 96 well reaction plate, 10ul of mix was added to each well;

2.3.3 adding 0.5ul of sample template into a 96-well plate correspondingly, and stopping when the sample template is centrifuged to 4000 rpm;

2.3.4 the mixing plate is heated by a metal bath heater at 95 ℃ for pre-denaturation for 5 minutes and is immediately placed at-20 ℃ after being taken out;

2.3.5 taking out after cooling, centrifuging at 4000 rpm, unfreezing and uniformly mixing;

2.3.6 performing capillary electrophoresis on the sample by using a 3730 sequencer;

2.3.7 obtaining and analyzing the result of the machine, and screening out the site with better polymorphism.

2.4 analysis of results

The results of the take-down machine were obtained by capillary electrophoresis and analyzed to obtain fluorescence detection peak maps of capillary electrophoresis of the amplification products of 4 Lepista sordida strains, as shown in FIGS. 1 to 4. Comparing capillary electrophoresis images of different primers amplified by the 4 Lepista sordida strains, the peaks of each fluorescent label of the 4 strains are not overlapped, and some strains have two peak values, are clear and distinguishable and have specificity, and are also distinguished from one another. The invention shows that the 4 pairs of SSR molecular marker primers provided by the invention can accurately distinguish 4 Lepista sordida strains.

3. SSR marker-based cluster analysis

Genetic diversity analysis is carried out on the Lepista sordida strains of 4 strains based on 4 SSR loci, and UPGMA trees of the 4 Lepista sordida strains are constructed based on the genetic distance of Nei for clustering analysis. The results showed that the genetic distance of strains GZ and JX was the closest and the genetic distance of strain Z2 was the farthest, as shown in fig. 5; the strain N006# is singly gathered into one strain, which indicates that the strain has specificity different from the other three strains. Further illustrates that the 4 pairs of SSR molecular marker primers provided by the invention can distinguish Lepista sordida strain N006# from other strains of Lepista sordida.

SEQUENCE LISTING

<110> research institute for Kunming edible fungi of China's national supply and marketing cooperative general society

<120> SSR molecular marker and method for identifying Lepista sordida N006# strain

<130> 20210410

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 165

<212> DNA

<213> Artificial sequence

<400> 1

cctcttcggg cctttgtaat gatggaggag ccgcggcggt agtcgaccac cagggacatg 60

ttgtcctcga tggtgatgcc ctcgtcgaag acgtcacgat cgcgcaggta gccgtcgtgg 120

tgctccgtgg tcgtagtaga gccccttgaa ctgcaggacc cagta 165

<210> 2

<211> 259

<212> DNA

<213> Artificial Synthesis

<400> 2

cttcgagtgt tgcccgatga gatggcacag agatatcaac agcaagcaca cagcaacaac 60

agcaacaaca acatcagcag cagcaacatc agcaacagca acaacaacaa cagcagagac 120

caccacaaca gatgcaacag caacagatac aacagcaaca gccaccgcct cctcaaccac 180

agttgcagca tcaccagcca cccccacaac ctgcccaata caatagcctt gtgaccacac 240

aacgcagaca gagagaatg 259

Claims (2)

1. The SSR molecular marker primers for identifying Lepista sordida N006 strain are characterized by comprising 4 pairs of SSR molecular marker primers including LXSSR 001, LXSSR 004, LXSSR 015 and LXSSR 041, wherein the nucleotide sequences of each primer pair are respectively as follows:

LXSSSR001-F:ATGTAATGATGGAGGAGCCG，

LXSSSR001-R:ACTGGGTCCTGCAGTTCAAG；

LXSSSR004-F:CGAGTGTTGCACGATGAGAT，

LXSSSR004-R:CTCTGTCTGCGTTGTGTGGT；

LXSSSR015-F:TGAGAGGTATGCTGGTGCTG，

LXSSSR015-R:CCCTGAACTTGGCCATTAGA；

LXSSSR041-F:ACACTGGTGAAGGAGTTGGG，

LXSSSR041-R:TCGTGAGGGTGAGCCTTATC。

2. a method for identifying Lepista sordida N006 strain based on SSR molecular marker primers in claim 1 is characterized by comprising the following steps:

1) Extracting DNA of Lepista sordida N006 strain and other strain Lepista sordida strains;

2) Performing PCR amplification by using the extracted DNA as a template and the SSR molecular marker primer;

3) And (3) performing capillary electrophoresis detection on the amplification product obtained in the step 2), and comparing a fluorescence detection peak image to identify the Lepista sordida N006# strain.

Images