CN113151567A - SSR molecular marker and method for identifying Lepista sordida N006# strain - Google Patents

Abstract

The invention discloses an SSR molecular marker and a method for identifying Lepista sordida N006# strain, wherein the SSR molecular marker is the following combination of 4 pairs of SSR molecular markers: LXSSR 001, LXSSR 004, LXSSR 015 and LXSSR 041, the nucleotide sequences corresponding to the primers LXSSR 001 and LXSSR 004 are shown as SEQ ID NO.1 and SEQ ID NO. 2, respectively. The method for identifying Lepista sordida N006 strain by adopting the SSR molecular marker comprises the following steps: 1) extracting DNA of Lepista sordida N006 strain and other strain Lepista sordida strains; 2) carrying out PCR amplification by using the extracted DNA as a template according to the SSR molecular marker primer; 3) and (3) carrying out capillary electrophoresis detection on the amplified product, comparing a fluorescence detection peak image, constructing a UPGMA tree according to the data, and carrying out cluster analysis. Compared with conventional morphological detection, fruiting experiments and antagonism experiments, the method for identifying Lepista sordida by SSR molecular markers has the advantages of high accuracy, good repeatability, simplicity and convenience in operation and the like, and can be used for quickly identifying the strain N006 #.

Description

SSR molecular marker and method for identifying Lepista sordida N006# strain

Technical Field

The invention belongs to the field of edible fungus molecular biology, and particularly relates to an SSR molecular marker and a method for identifying Lepista sordida N006# strain.

Background

Lepista sordida (Schumach.) Singer also named "Lepista sordida", Lepista sordida, etc., belonging to Tricholomataceae (Tricn 006# olympaceae), Lepista (Tricholoma)Lepista). The fungus is a rare fungus for both medicine and food, has rich protein content and more complete amino acids, especially rich calcium, iron, zinc, potassium, phosphorus and vitamin C, and has trace element selenium content 10-20 times that of wild fungus such as Collybia albuminosa, Craib, Boletus serohilus, Rhodococcus rhodochrous, etc. The market price of the fresh mushrooms is about 60-120 yuan/kg, and the cultivation and popularization prospect is very wide.

The earliest written record of the lepista sordida in China begins from the report of the lepista sordida cultivation in the early 90 s of the 20 th century, in recent years, the artificial cultivation technology of the lepista sordida is preliminarily mature, and a certain scale of demonstration planting area is formed in the regions of Sichuan, Hunan, Yunnan, Guizhou, Heilongjiang and the like in China, so that the economic benefit is good. However, the research of China on the breeding of the new Lepista sordida species is still not perfect enough, and the strain for commercial cultivation is lacked, the cultivated strain is obtained by gradually breeding after being domesticated by wild strains in various domestic production areas, different genetic backgrounds exist among the wild strains, the individual difference is large, and long-term strain breeding practice proves that the strain domesticated by the wild fruiting body is not necessarily an ideal strain with strong activity, stable genetic characteristic, quick fruiting and high yield.

Therefore, after the excellent strains which are verified by tests are obtained, the strains of the excellent strains need to be accurately identified so as to conveniently distinguish different strains, thereby avoiding the phenomenon that the bred excellent strains of the lepista sordida are mixed with other same strains to cause the occurrence of the phenomenon of same name and different varieties or same name and different names in the production, operation and market circulation processes. The SSR molecular marker has the advantages of wide distribution in gene pairs, specific locus, high repeatability and the like, and can be used for identifying the variation among different varieties and strains of the same species with high precision.

At present, reports of applying SSR molecular markers based on whole genes to Lepista sordida germplasm resource diversity are not seen.

Disclosure of Invention

The first purpose of the invention is to provide an SSR molecular marker for identifying Lepista sordida N006# strain, and the second purpose of the invention is to provide a method for identifying Lepista sordida N006# strain by using the SSR molecular marker.

The Lepista sordida N006 strain is preserved in China general microbiological culture Collection center (CGMCC) at 2016, 6 and 1; the preservation number is CGMCC NO. 12507.

The first purpose of the invention is realized by the SSR molecular marker for identifying the Lepista sordida N006# strain, which comprises the following 4 pairs of SSR molecular marker combinations: LXSSR 001, LXSSR 004, LXSSR 015 and LXSSR 041, wherein the nucleotide sequences corresponding to LXSSR 001 and LXSSR 004 are shown as SEQ ID NO.1 and SEQ ID NO. 2, respectively.

The second purpose of the invention is realized by adopting the SSR molecular marker to identify Lepista sordida N006 strain, which comprises the following steps:

1) extracting DNA of Lepista sordida N006 strain and other strain Lepista sordida strains;

2) performing PCR amplification according to the SSR molecular marker primer by taking the extracted DNA as a template;

3) and (3) performing capillary electrophoresis detection on the amplification product obtained in the step (2), comparing a fluorescence detection peak image, constructing a UPGMA tree according to the data, and performing cluster analysis.

The invention uses SSR molecular marker primers to perform PCR specific amplification on Lepista sordida strain N006# and other Lepista sordida strains Z2, GZ, JX and the like with different geographical sources, and generates specific maps by combining an accurate quantitative capillary electrophoresis fluorescence detection method. The invention discloses 4 pairs of unique SSR primers, and combines with Lepista sordida fingerprint spectrum analysis of other varieties of strains, so that the Lepista sordida strain N006# can be accurately and quickly identified.

The invention has the beneficial effects that:

1) compared with conventional morphological detection and antagonism experiments, the identification method of the Lepista sordida N006# strain provided by the invention has the advantages of high accuracy, good repeatability, simplicity and convenience in operation and the like, can be used for quickly distinguishing the strain N006# from other strains of Lepista sordida, and can be used for quickly identifying the strain N006 #.

2) The SSR molecular markers can be used for quickly identifying in a hypha stage, fruiting is not required to be judged according to fruiting body agronomic characters, the time and the strength are saved, subjective misjudgment is avoided, and different strain strains of the Lepista sordida can be accurately identified, so that the phenomenon that the excellent strain of the selected Lepista sordida is mixed with other same strains in the production, management and market circulation processes to cause the phenomenon of same name and different names is avoided, and the intellectual property rights of the Lepista sordida are effectively protected. The method has important significance for identifying the authenticity of the variety in the production process of the Lepista sordida.

3) The SSR molecular marker method for Lepista sordida provided by the invention can make up for the blank of specific molecular markers of Lepista sordida, and provides a powerful research tool for genetic diversity, colony genetics and germplasm identification research of the Lepista sordida.

Drawings

FIG. 1 is a capillary electrophoresis diagram of the Lepista sordida N006# strain amplified by the 4 pairs of SSR molecular marker primers of the invention, and a, b, c and d are capillary electrophoresis diagrams of the strain N006# amplified by the primers LXSSR 001, LXSSR 004, LXSSR 015 and LXSSR 041 respectively;

FIG. 2 is a capillary electrophoresis diagram of a Lepista sordida GZ strain respectively amplified by SSR molecular marker primers of the invention 4, and diagrams a, b, c and d are capillary electrophoresis diagrams of strains GZ amplified by primers LXSSR 001, LXSSR 004, LXSSR 015 and LXSSR 041 respectively;

FIG. 3 is a capillary electrophoresis diagram of Lepista sordida Z2 strain amplified by SSR molecular marker primers of the invention 4 pairs, and diagrams a, b, c and d are capillary electrophoresis diagrams of LXSSR 001, LXSSR 004, LXSSR 015 and LXSSR 041 amplified strain Z2;

FIG. 4 is a capillary electrophoresis diagram of a Lepista sordida JX strain amplified by a pair of SSR molecular marker primers respectively according to the invention, and diagrams a, b, c and d are capillary electrophoresis diagrams of strains JX amplified by primers LXSSR 001, LXSSR 004, LXSSR 015 and LXSSR 041 respectively;

FIG. 5 shows genetic distance UPGMA tree of 4 Lepista sordida strains constructed based on SSR molecular markers.

Detailed Description

The present invention will be further described with reference to the following specific examples.

Example 1 determination of SSR molecular markers and primers of Lepista sordida

Designing 50 pairs of SSR site primers as primary screening primers according to the whole gene pair DNA of Lepista sordida, adding primer sequences of 16 basic groups of universal Tag to 5' ends of all forward primers F during synthesis, and carrying a plurality of Tag sequences when DNA is amplified for the first time. And (3) performing fluorescent primer PCR on the ideal PCR product of the second round screening amplification strip, wherein the primers are Tag modified primers and corresponding reverse R primers. The purpose can be achieved by using 3 primers of a modified primer of Tag, an F primer with a Tag sequence and an R primer which can be amplified together in a multiplex mode, a fluorescent PCR product which is amplified well finally is used for detecting by a 3730xl sequencer, obtained data are analyzed by Genemapper software, and 4 pairs of primers with high specificity and good polymorphism are screened out according to the analysis result, as shown in Table 1.

TABLE 1 primer sequence information for SSR molecular markers

Example 2 identification of Lepista sordida strains by using SSR molecular markers provided by the invention

1. DNA extraction

The TSINGKE plant DNA extraction kit (universal type) is used, and the specific steps are as follows:

1.1 Spin Colu2 was placed in the Collection Tube, and 250 was addedµl Buffer BL, centrifuging at 12000rpm/min for 1min to activate the silica gel membrane;

1.2 dried mycelia (not more than 20 mg) of 4 Lepista sordida strains such as GZ, Z2, JX, N006# and the like were taken, and thoroughly ground by adding liquid nitrogen. Grinding, placing in a 1.5 ml centrifuge tube, adding 400µl Buffer gP1, vortex and oscillate for 1min, water bath at 65 ℃ for 10-30 min, and during the period, the mixture can be taken out, inverted and mixed evenly for full cracking;

1.3 addition of 150µl Buffer gP2, vortex and shake for 1min, ice bath for 5 min;

1.412000 rpm/min for 5min, transferring the supernatant to a new centrifuge tube;

1.5 adding absolute ethyl alcohol with the same volume as the supernatant, immediately and fully oscillating and uniformly mixing, transferring all liquid into Spin Colu2, centrifuging at 12000rpm/min for 30s, and discarding waste liquid;

1.6 addition of 150 to Spin Colu2µl Buffer Pw (absolute ethyl alcohol is added before use), centrifuging at 12000rpm/min for 30s, and discarding waste liquid;

1.7 addition of 150 to Spin Colu2µl WasN006# Buffer (absolute ethyl alcohol is added before use), centrifuging at 12000rpm/min for 30s, and discarding the waste liquid;

1.8 repeating the operation step 7;

1.9 putting Spin Colu2 back into Collection Tube, centrifuging at 12000rpm/min for 2min, uncovering and airing for 1 min;

1.10 taking out Spin Colu2, putting into a clean centrifuge tube, adding 50-100 μ l TE Buffer (preheating TE Buffer at 65 ℃) at the center of the adsorption film, standing for 2min at 20-25 ℃, and centrifuging for 2min at 12000 rpm/min.

2. SSR-PCR screening amplification and product detection

2.1 fluorescent primer Synthesis and PCR amplification

SSR-PCR amplification is carried out on all sample DNA by using the screened 4 pairs of specific primers, and the pairs of amplification systems and reaction conditions are shown in Table 2: the synthesis of fluorescent primers and the sequencing of PCR products are completed by the department of Ongji Biotechnology Limited.

TABLE 2 PCR amplification System and reaction conditions

The above amplification system was amplified according to the following amplification procedure (see table 3):

TABLE 3 PCR amplification procedure

The information of the 4 Lepista sordida strains is shown in Table 4:

table 44 Lepista sordida strain source information

2.2 electrophoretic detection

And (3) carrying out agarose gel electrophoresis (2 ul of sample +6ul of bromophenol blue) on the amplified PCR product, obtaining an identification gel picture under the voltage of 300V for 12 minutes, determining the concentration of the template through the gel picture, and adding water to dilute the template to the concentration required by capillary electrophoresis.

2.3 capillary detection

2.3.1 internal standards of iDi and GS500 were expressed as 130: 1, mixing to prepare mix;

2.3.2 Mix was dispensed using a domestic 96 well reaction plate, 10ul of mix was added to each well;

2.3.3 adding 0.5ul of sample template into a 96-well plate correspondingly, and stopping when the sample template is centrifuged to 4000 rpm;

2.3.4 the mixing plate is heated by a metal bath heater at 95 ℃ for pre-denaturation for 5 minutes and is immediately placed at-20 ℃ after being taken out;

2.3.5 taking out after cooling, centrifuging at 4000 rpm, unfreezing and uniformly mixing;

2.3.6 performing capillary electrophoresis with 3730 sequencer;

2.3.7 obtaining and analyzing the results of the machine, and screening out the sites with better polymorphism.

2.4 analysis of results

The results of the take-down machine were obtained by capillary electrophoresis and analyzed to obtain fluorescence detection peak maps of capillary electrophoresis of the amplification products of 4 Lepista sordida strains, as shown in FIGS. 1 to 4. Comparing capillary electrophoresis images of different primer amplifications of the 4 Lepista sordida strains, the peaks of each fluorescent label of the 4 strains are not overlapped, and some strains have two peak values, are clear and distinguishable and have specificity, and are also distinguished from each other. The invention shows that the 4 pairs of SSR molecular marker primers provided by the invention can accurately distinguish 4 Lepista sordida strains.

3. SSR marker-based clustering analysis

Genetic diversity analysis is carried out on the Lepista sordida strains of 4 strains based on 4 SSR loci, and UPGMA trees of the 4 Lepista sordida strains are constructed based on the genetic distance of Nei for clustering analysis. The results showed that strains GZ and JX were the closest in genetic distance and strain Z2 was the farthest in genetic distance, as shown in fig. 5; the strain N006# is singly gathered into one strain, which indicates that the strain has specificity different from the other three strains. Further illustrates that the 4 pairs of SSR molecular marker primers provided by the invention can distinguish Lepista sordida strain N006# from other strains of Lepista sordida.

SEQUENCE LISTING

<110> research institute of edible fungi of Kunming, China's national supply and marketing Cooperation headquarters

<120> SSR molecular marker and method for identifying Lepista sordida N006# strain

<130> 20210410

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 165

<212> DNA

<213> Artificial sequence

<400> 1

cctcttcggg cctttgtaat gatggaggag ccgcggcggt agtcgaccac cagggacatg 60

ttgtcctcga tggtgatgcc ctcgtcgaag acgtcacgat cgcgcaggta gccgtcgtgg 120

tgctccgtgg tcgtagtaga gccccttgaa ctgcaggacc cagta 165

<210> 2

<211> 259

<212> DNA

<213> Artificial Synthesis

<400> 2

cttcgagtgt tgcccgatga gatggcacag agatatcaac agcaagcaca cagcaacaac 60

agcaacaaca acatcagcag cagcaacatc agcaacagca acaacaacaa cagcagagac 120

caccacaaca gatgcaacag caacagatac aacagcaaca gccaccgcct cctcaaccac 180

agttgcagca tcaccagcca cccccacaac ctgcccaata caatagcctt gtgaccacac 240

aacgcagaca gagagaatg 259

Claims (3)

1. The SSR molecular marker for identifying Lepista sordida N006 strain is characterized by comprising the following 4 pairs of SSR molecular marker combinations: LXSSR 001, LXSSR 004, LXSSR 015 and LXSSR 041, the nucleotide sequences corresponding to LXSSR 001 and LXSSR 004 are shown as SEQ ID NO:1 and SEQ ID NO:2, respectively.

2. The SSR molecular marker according to claim 1, wherein the primer sequences of said SSR molecular marker are respectively:

LXSSSR001-F：ATGTAATGATGGAGGAGCCG；

LXSSSR001-R：ACTGGGTCCTGCAGTTCAAG；

LXSSSR004-F：CGAGTGTTGCACGATGAGAT；

LXSSSR004-R:CTCTGTCTGCGTTGTGTGGT；

LXSSSR015-F:TGAGAGGTATGCTGGTGCTG；

LXSSSR015-R:CCCTGAACTTGGCCATTAGA；

LXSSSR041-F:ACACTGGTGAAGGAGTTGGG；

LXSSSR041-R:TCGTGAGGGTGAGCCTTATC。

3. a method for identifying lepista sordida N006# strain by using SSR molecular markers according to claim 1 or 2, comprising the steps of:

1) extracting DNA of Lepista sordida N006 strain and other strain Lepista sordida strains;

2) performing PCR amplification according to the SSR molecular marker primer by taking the extracted DNA as a template;

3) and (3) carrying out capillary electrophoresis detection on the amplification product obtained in the step (2), and comparing a fluorescence detection peak image.

Images