WO2023087784A1

WO2023087784A1 - Dna barcode for screening floccularia luteovirens using content of total polyphenol as index

Info

Publication number: WO2023087784A1
Application number: PCT/CN2022/109894
Authority: WO
Inventors: 杨满军
Original assignee: 杨满军
Priority date: 2021-11-19
Filing date: 2022-08-03
Publication date: 2023-05-25
Also published as: US20240218462A1; CN114134248B; CN114134248A; ZA202210225B

Abstract

Disclosed in the present invention are a DNA barcode for screening Floccularia luteovirens using the content of the total polyphenol as an index, a primer set and the use. The DNA barcode technology of the present invention has the advantages of saving time, labor and money, accuracy and a high efficiency, plays an active role in the geographical origin identification and genetic breeding of high-quality Floccularia luteovirens, and at the same time also provides an effective method for the identification and protection of germplasm resources.

Description

A DNA barcode for screening the total polyphenol content index of yellow-green mushrooms

technical field

The invention relates to the technical field of edible fungus germplasm resources screening, and more specifically relates to a DNA barcode, primer set and application for screening indicators of total polyphenol content of Pleurotus pilosula.

Background technique

Yellow-green mushroom, golden in color, also known as chanterelle and golden mushroom, is a high-quality edible fungus with unique flavor, which cannot be cultivated artificially at present. Wild yellow-green mushrooms are mainly distributed in the Qinghai-Tibet Plateau. The main production areas are Damxung County in the Tibet Autonomous Region, Qilian County in Qinghai Province, and Shiqu County in Sichuan Province. The quality of these three main production areas is also the best. The main indicators for evaluating the nutritional value, flavor and biological activity of the yellow-green mushroom include: high content of total soluble protein, total soluble amino acid, total polyphenol, total polysaccharide and total fat, and strong antioxidant activity. Different origins of yellow-green mushrooms have different nutritional values, different flavors, different biological activities, and different market prices. In the past, the breeding of yellow-green mushrooms mainly used morphological methods combined with the determination of beneficial component content indicators. However, affected by the special Qinghai-Tibet plateau climate environment, yellow-green mushrooms produced in different regions often have the same name and different substances. The phenomenon of synonymous with the same thing, so the morphological identification method is difficult to effectively distinguish. What is more difficult is that high-quality strains with high content of total soluble protein, total soluble amino acid, total polyphenol, total polysaccharide and total fat and strong antioxidant activity cannot be screened out by morphological methods. In addition, due to the high altitude of the main production areas where it is distributed, there are also great difficulties in sample collection.

DNA barcode molecular identification technology is a molecular biology technique based on DNA barcode (conserved and stable genetic DNA sequence in the genome) to identify species and good quality. It is an effective supplement and expansion of traditional breeding methods, and it can accurately and effectively identify samples when their morphology is incomplete or lacks morphological structure (processed products such as powder, etc.). In order to realize the effective development and utilization of Pleurotus chinensis, it is particularly important and urgent to use DNA barcode molecular identification technology to assist in the screening of different origins of Pleurotus edulis strains. In the existing DNA barcoding technology, the ITS (ribosomal RNA internal transcriptional spacer) and the non-coding region or conserved gene sequence in the mitochondria are mainly used for species identification; restriction fragment length polymorphism (restriction fragment length polymorphism, RFLP ) operation is very complicated, the reliability and repeatability of the results are poor, random amplified polymorphic DNA (random amplified polymorphic DNA, RAPD) is susceptible to interference, requires a high level of operator skills, and is difficult to promote in assisted breeding ; Single nucleotide polymorphism (single nucleotide polymorphism, SNP) requires high equipment and high cost.

Therefore, in view of the shortcomings of traditional breeding methods that are not accurate enough to be time-consuming and labor-intensive, how to provide a DNA barcode that can accurately and quickly identify the strains of the yellow-green mushroom and simultaneously achieve high-quality breeding is cost-effective. Low cost, high efficiency, easy operation, stable results, high reliability and good repeatability are the problems that those skilled in the art need to solve urgently.

Contents of the invention

In view of this, the present invention provides a DNA barcode and primer set for screening indicators of the total polyphenol content of Pleurotus pilosula, which can quickly and accurately screen out bacterial strains with high total polyphenol content in Pleurotus pubescens. High-quality yellow-green shiitake mushrooms provide a beneficial adjunct.

In order to achieve the above object, the present invention adopts the following technical solutions:

A DNA barcode for screening indicators of the total polyphenol content of Pleurotus pilosula, the nucleotide sequence of the DNA barcode includes:

Such as SEQ ID NO: 3,

and/or SEQ ID NO: 4,

and/or the combination of SEQ ID NO: 3 and SEQ ID NO: 4,

and SEQ ID NO: 7,

and/or SEQ ID NO: 8,

and/or a combination of SEQ ID NO: 7 and SEQ ID NO: 8,

and/or a combination of SEQ ID NO: 11 and SEQ ID NO: 12 and SEQ ID NO: 13,

and/or a combination of SEQ ID NO: 12 and SEQ ID NO: 13 and SEQ ID NO: 14,

and/or SEQ ID NO: 13 and SEQ ID NO: 14,

and/or SEQ ID NO: 17,

and/or SEQ ID NO: 18,

And/or one or more of the combination of SEQ ID NO:17 and SEQ ID NO:18.

The present invention is based on fluorescent PCR amplification of all simple sequence repeats (simple sequence repeat, SSR) in the whole genome of Pleurotus volvulus, establishes a DNA barcode effectively corresponding to the total polyphenol content, and the amplified fragments are compatible with the DNA of the present invention. The comparison of the barcodes can quickly and accurately screen out the strains with high total polyphenol content of the yellow-green mushroom, and provide favorable assistance for the breeding of the yellow-green mushroom.

Another object of the present invention is to provide a primer set that can amplify the DNA barcode for the above-mentioned screening indicator of the total polyphenol content of Pleurotus volvulus, wherein the nucleotide sequence of the primer set includes:

Such as SEQ ID NO: 1 and SEQ ID NO: 2,

and/or SEQ ID NO: 5 and SEQ ID NO: 6,

and/or SEQ ID NO: 9 and SEQ ID NO: 10,

And/or one or more of SEQ ID NO:15 and SEQ ID NO:16.

As a preferred technical solution of the present invention, it is characterized in that the nucleotide sequence of the primer set includes:

Such as SEQ ID NO: 1 and SEQ ID NO: 2,

and SEQ ID NO: 5 and SEQ ID NO: 6,

and SEQ ID NO: 9 and SEQ ID NO: 10,

and SEQ ID NO: 15 and SEQ ID NO: 16.

Different primer sets of the present invention can be used alone or in combination to screen the total polyphenol content of Pleurotus chinensis, and when all the primer sets are used together, the screening accuracy is the highest.

Yet another object of the present invention is, a kind of method for screening yellow-green mushroom with total polyphenol content index, comprises the following steps:

S1, extracting the genomic DNA of the sample to be tested;

S2. Using S1 genomic DNA as a template, the above-mentioned one or more sets of primers are respectively subjected to fluorescent PCR amplification reactions to obtain amplification products;

The amplified products described in S3 and S2 are detected by capillary fluorescence electrophoresis, and determined by the number of fragments of the amplified product, the number of SSR sites, the SSR repeat elements and the number of repeats thereof.

As a preferred technical solution of the present invention, the criteria for determining step S3 are:

The primer sets of SEQ ID NO: 1 and SEQ ID NO: 2 amplified to obtain a 229bp fragment containing 5 AAG repeat elements and a 232bp fragment containing 6 AAG repeat elements;

And/or SEQ ID NO: 5 and SEQ ID NO: 6 contain a primer set to amplify a 218bp fragment containing 7 TCC repeat elements and a 221bp fragment containing 8 TCC repeat elements;

And/or SEQ ID NO: 9 and SEQ ID NO: 10 contain primer sets to amplify to obtain a 233bp fragment containing 8 AT repeat elements, a 235bp fragment containing 9 AT repeat elements and a 237bp fragment containing 10 AT repeat elements;

And/or when SEQ ID NO: 15 and SEQ ID NO: 16 contain a primer set to amplify a 212bp fragment containing 5 GCT repeating elements and a 215bp fragment containing 6 GCT repeating elements, it is determined that the yellow-green Pleurotus edodes is the total Yellow-green shiitake mushroom with high polyphenol content.

As a preferred technical solution of the present invention, the reaction system of the fluorescent PCR amplification reaction described in step S2 is:

2×Taq PCR MasterMix 5 μL, genomic DNA 1 μL, upstream primer 0.1 μL, downstream primer 0.4 μL, fluorescent M13 primer 0.4 μL, dilute to 10 μL with sterile deionized water.

More preferably, the concentrations of the upstream primers, downstream primers and fluorescent M13 primers are all 10uM.

As a preferred technical solution of the present invention, the fluorescent PCR amplification reaction procedure described in step S2 is:

Pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 30s, drop PCR annealing at 62 to 55°C for 30s, extension at 72°C for 30s, a total of 10 cycles; denaturation at 95°C for 30s, annealing at 52°C for 30s, extension at 72°C for 30s, a total of 25 cycles; The final extension was 20min at 72°C; after incubation at 4°C for 6h, it was used for fluorescence capillary electrophoresis detection.

Another object of the present invention is to provide the application of the above-mentioned DNA barcode and/or the above-mentioned primer set in the preparation of products for screening high-quality yellow-green mushrooms based on the total polyphenol content index.

Another object of the present invention is to provide a product for screening high-quality yellow-green mushrooms based on the total polyphenol content index, which contains one or more sets of primers mentioned above, and meets the standards: SEQ ID NO: 1 and SEQ ID NO: 2 primer sets amplified to obtain a 229bp fragment containing 5 AAG repeat elements and a 232bp fragment containing 6 AAG repeat elements;

And/or SEQ ID NO: 15 and SEQ ID NO: 16 contain primer sets to amplify to obtain a 212bp fragment containing 5 GCT repeat elements and a 215bp fragment containing 6 GCT repeat elements.

As a preferred technical solution of the present invention, the product is a kit.

It can be seen from the above-mentioned technical scheme that, compared with the prior art, the present invention discloses a DNA barcode and primer set for screening indicators of total polyphenol content, which can be carried out using wild samples of Pleurotus pilosula and a small amount of tissue or mycelia. Breeding of excellent strain traits; it can be identified in different growth stages such as mycelium, primordia, fruiting bodies, spores, etc. of Pleurotus chinensis; the detection cycle is short, the operation is simple, and it will not cause waste, the results are stable, reliable and repeatable Well, it overcomes the time-consuming and labor-intensive shortcoming of the traditional breeding method for selecting and breeding the yellow-green mushroom strains.

Compared with the traditional breeding method and other existing DNA barcode technologies, the present invention has the advantages of saving time, effort, money, accuracy and high efficiency, and plays an active role in the screening of high-quality yellow-green mushroom characters and genetic breeding, and at the same time It also provides an effective method for the identification and protection of germplasm resources.

Description of drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings that need to be used in the description of the embodiments or the prior art. Obviously, the accompanying drawings in the following description are only It is an embodiment of the present invention, and those skilled in the art can also obtain other drawings according to the provided drawings without creative work.

Accompanying drawing of Fig. 1 is the total polyphenol content contrast result figure of test example of the present invention, comparative example 1 and 2;

Accompanying drawing of Fig. 2 is that the present invention utilizes primer 1 fluorescent PCR amplification comparative example 1, 2 and test example result figure;

Accompanying drawing of Fig. 3 is that the present invention utilizes primer 2 fluorescent PCR amplification comparative examples 1, 2 and test example result figure;

Accompanying drawing of Fig. 4 is that the present invention utilizes primer 3 fluorescent PCR amplification comparative examples 1, 2 and test example result figure;

Fig. 5 is a diagram showing results of comparative examples 1 and 2 and test examples using primer 4 in the present invention for fluorescent PCR amplification.

Detailed ways

The following will clearly and completely describe the technical solutions in the embodiments of the present invention with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only some, not all, embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by persons of ordinary skill in the art without making creative efforts belong to the protection scope of the present invention.

The embodiment of the invention discloses a DNA barcode, primer set and application for screening indicators of total polyphenol content in Pleurotus volvulus. The reagents used are all commercially available, and their sources are not specifically limited, and the test methods used are conventional methods unless otherwise mentioned.

The construction of the DNA barcode of embodiment 1 yellow-green mushroom

Genome sequencing was carried out on the samples of Dangxiong County in Tibet Autonomous Region, Qilian County in Qinghai Province, and Shiqu County in Sichuan Province. The SSR loci in the genome sequences were analyzed using the MISA program.

Design primers for PCR amplification of these SSR loci, retain primers that can amplify the corresponding fragments, and discard invalid primers.

The content of total polyphenols was determined in the samples of Dangxiong County of Tibet Autonomous Region, Qilian County of Qinghai Province and Shiqu County of Sichuan Province.

The samples from the above three origins were respectively amplified using effective primers and detected by capillary electrophoresis. The simple sequence repeat (SSR) site corresponding to the total polyphenol content was established through analysis. Finally, 4 pairs of primers (see Table 1) were obtained, and the fragment polymorphisms obtained by using these 4 pairs of primers to amplify the sample genome can assist in screening the yellow-green mushrooms with high total polyphenol content.

Table 1 Specific primers for the screening of high-quality strains with high total polyphenol content in Pleurotus pubescens

Example 2 Amplification of SSR-specific primers for the total polyphenol content of Pleurotus pubescens

(1) Extraction of total polyphenols

Collect the fruiting bodies of Dangxiong County in Tibet Autonomous Region, Qilian County in Qinghai Province, and Shiqu County in Sichuan Province, dehydrate them by vacuum freeze-drying, crush them and pass through a 50-mesh sieve, add 20 mL of double-distilled water to 1 gram of dry powder, Extract with 300W ultrasonic wave for 30min, then centrifuge at 5000r/min for 30min, and take the supernatant to prepare total polyphenol extract. The determination of the total polyphenol content in the fruiting body extract of Pleurotus velutipes was determined by the Folin phenol method, specifically referring to Wang Jiadan et al. University Journal (Natural Science Edition), 2017,39(02):113-120.), and converted to mg per gram. Among them, the total polyphenol content in the yellow-green Pleurotus edodes in Qilian County, Qinghai Province was 7.67 (± 0.06) mg per gram, which was determined as a test example, and the total polyphenol content in the yellow-green Pleurotus pilosa in Dangxiong County, Tibet Autonomous Region was 7.06 (± 0.06) mg/g. 0.13) mg per gram was determined as comparative example 1, and the total polyphenol content in the yellow-green mushroom in Shiqu County, Sichuan Province was 6.25 (±0.1) mg per gram and determined as comparative example 2 (see accompanying drawing 1).

(2) Using Sangon Bioengineering (Shanghai) Co., Ltd. Ezup Column Fungal Genomic DNA Extraction Kit (Cat. No. B518259) to extract the genome of the yellow-green mushroom sample, dilute to 20ng/μL for fluorescent PCR amplification.

(3) The primers in Table 1 were used to amplify the SSR DNA barcode by fluorescent PCR.

Fluorescent PCR amplification reaction system (10 μL): 2×Taq PCR MasterMix 5 μL, template (genomic DNA) 1 μL, upstream primer 0.1 μL, downstream primer 0.4 μL (concentration of both upstream and downstream primers is 10 uM), fluorescent M13 primer (concentration 10uM) 0.4 μL, dilute to 10 μL with sterile deionized water;

Reaction conditions: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 30 s, drop PCR annealing at 62 to 55°C for 30 s, extension at 72°C for 30 s, a total of 10 cycles; denaturation at 95°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 30 s, a total of 25 cycles 72°C final extension for 20min; 4°C incubation for 6h for fluorescence capillary electrophoresis detection.

(4) After quantitatively diluting the PCR product, take 1 μL of the PCR diluted product and add 9 μL of formamide (containing 1% internal standard) to denature it, and then put it on a DNA sequencer ABI 3730xl for capillary fluorescence electrophoresis detection. The internal standard is LIZ-500 Molecular weight internal standard (also known as molecular weight internal control, internal lane standards) is composed of 16 double-stranded DNA fragments labeled with LIZ fluorescein (orange), and the molecular weights are: 35, 50, 75, 100 , 139, 150, 160, 200, 250, 300, 340, 350, 400, 450, 490, and 500bp. The size of the fragment in the electrophoresis image of the amplification result is equal to the actual bp number of the amplified fragment plus the M13 fluorescent primer (about 18bp), with an error of 1-2bp. The peak number of the amplified capillary electrophoresis combined with the sequencing result indicates that the heterozygous amplified fragment of the gene quantity.

(5) Using the above method to identify the yellow-green mushrooms of the test example, comparative example 1 and comparative example 2.

The amplification result of primer 1 is shown in Figure 2. When primer 1 was used for fluorescent PCR amplification, 2 fragments (2 peaks) were amplified, containing 2 SSR sites, and the SSR repeating element was AAG. The characteristics of the amplified fragments obtained in the test example are 229bp fragments and 232bp fragments containing 5 and 6 repetitions respectively.

Primer 1 amplified fragment: (The length of the statistical fragment in the electropherogram includes the M13 fluorescent primer. The specific sequence display removes the M13 fluorescent primer sequence (18bp), and the underlined part is the SSR repeat element.)

229bp amplified fragment sequence:

TTGCAGAGCAAGCAAGCAAGTAGCAGACAAGTAAACCTTGAACAAGACTTGCAAATCACTATCACACAAAGCAACTACTACTACTACAATCACTAATGAACAAGAAGAAGAAGAAGTAGAACAACAAGTCTGAAGAAGCACACAGTTACTGTTATGACCTTATCTGGATACCATATATTTCCTAGACTTTAGAATATATGTATAATGTGTTCCTGCCTCATTTCT (eg Shown in SEQ ID NO: 3)

232bp amplified fragment sequence:

TTGCAGAGCAAGCAAGCAAGTAGCAGACAAGTAAACCTTGAACAAGACTTGCAAATCACTATCACACAAAGCAACTACTACTACTACAATCACTAATGAACAAGAAGAAGAAGAAGAAGTAGAACAACAAGTCTGAAGAAGCACAGTTACTGTTATGACCTTATCTGGATACCATATATTTCTCTAGACTTTAGAATATGTATAATGTGTTCCTGCCTCATTTCT (as shown in SEQ ID NO : 4)

The amplification result of primer 2 is shown in Figure 3. When primer 2 was used for fluorescent PCR amplification, 2 fragments (2 peaks) were amplified, containing 2 SSR sites, and the SSR repeating element was TCC. The characteristics of the amplified fragments obtained in the test example are 218bp fragments and 221bp fragments with 7 and 8 repetitions respectively. In Figure 3, the weak signal peaks in the amplification process of Comparative Example 1 do not contain SSR repeat elements.

Primer 2 amplified fragment: (The statistical fragment length of the electropherogram includes the M13 fluorescent primer, the specific sequence shows that the M13 fluorescent primer sequence (18bp) is removed, and the underlined part is the SSR repeat element.)

218bp amplified fragment sequence:

AGTTGGAGTTGTCCTCAGCGGCGGCCATTGCTTTCGCAACCTCGGCTTTCTGCTCCTCCTCGATACGAAGTCGTTCACGTTCCTCC TCCTCCTCCTCCTCC TTCAGCCTCTCCTGCTCCTTGGCCTGCTCTTCTGCGAGACGAACACGTTCTTTCTCTTCGTCTTCAAGCATACGTTCTTCCTCTTCTTTGCGCAAGCGTTCCCTTTCCTCCT (as in SEQ ID NO: 7)

221bp amplified fragment sequence:

AGTTGGAGTTGTCTCTCCTGCTCCTTGGCCTGC TCTTCTGCGAGACGAACACGTTCTTTCTCTTCGTCTTCAAGCGTATACGTTCTTCCTCTTCTTTGCGCAAGCGTTCCCTTTCCTCCT ( as shown in SEQ ID NO : 8)

The amplification result of primer 3 is shown in Figure 4. When primer 3 was used for fluorescent PCR amplification, 4 fragments (4 peaks) were amplified, containing 4 SSR sites, and the SSR repeating element was AT. The characteristics of the amplified fragments obtained in the test example are 233bp fragments, 235bp fragments and 237bp fragments repeated 8, 9, and 10 times respectively. In Figure 4, the 223bp amplified fragment belongs to non-specific amplification, and the weak signal peak does not contain SSR repeat elements.

Primer 3 amplified fragment: (The statistical fragment length of the electropherogram includes the M13 fluorescent primer, the specific sequence display removes the M13 fluorescent primer sequence (17bp), the error is 1bp, and the underlined part is the SSR repeat element.)

231bp amplified fragment sequence:

CTCGCTAGCGCATCGTGATAAGAAAAGAGAGAGCTTAGAAAAGAGGAAAAGTGACAAACGGAATGTAATGGTCGTGTTCGGATAAAGTAGAGCATACCTTCCCCACACCAGCCTCTTAAAACTAGTAGTACTACACATCGCATGTAAAGCGCCCCAATGACCGCGTTTCTGGATTTAAATATATAC ATATATATATAT AAATGGTCGTGTTTAGGGATA AGCCGGCC (as shown in SEQ ID NO: 11)

233bp amplified fragment sequence:

CTCGCTAGCGCATCGTGATAAGAAAAGAGAGAGCTTAGAAAAGAGGAAAAGTGACAAACGGAATGTAATGGTCGTGTTCGGATAAAGTAGAGCATACCTTCCCCACACCAGCCTCTTAAAACTAGTAGTACTACACATCGCATGTAAAGCGCCCCAATGACCGCGTTTCTGGATTTAAATATATAC ATATATATATATAT AAATGGTCGTGTTTAGGGA TAAGCCGGCC (as shown in SEQ ID NO: 12)

235bp amplified fragment sequence:

CTCGCTAGCGCATCGTGATAAGAAAAGAGAGAGCTTAGAAAAGAGGAAAAGTGACAAACGGAATGTAATGGTCGTGTTCGGATAAAGTAGAGCATACCTTCCCCACACCAGCCTCTTAAAACTAGTAGTACTACACATCGCATGTAAAGCGCCCCAATGACCGCGTTTCTGGATTTAAATATATAC ATATATATATATAT AAATGGTCGTGTTTAG GGATAAGCCGGCC (as shown in SEQ ID NO: 13)

237bp amplified fragment sequence:

CTCGCTAGCGCATCGTGATAAGAAAAGAGAGAGCTTAGAAAAGAGGAAAAGTGACAAACGGAATGTAATGGTCGTGTTCGGATAAAGTAGAGCATACCTTCCCCACACCAGCCTCTTAAAACTAGTAGTACTACACATCGCATGTAAAGCGCCCCAATGACCGCGTTTCTGGATTTAAATATATAC ATATATATATATATAT AAATGGTCGTGTTTTAG GGATAAGCCGGCC (as shown in SEQ ID NO: 14)

The amplification result of primer 4 is shown in Figure 5. When primer 4 was used for fluorescent PCR amplification, 2 fragments (2 peaks) were amplified, containing 2 SSR sites, and the SSR repeating element was GCT. The characteristics of the amplified fragments obtained in the test example are 212bp fragments and 215bp fragments containing 5 and 6 repeated GCTs respectively. In Figure 5, the weak signal peaks in the amplification process of Comparative Example 1 do not contain SSR repeat elements.

Primer 4 amplified fragment: (The statistical fragment length of the electropherogram includes the M13 fluorescent primer, the specific sequence display removes the M13 fluorescent primer sequence (18bp), and the underlined part is the SSR repeat element.)

212bp amplified fragment sequence:

GGAAGATGAGCCAGCTCCTGCTGTCACTGAACCAGAG GCT GCTGCTGCTGCT ACTACTACCACTGAGACCCCAGCTGCCACCGAGGAACCTTCTAAGGAGGAAGCTAAACCTGTATGTATACCCTAGCTTTTGTGTTAACAACACTAATTCTTTTATGTTATAGGCTGCCGATTATAGGCTGCCGATTCTGACAATGGTAAGGCTGCACGTCCAAAGAGCCCATCT (as in SEQ ID NO: 17)

215bp amplified fragment sequence:

GGAAGATGAGCCAGCTCCTGCTGTCACTGAACCAGAG GCT GCTGCTGCTGCTGCT ACTACTACCACTGAGACCCCAGCTGCCACCGAGGAACCTTCTAAGGAGGAAGCTAAACCTGTATGTATACCCCTAGCTTTTGTGTTAACAACACTAATTCTTTTATGTTATAGGCT GCCGATTCTGACAATGGTAAGGCTGCACGTCCAAAGAGCCCATCT (as SEQ ID NO: 18)

Through the comprehensive analysis of the spectra and sequencing results of the test example, comparative example 1 and comparative example 2, the DNA barcode characteristic information of the yellow-green Pleurotus edodes with high total polyphenol content is obtained as shown in Table 2. Primer 1 amplifies a 229bp fragment containing 5 AAG repeat elements (as shown in SEQ ID NO: 3) and a 232bp fragment containing 6 AAG repeat elements (as shown in SEQ ID NO: 4), and primer 2 amplifies A 218bp fragment containing 7 TCC repeat elements (as shown in SEQ ID NO: 7) and a 221bp fragment containing 8 TCC repeat elements (as shown in SEQ ID NO: 8); Primer 3 amplifies 8 AT repeats The 233bp fragment (as shown in SEQ ID NO: 12) of element, the 235bp fragment (as shown in SEQ ID NO: 13) containing 9 times of AT repeat elements and the 237bp fragment (as shown in SEQ ID NO: 10) of AT repeat elements 14); Primer 4 amplifies a 212bp fragment containing 5 GCT repeat elements (as shown in SEQ ID NO: 17) and a 215bp fragment containing 6 GCT repeat elements (as shown in SEQ ID NO: 18). Using

primers

1, 2, 3, 4 or any combination of primers can be used for comprehensive detection and judgment. When

primers

1, 2, 3, and 4 are used together, the accuracy of screening the total polyphenol content of Pleurotus chinensis is the highest. good.

Table 2 DNA barcode characteristics of the yellow-green mushroom with high total polyphenol content

Example 3 Screening and Verification of Yellow-green Pleurotus pubescens Total Polyphenol Content Index

Validation of DNA barcodes for the total polyphenol content of Pleurotus chinensis through blind experiments.

In the first blind test, samples from Qilian County, Qinghai Province, whose total polyphenol content was higher than or equal to 7.67 mg/g were used as the test group, and samples from Dangxung County, Tibet Autonomous Region, and Sichuan The samples from Shiqu County in the province are the comparison group 1 and the comparison group 2, each with 16 samples and a total of 48 samples for blind test;

The second step test, using primers (SEQ ID NO: 1 and SEQ ID NO: 2, SEQ ID NO: 5 and SEQ ID NO: 6, SEQ ID NO: 9 and SEQ ID NO: 10, SEQ ID NO: 15 and SEQ ID NO: 16) was amplified and subjected to capillary electrophoresis. The primer set can be amplified using one or more pairs of combinations to distinguish the blind test sample from the DNA barcode characteristics of the test example;

In the third step of unblinding, the results are shown in Table 3. All 16 samples with high and low total polyphenol content were distinguished by the DNA barcode characteristics of the total polyphenol content, and the unblinding results were all correct. This shows that the DNA barcode of the total polyphenol content is suitable for the screening of the traits of the total polyphenol content.

Table 3 Unblinding identification results of DNA barcode features of total polyphenol content

Each embodiment in this specification is described in a progressive manner, each embodiment focuses on the difference from other embodiments, and the same and similar parts of each embodiment can be referred to each other.

The above description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the present invention will not be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

A DNA barcode for screening indicators of the total polyphenol content of Pleurotus pubescens, characterized in that the nucleotide sequence of the DNA barcode includes:

Such as SEQ ID NO: 3,

and/or SEQ ID NO: 4,

and/or the combination of SEQ ID NO: 3 and SEQ ID NO: 4,

and SEQ ID NO: 7,

and/or SEQ ID NO: 8,

and/or a combination of SEQ ID NO: 7 and SEQ ID NO: 8,

and/or a combination of SEQ ID NO: 11 and SEQ ID NO: 12 and SEQ ID NO: 13,

and/or a combination of SEQ ID NO: 12 and SEQ ID NO: 13 and SEQ ID NO: 14,

and/or SEQ ID NO: 13 and SEQ ID NO: 14,

and/or SEQ ID NO: 17,

and/or SEQ ID NO: 18,

And/or one or more of the combination of SEQ ID NO:17 and SEQ ID NO:18.
A kind of primer group that amplifies the DNA barcode that screens the total polyphenol content index of yellow-green mushroom as claimed in claim 1, it is characterized in that, the nucleotide sequence of described primer group comprises:

Such as SEQ ID NO: 1 and SEQ ID NO: 2,

and/or SEQ ID NO: 5 and SEQ ID NO: 6,

and/or SEQ ID NO: 9 and SEQ ID NO: 10,

And/or one or more of SEQ ID NO:15 and SEQ ID NO:16.
The primer set according to claim 2, wherein the nucleotide sequence of the primer set comprises:

Such as SEQ ID NO: 1 and SEQ ID NO: 2,

and SEQ ID NO: 5 and SEQ ID NO: 6,

and SEQ ID NO: 9 and SEQ ID NO: 10,

and SEQ ID NO: 15 and SEQ ID NO: 16.
A method for screening yellow-green mushrooms with the index of total polyphenol content, characterized in that it comprises the following steps:

S1, extracting the genomic DNA of the sample to be tested;

S2. Using S1 genomic DNA as a template, select one or more sets of primers according to claim 2 to carry out fluorescent PCR amplification reaction respectively to obtain amplification products;

The amplified products described in S3 and S2 are detected by capillary fluorescence electrophoresis, and determined by the number of fragments of the amplified product, the number of SSR sites, the SSR repeat elements and the number of repeats thereof.
According to the method for screening yellow-green mushrooms with total polyphenol content index according to claim 4, it is characterized in that, the judgment standard of described step S3 is:

The primer sets of SEQ ID NO: 1 and SEQ ID NO: 2 amplified to obtain a 229bp fragment containing 5 AAG repeat elements and a 232bp fragment containing 6 AAG repeat elements;

And/or SEQ ID NO: 5 and SEQ ID NO: 6 contain a primer set to amplify a 218bp fragment containing 7 TCC repeat elements and a 221bp fragment containing 8 TCC repeat elements;

And/or SEQ ID NO: 9 and SEQ ID NO: 10 contain primer sets to amplify to obtain a 233bp fragment containing 8 AT repeat elements, a 235bp fragment containing 9 AT repeat elements and a 237bp fragment containing 10 AT repeat elements;

And/or when SEQ ID NO: 15 and SEQ ID NO: 16 contain a primer set to amplify a 212bp fragment containing 5 GCT repeating elements and a 215bp fragment containing 6 GCT repeating elements, it is determined that the yellow-green Pleurotus edodes is the total Yellow-green shiitake mushroom with high polyphenol content.
According to claim 4, the method for screening yellow-green Pleurotus pubescens with total polyphenol content index, is characterized in that, the reaction system of fluorescent PCR amplification reaction described in step S2 is:

2×Taq PCR Master Mix 5 μL, Genomic DNA 1 μL, Upstream Primer 0.1 μL, Downstream Primer 0.4 μL, Fluorescent M13 Primer 0.4 μL, Dilute to 10 μL with sterile deionized water.
The method for screening Pleurotus pilosula according to the index of total polyphenol content according to claim 6, wherein the concentrations of the upstream primers, downstream primers and fluorescent M13 primers are all 10uM.
According to claim 4, the method for screening yellow-green Pleurotus pubescens with total polyphenol content index, is characterized in that, the fluorescent PCR amplification reaction procedure described in step S2 is:

Pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 30s, drop PCR annealing at 62 to 55°C for 30s, extension at 72°C for 30s, a total of 10 cycles; denaturation at 95°C for 30s, annealing at 52°C for 30s, extension at 72°C for 30s, a total of 25 cycles; The final extension was 20min at 72°C; after incubation at 4°C for 6h, it was used for fluorescence capillary electrophoresis detection.
The application of the DNA barcode described in claim 1 and/or the primer set described in claim 2 in the preparation of products for screening Pleurotus pubescens with the total polyphenol content index.
A product for screening high-quality yellow-green mushrooms based on the total polyphenol content index, characterized in that it contains one or more sets of primers according to claim 2, and meets the standards: SEQ ID NO: 1 and SEQ ID NO : 2 primer sets amplified to obtain a 229bp fragment containing 5 AAG repeat elements and a 232bp fragment containing 6 AAG repeat elements;

And/or SEQ ID NO: 5 and SEQ ID NO: 6 contain a primer set to amplify a 218bp fragment containing 7 TCC repeat elements and a 221bp fragment containing 8 TCC repeat elements;

And/or SEQ ID NO: 9 and SEQ ID NO: 10 contain primer sets to amplify to obtain a 233bp fragment containing 8 AT repeat elements, a 235bp fragment containing 9 AT repeat elements and a 237bp fragment containing 10 AT repeat elements;

And/or SEQ ID NO: 15 and SEQ ID NO: 16 contain primer sets to amplify to obtain a 212bp fragment containing 5 GCT repeat elements and a 215bp fragment containing 6 GCT repeat elements.