CN112980995B - Identification method of microsatellite DNA marker fingerprint of golden needle mushroom 1754 strain and construction method and application thereof - Google Patents
Identification method of microsatellite DNA marker fingerprint of golden needle mushroom 1754 strain and construction method and application thereof Download PDFInfo
- Publication number
- CN112980995B CN112980995B CN202110385283.6A CN202110385283A CN112980995B CN 112980995 B CN112980995 B CN 112980995B CN 202110385283 A CN202110385283 A CN 202110385283A CN 112980995 B CN112980995 B CN 112980995B
- Authority
- CN
- China
- Prior art keywords
- strain
- golden
- primer
- needle mushroom
- size
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an identification method of a microsatellite DNA marker fingerprint of a golden 1754 strain of needle mushroom as well as a construction method and application thereof, wherein the fingerprint consists of 6 pairs of microsatellite DNA markers. The construction method comprises the following steps: (1) hypha culture; (2) extracting genome DNA; (3) detecting microsatellite DNA molecular markers; and (4) detecting by capillary electrophoresis. The application comprises the following steps: performing microsatellite DNA marker amplification on the flammulina velutipes strains, comparing the obtained banding pattern with the fingerprint spectrum, and obtaining the golden 1754 flammulina velutipes strains when the banding pattern is consistent with the fingerprint spectrum. Compared with conventional morphological detection, antagonistic test and fruiting test, the method has the advantages of short detection time, high accuracy and good repeatability, and has the specificity of the golden 1754 strain of the golden needle mushroom in the collected 105 main culture strains for golden needle mushroom cultivation at home and abroad.
Description
Technical Field
The invention belongs to the technical field of needle mushroom strain detection, and particularly relates to an identification method of a microsatellite DNA marker fingerprint of a needle mushroom golden 1754 strain, and a construction method and application thereof.
Background
Flammulina velutipes (Flammulina filiformis) is a commonly cultivated edible fungus, and is generally classified into white and yellow varieties. The cultivation history is long, the total production amount is promoted year by year, and the strain is the fastest-developing and largest-scale strain in industrialized edible fungus enterprises in China at present. The daily yield of the factory-like golden mushroom in China accounts for 47.12 percent of the total factory-like yield of edible mushrooms in China. The needle mushroom is rich in nutrition, delicious in taste and high in medicinal value, is rich in various nutritional ingredients such as proteins, minerals and vitamins, has various medicinal health-care effects of resisting tumors, enhancing immunity regulation, resisting viruses, reducing blood fat, resisting fatigue, protecting liver and the like, and is popular with consumers.
The contribution rate of the high-quality strains in the yield per unit and the quality of the flammulina velutipes is significant. Compared with the current dominant industrialized strains, china has abundant wild and natural flammulina velutipes cultivation resources, the high-quality resources are efficiently utilized, the genetic basis of the strains is expanded, and the method is favorable for breeding the domestic high-yield, high-quality and characteristic flammulina velutipes strains. In order to establish a new edible fungus species registration system to really protect the species property rights of China, a mature species identification technology must be established at first to lay a foundation for new species registration. The requirements of industrial cultivation modes and strain degeneration phenomena on the quality of needle mushroom cultivation strains are higher and higher, and a simple, convenient, rapid and accurate strain identification technology needs to be developed to ensure that each batch of strains is high-quality and accurate.
Aiming at the current development situation of the flammulina velutipes industry, the development of an accurate and effective flammulina velutipes strain identification system by utilizing the modern molecular biology technology is an extremely important work.
Disclosure of Invention
The invention aims to solve the technical problem of providing a microsatellite DNA marker fingerprint of a flammulina velutipes 'gold 1754' strain and a construction method and application thereof, wherein the fingerprint has the advantages of short detection time, high accuracy and good repeatability compared with conventional morphological detection, antagonistic test and fruiting test.
Flammulina velutipes (Flammulina filiformis) gold 1754 was deposited at Guangdong province microorganism culture Collection center on 8.2.2021, and was deposited at Building 5, miao 100, miao, guangdong province, institute for microorganisms (Building 59, no.100Central Xiaoan Lie road, guangzhou, china) and deposited as GDMCC No. 61520.
The invention relates to a micro-satellite DNA marker fingerprint of golden mushroom 'gold 1754' strain, which consists of 6 pairs of micro-satellite DNA markers, is an SSR primer developed based on simple repetitive sequence fragments of golden mushroom genome, has good amplification band type and high repeatability, and has detailed marking information as shown in Table 1:
TABLE 1 microsatellite DNA marker details List
The invention relates to a method for constructing a microsatellite DNA marker fingerprint of a golden needle mushroom 'golden 1754' strain, which comprises the following steps:
(1) Hypha culture: inoculating needle mushroom strain to potato glucose agar solid culture medium (PDA), culturing at 25 deg.C for 7d, and collecting mycelium;
(2) Extraction of genomic DNA: extracting the genome DNA of the hyphae by using a TaqHotStart amplification kit of TAKARA, detecting the concentration and purity of the total genome DNA by an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be consistent;
(3) Detecting the microsatellite DNA molecular marker: carrying out PCR amplification of gene microsatellite DNA markers on the extracted DNA;
(4) And (3) electrophoresis detection: mixing the product obtained by PCR amplification with formamide sample adding buffer solution, denaturing, and detecting on a computer;
(5) GeneMapper data analysis.
The specific process for extracting the genome DNA of the hyphae by the kit method in the step (2) comprises the following steps:
(1) Adding a hypha sample into liquid nitrogen, and fully grinding;
(2) Adding 360 mu L of Buffer STE and 40 mu L of Buffer SDS into the ground powder rapidly, quickly whirling and uniformly mixing, placing the centrifugal tube in a water bath at 65 ℃ for 15min, and reversing the centrifugal tube in the water bath process to mix the sample for a plurality of times;
(3) Adding 5 μ L RNase Solution into the lysate, mixing by vortex, and standing at room temperature for 15-30min;
(4) Adding 140 mu L of Buffer PS, vortexing and shaking for 30s, and standing on ice for 10min;
(5) 13000g was centrifuged for 5min at room temperature, and 400. Mu.L of the supernatant was carefully transferred to a new centrifuge tube;
(6) Add 600. Mu.L Buffer PBD (diluted with absolute ethanol) to the sample, vortex and mix for 30s;
(7) Loading the DNA binding column in a collecting tube, transferring half of the mixed solution to the column, and centrifuging at 8000g for 1min;
(8) Pouring off the filtrate, putting the column back into the collecting pipe, transferring the residual mixed solution into the column, and centrifuging for 1min at 8000 g;
(9) Pouring the filtrate and putting the column back into the collecting pipe, adding 600 μ L Buffer GW2 (diluted with absolute ethyl alcohol) into the column, and centrifuging at 8000g for 1min;
(10) Repeating the step 9;
(11) Pouring off the filtrate, putting the column back into the collecting pipe, centrifuging for 2min at 10000g to remove the residual ethanol in the column;
(12) Transferring the column to a new 1.5ml centrifuge tube, adding 30 μ L of Buffer AE preheated to 65 deg.C to the center of the membrane of the column, standing at room temperature for 2min, and centrifuging at 10000g for 1min;
(13) mu.L of DNA was subjected to 1.2% agarose gel electrophoresis, 2. Mu.L of DNA was subjected to NanoDrop spectrophotometry, and the remaining DNA was stored at-20 ℃.
The PCR amplification system in the step (3) is as follows: total volume 10 μ L, including: 10 XPCR buffer1 uL, 2.5mmol/L dNTP0.8 uL, 5U/uL HSTaq DNA enzyme 0.1 uL, 5 umol/L microsatellite DNA mark forward primer and reverse primer total volume 0.6 uL respectively, template DNA extracted with concentration of 20 ng-30 ng/uL 1 uL, ddH 2 O 5.9μL;
And (3) PCR reaction conditions: 5min at 95 ℃; 30second at 95 ℃, 30second at 59 ℃, 30second at 72 ℃,35 cycles; 30min at 60 ℃.
The sample adding buffer solution in the step (4) is 9 mu L of a molecular weight internal standard and formamide mixed solution (0.5; the amount of the PCR amplification product added was 1. Mu.L.
The specific process of denaturation in the step (4) is to denature at 95 ℃ for 3min, and then to cool in an ice-water mixture for 3min.
The electrophoresis in the step (4) has the following technological parameters: the modified polyacrylamide gel is commercial POP7 gel, the electrophoresis buffer solution is 3730buffer EDTA, the injection voltage is 2000V, the operation voltage is 15000V, the sample injection time is 10s, the temperature is 60 ℃, the capillary length is 50cm, the power is 200W, the electrophoresis is performed for 20min, and the current and the power are dynamic.
The data analysis in the step (5) specifically comprises the following steps: and (3) importing the detected original data file into analysis software genemapper ID3.2, and performing group structure analysis, clustering and heterozygosity analysis and core germplasm resource calculation analysis by using POPGENE, NTSYS and other software. Allele factors (Na, ne), nei's genetic diversity index (He), shannon's diversity information index (I) and gene observation heterozygosity (Ho) were analyzed.
TABLE 2 summary of allelic fragment information from SSR primer amplification
The invention discloses an application of a microsatellite DNA marker fingerprint of a golden mushroom 'gold 1754' strain, which is characterized in that 6 pairs of SSR primers developed by simple repetitive sequence segments of golden mushroom genomes are utilized, a large number of SSR primers are screened, the number of allelic segments amplified by the 6 pairs of SSR primers in each golden mushroom culture is determined and numbered (table 2) by performing banding amplification on the collected SSR primers of 105 main golden mushroom cultures, and the 'gold 1754' strain can be effectively identified in the collected 105 main needle mushroom cultures through the number combination of different SSR allelic sites. The relative molecular weight of the allelic locus amplified by each SSR primer can be determined by analyzing capillary electrophoresis combined with software, the strain with the specific SSR allelic fragment combination of 'gold 1754' strain is the golden mushroom 'gold 1754' strain, and the serial number combination of the strain is as follows: (12+13)/(6+9)/(6+10)/3/(7+9)/2.
The invention has the beneficial effects that: compared with conventional morphological detection, antagonism test and fruiting test, the method has the advantages of short detection time, high accuracy and good repeatability. The operation time required for detection is within 24h (including genome DNA extraction, PCR amplification, electrophoresis analysis and data analysis), while the time required for conventional antagonistic tests is at least two weeks, and the time required for fruiting tests is at least 3 months; the method has specificity of 'gold 1754' strains in 105 collected main culture strains of the commercially available flammulina velutipes (including Fv-DY, fv-FY, fv-SB, fv-CYS, fv-YH, fv-KL, fv-MG, fv-MH, fv-MI, fv-MJ, fv-SY, fv-FM, fv-WC, fv-GF, fv-BY, fv-HL, fv-RYJ, fv-XH, fv-HTC, fv-GR and the like), and has good application prospect.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required to be used in the description of the embodiments are briefly introduced below, and it is obvious that the drawings in the description below are only some embodiments of the present invention, and it is obvious for those skilled in the art that other drawings can be obtained according to the drawings without inventive labor. Wherein:
FIG. 1 is a peak diagram of the relative molecular weights of allelic loci obtained by sequentially detecting primers FfSSR1 in a selected needle mushroom cultivation material 'gold 1754' and several main cultivation commercial varieties respectively;
FIG. 2 is a peak diagram of the relative molecular weights of the allelic sites obtained by sequentially detecting the primers FfSSR2 in the selected needle mushroom cultivation material 'gold 1754' and several main cultivation commercial varieties respectively;
FIG. 3 is a peak diagram of the relative molecular weights of the allelic sites obtained by sequentially detecting the primers FfSSR13 in the selected needle mushroom cultivation material 'gold 1754' and several main cultivation commercial varieties respectively;
FIG. 4 is a peak diagram of the relative molecular weights of the allelic sites obtained by sequentially detecting the primers FfSSR15 in the selected needle mushroom cultivation material 'gold 1754' and several main cultivation commercial varieties respectively;
FIG. 5 is a peak diagram of the relative molecular weights of the allelic sites obtained by sequentially detecting the primer FfSSR17 in the selected needle mushroom cultivation material "gold 1754" and several main cultivation commercial varieties respectively;
FIG. 6 is a peak diagram of the relative molecular weight of the allelic site obtained by sequentially detecting the primer FfSSR18 in the selected needle mushroom cultivation material "gold 1754" and several main cultivation commercial varieties respectively.
Detailed Description
In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with examples are described in detail below.
In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, but the present invention may be practiced in other ways than those specifically described and will be readily apparent to those of ordinary skill in the art without departing from the spirit of the present invention, and therefore the present invention is not limited to the specific embodiments disclosed below.
Furthermore, the references herein to "one embodiment" or "an embodiment" refer to a particular feature, structure, or characteristic that may be included in at least one implementation of the present invention. The appearances of the phrase "in one embodiment" in various places in the specification are not necessarily all referring to the same embodiment, nor are separate or alternative embodiments mutually exclusive of other embodiments.
Example 1:
(1) Hypha culture: inoculating needle mushroom strain to potato glucose agar solid culture medium (PDA), culturing at 25 deg.C for 7d, and collecting mycelium;
(2) Extraction of genomic DNA: extracting the genome DNA of the hyphae by using a TaqHotStart amplification kit of TAKARA, detecting the concentration and purity of the total genome DNA by an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be consistent;
the CTAB method for extracting genome DNA of hyphae comprises the following steps:
(1) adding liquid nitrogen into the hypha sample, and fully grinding;
(2) adding 360 mu L of Buffer STE and 40 mu L of Buffer SDS into the ground powder rapidly, quickly whirling and uniformly mixing, placing the centrifugal tube in a water bath at 65 ℃ for 15min, and reversing the centrifugal tube in the water bath process to mix the sample for a plurality of times;
(3) adding 5 μ L RNase Solution into the lysate, mixing by vortex, and standing at room temperature for 15-30min;
(4) adding 140 μ L Buffer PS, vortexing and shaking for 30s, and standing on ice for 10min;
(5) 13000g was centrifuged for 5min at room temperature, 400. Mu.L of the supernatant was carefully transferred to a new centrifuge tube;
(6) add 600. Mu.L Buffer PBD (diluted with absolute ethanol) to the sample, vortex for 30s;
(7) loading the DNA binding column in a collecting tube, transferring half of the mixed solution to the column, and centrifuging at 8000g for 1min;
(8) pouring off the filtrate, loading the column back into the collecting pipe, transferring the rest mixed solution into the column, and centrifuging at 8000g for 1min;
(9) pouring the filtrate and putting the column back into the collecting pipe, adding 600 μ L Buffer GW2 (diluted with absolute ethyl alcohol) into the column, and centrifuging at 8000g for 1min;
r repeats step 9;
pouring off the filtrate, putting the column back into the collecting pipe, centrifuging for 2min at 10000g to remove the residual ethanol in the column;
transferring the column to a new 1.5ml centrifuge tube, adding 30 μ L of Buffer AE preheated to 65 deg.C to the center of the membrane of the column, standing at room temperature for 2min, and centrifuging at 10000g for 1min;
mu.L of DNA was used for 1.2% agarose gel electrophoresis detection, and 2. Mu.L of DNA was used for NanoDrop fractionationThe concentration was measured photometrically and the remaining DNA was stored at-20 ℃.
(3) Detecting the microsatellite DNA molecular marker: carrying out PCR amplification of gene microsatellite DNA markers on the extracted DNA;
the PCR amplification system is as follows: total volume 10 μ Ι _, comprising: 10 XPCR buffer1 uL, 2.5mmol/L dNTP0.8 uL, 5U/uL HSTaq DNA enzyme 0.1 uL, 5 umol/L microsatellite DNA mark forward primer and reverse primer total volume each 0.6 uL, template DNA 1 uL, ddH extracted with the concentration of 20 ng-30 ng/uL 2 O 5.9μL;
And (3) PCR reaction conditions: 5min at 95 ℃; 30second at 95 ℃, 30second at 59 ℃, 30second at 72 ℃,35 cycles; 30min at 60 ℃.
(4) And (3) electrophoresis detection: mixing the product obtained by PCR amplification with 1 μ L sample buffer solution, denaturing at 95 deg.C for 3min, and cooling in ice water mixture for 3min; applying 3 microlitres of sample to a modified polyacrylamide gel for electrophoresis, wherein the modified polyacrylamide gel is commercial POP7 gel, the electrophoresis buffer solution is 3730buffer EDTA, the injection voltage is 2000V, the operation voltage is 15000V, the sample injection time is 10s, the temperature is 60 ℃, the length of a capillary is 50cm, the power is 200W, the electrophoresis is 20min, and the current and the power are dynamic,
(5) Analysis of results
Adopting 6 pairs of SSR primers to carry out PCR amplification and capillary electrophoresis on needle mushroom strains, and finding a matched number combination by analyzing allelic gene factors (Na, ne), nei's genetic diversity index (He), shannon's diversity information index (I) and gene observation heterozygosity (Ho) and combining relative molecular weight peak maps of allelic sites: ffSSR1, ffSSR2, ffSSR13, ffSSR15, ffSSR17, ffSSR18, the corresponding banding pattern is: (12 + 13)/(6 + 9)/(6 + 10)/3/(7 + 9)/2), and the strain is determined to be golden 1754 flammulina velutipes strain. To ensure the accuracy of the identification, three replicates were recommended.
BY taking several main commercial varieties as examples, peak maps of the relative molecular weights of the allelic sites obtained BY sequential detection of 6 pairs of primers are given, as shown in FIGS. 1-6 (sequentially (1) gold 1754 (2); fv-SY (3); fv-FM (4); fv-WC (5); fv-GF (6); fv-BY (7); fv-HL (8); RYJ (9); fv-XH f-HTC)Fv-GR)。
The fingerprint spectrum of the invention refers to the combination of the primer and the band type thereof.
It should be noted that the above-mentioned embodiments are only for illustrating the technical solutions of the present invention and not for limiting, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, which should be covered by the claims of the present invention.
Sequence listing
<110> Shanghai city academy of agricultural sciences
<120> identification method of microsatellite DNA marker fingerprint of gold 1754 strain of needle mushroom, construction method and application thereof
<130> 2021040904-zf-wjn
<141> 2021-04-09
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tctgaatgtc ccggagcgt 19
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gatacgagca gcactcgcg 19
<210> 3
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tcttcttggg tggaagacg 19
<210> 4
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ctgagctagg ttcctctac 19
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
atttcttcgg atgctttgga 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ttctctttgc acacgtcgaa 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
agtcgtcgtt caaggtgtcg 20
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
cggttgtttg ttccactttt 20
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
cccagatgat gctgcaatgc 20
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
cgctttgtgg cactatctgc 20
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
aaaaattgag agggtgcatg 20
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
ttggacgaat cctcgttgcg 20
Claims (2)
1. A method for identifying a microsatellite DNA marker fingerprint of a golden 1754 strain of needle mushroom is characterized by comprising the following steps: the fingerprint consists of 6 pairs of microsatellite DNA markers, and the specific sequences of 6 pairs of corresponding primers are as follows:
FfSSR1 forward primer: TCTGAATGTCCCCGGAGCGT;
reverse primer: gatacgagcaggcactcgcg;
FfSSR2 forward primer: TCTTCTTGGGTGGAAGACG;
reverse primer: CTGAGCTAGGTTCCTCTAC;
FfSSR13 forward primer: ATTTCTTCGGATGCTTTGGA;
reverse primer: TTCTCTTTGCACACGTCGAAA;
FfSSR15 forward primer: AGTCGTCGTTCAAGGTGTGTCG;
reverse primer: CGGTTGTTTGTTCCACTTTT;
FfSSR17 forward primer: cccagatgattgctgcaatgc;
reverse primer: CGCTTTGTGGCACTATTCTGC;
FfSSR18 forward primer: AAAAATTGAGGGGTGCATG;
reverse primer: TTGGACGAATCCTCGTTGCG;
the corresponding combination of the belt type numbers is as follows: (12 + 13)/(6 + 9)/(6 + 10)/3/(7 + 9)/2;
the belt type number corresponding to the primer FfSSR1 is 12+13, the size of the strip of the allele segment corresponding to the number 12 is 305 to 305.99bp, and the size of the strip of the allele segment corresponding to the number 13 is 313 to 313.99bp; the band type number corresponding to the primer FfSSR2 is 6+9, wherein the size of the strip of the allele segment corresponding to the number 6 is 384 to 384.99bp, and the size of the strip of the allele segment corresponding to the number 9 is 394 to 394.99bp; the band type number corresponding to the primer FfSSR13 is 6+10, wherein the size of the strip of the allele segment corresponding to the number 6 is 211 to 211.99bp, and the size of the strip of the allele segment corresponding to the number 10 is 229 to 229.99bp; the corresponding band type number of the primer FfSSR15 is 3, and the band size of the corresponding allele segment is 238 to 238.99bp; the band type number corresponding to the primer FfSSR17 is 7+9, wherein the band size of the allele segment corresponding to the number 7 is 295 to 295.99bp, and the band size of the allele segment corresponding to the number 9 is 298 to 298.99bp; the corresponding band type number of the primer FfSSR18 is 2, and the corresponding allelic gene fragment has the band size of 213 to 213.99bp;
the preservation number of the golden 1754 strain of the flammulina velutipes is GDMCC No. 61520.
2. The use of a microsatellite DNA marker fingerprint of a golden 1754 strain of Flammulina velutipes as claimed in claim 1, wherein: the microsatellite DNA marker fingerprint of the golden needle mushroom 1754 strain is used for identifying the specific allelic variation of the golden needle mushroom 1754 strain and/or identifying the specificity of the golden needle mushroom 1754 strain.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110385283.6A CN112980995B (en) | 2021-04-09 | 2021-04-09 | Identification method of microsatellite DNA marker fingerprint of golden needle mushroom 1754 strain and construction method and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110385283.6A CN112980995B (en) | 2021-04-09 | 2021-04-09 | Identification method of microsatellite DNA marker fingerprint of golden needle mushroom 1754 strain and construction method and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN112980995A CN112980995A (en) | 2021-06-18 |
CN112980995B true CN112980995B (en) | 2023-02-28 |
Family
ID=76339637
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202110385283.6A Active CN112980995B (en) | 2021-04-09 | 2021-04-09 | Identification method of microsatellite DNA marker fingerprint of golden needle mushroom 1754 strain and construction method and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN112980995B (en) |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104131085A (en) * | 2014-07-04 | 2014-11-05 | 上海市农业科学院 | SSR marker fingerprint spectrum of golden mushroom Sanming BX3 bacterial classification and application thereof |
CN104131086A (en) * | 2014-07-04 | 2014-11-05 | 上海市农业科学院 | SSR labeled fingerprint of flammulina velutipes F3 strain and applications thereof |
CN104152547A (en) * | 2014-07-04 | 2014-11-19 | 上海市农业科学院 | SSR marker fingerprint spectrum of needle mushroom Qinghe strain and application thereof |
-
2021
- 2021-04-09 CN CN202110385283.6A patent/CN112980995B/en active Active
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104131085A (en) * | 2014-07-04 | 2014-11-05 | 上海市农业科学院 | SSR marker fingerprint spectrum of golden mushroom Sanming BX3 bacterial classification and application thereof |
CN104131086A (en) * | 2014-07-04 | 2014-11-05 | 上海市农业科学院 | SSR labeled fingerprint of flammulina velutipes F3 strain and applications thereof |
CN104152547A (en) * | 2014-07-04 | 2014-11-19 | 上海市农业科学院 | SSR marker fingerprint spectrum of needle mushroom Qinghe strain and application thereof |
Non-Patent Citations (1)
Title |
---|
Development and characterization of simple sequence repeat (SSR) markers for the mushroom Flammulina velutipes;Ruiying Zhang等;《Journal of Bioscience and Bioengineering》;20101231;第110卷(第3期);第273页右栏第1-3段、第274页、第275页左栏第1-2段、表1-2、图1 * |
Also Published As
Publication number | Publication date |
---|---|
CN112980995A (en) | 2021-06-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN113186327B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FC89 strain, construction method and application thereof | |
CN112941224A (en) | Identification method of SSR (simple sequence repeat) marker fingerprint of golden 6046 strain of flammulina velutipes, construction method and application thereof | |
CN112795690A (en) | Identification method of SSR (simple sequence repeat) marker fingerprint of flammulina velutipes J3931 strain as well as construction method and application of identification method | |
CN112980995B (en) | Identification method of microsatellite DNA marker fingerprint of golden needle mushroom 1754 strain and construction method and application thereof | |
CN112725522A (en) | Golden needle mushroom 1767 strain and identification method and construction method and application of SSR marker fingerprint spectrum thereof | |
CN112941223A (en) | Golden needle mushroom 6168 strain and identification method and construction method and application of SSR marker fingerprint spectrum thereof | |
CN112813193B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes X995 strain and construction method and application thereof | |
CN112980994B (en) | Identification method of SSR marker fingerprint of needle mushroom strain and construction method and application thereof | |
CN113151548B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FV1923 strain and construction method and application thereof | |
CN113186328B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes xujin 18 strain and construction method and application thereof | |
CN112961934B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes SCY12 strain and construction method and application thereof | |
CN112980992B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FW178 strain, construction method and application thereof | |
CN112961933B (en) | Identification method of microsatellite DNA marker fingerprint spectrum of flammulina velutipes FL159 strain and construction method and application thereof | |
CN113151547B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FL1980 strain, construction method and application thereof | |
CN113005220B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes J1011 strain, construction method and application thereof | |
CN112760406B (en) | SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM22 strain as well as construction method and application thereof | |
CN112795680B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-N-11 strain and construction method and application thereof | |
CN112795687B (en) | SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM21 strain as well as construction method and application thereof | |
CN112795681B (en) | SSR (simple sequence repeat) labeled fingerprint spectrum of hypsizigus marmoreus HM18 strain as well as construction method and application of SSR labeled fingerprint spectrum | |
CN112708694B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-B-3 strain and construction method and application thereof | |
CN112708696B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-F-4 strain and construction method and application thereof | |
CN112877458B (en) | SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM36 strain as well as construction method and application thereof | |
CN112877457B (en) | SSR (simple sequence repeat) labeled fingerprint spectrum of hypsizigus marmoreus HM6 strain as well as construction method and application of SSR labeled fingerprint spectrum | |
CN112746128B (en) | SSR (simple sequence repeat) marker fingerprint of hypsizigus marmoreus HM3 strain, and construction method and application thereof | |
CN112813183B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-B-6 strain and construction method and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |