CN113186327B - Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FC89 strain, construction method and application thereof - Google Patents
Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FC89 strain, construction method and application thereof Download PDFInfo
- Publication number
- CN113186327B CN113186327B CN202110379739.8A CN202110379739A CN113186327B CN 113186327 B CN113186327 B CN 113186327B CN 202110379739 A CN202110379739 A CN 202110379739A CN 113186327 B CN113186327 B CN 113186327B
- Authority
- CN
- China
- Prior art keywords
- flammulina velutipes
- strain
- primer
- microsatellite dna
- size
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an identification method of a microsatellite DNA marker fingerprint of flammulina velutipes FC89 strain, a construction method and application thereof, wherein the fingerprint consists of 6 pairs of microsatellite DNA markers. The construction method comprises the following steps: (1) hypha culture; (2) extracting genome DNA; (3) detection of microsatellite DNA markers; and (4) detecting by capillary electrophoresis. The application comprises the following steps: performing microsatellite DNA marker amplification on the flammulina velutipes strains, comparing the obtained banding pattern with the fingerprint spectrum, and obtaining the flammulina velutipes FC89 strain if the banding pattern is consistent with the fingerprint spectrum. Compared with conventional morphological detection, antagonism test and fruiting test, the method has the advantages of short detection time, high accuracy and good repeatability, and has the specificity of flammulina velutipes FC89 strains in the collected 105 flammulina velutipes cultivation main culture strains at home and abroad.
Description
Technical Field
The invention belongs to the technical field of detection of flammulina velutipes strains, and particularly relates to an identification method of microsatellite DNA marker fingerprint of flammulina velutipes FC89 strains, and a construction method and application thereof.
Background
Flammulina velutipes (Flammulina filiformis) is a commonly cultivated edible fungus, and is generally classified into white and yellow varieties. The cultivation history is long, the total production amount is promoted year by year, and the strain is the fastest-developing and largest-scale strain in industrialized edible fungus enterprises in China at present. The daily yield of the industrial cultivation of the flammulina velutipes in China approximately accounts for 47.12 percent of the total industrial yield of the edible fungi in China. The needle mushroom is rich in nutrition, delicious in taste and high in medicinal value, is rich in various nutritional ingredients such as proteins, minerals and vitamins, has various medicinal health-care effects of resisting tumors, enhancing immunity regulation, resisting viruses, reducing blood fat, resisting fatigue, protecting liver and the like, and is popular with consumers.
The contribution rate of the high-quality strains in the yield per unit and the quality of the flammulina velutipes is significant. The industrialized culture strain of flammulina velutipes in China is mainly white strain which is bred abroad and has high first tide yield, short growth period and storage tolerance. The breeding work of the flammulina velutipes is relatively lagged, and the reason that the market share of the domestic strains is low at present is also caused. But compared with the current leading industrialized strains, china has rich wild and natural flammulina velutipes cultivation resources, the high-quality resources are efficiently utilized, the genetic basis of the strains is expanded, and the breeding of the domestic high-yield, high-quality and characteristic flammulina velutipes strains is facilitated.
In order to establish a new species registration system of edible fungi to really protect the property rights of species in China, a mature species identification technology must be established at first to lay a foundation for registering the new species. The phenomenon of product homogenization caused by low diversity of needle mushroom culture strains not only brings economic loss to production enterprises, but also greatly influences the rapid development of the needle mushroom industry in China; on the other hand, the requirements of industrial cultivation modes and strain degeneration phenomena on the quality of needle mushroom cultivation strains are higher and higher, and a simpler, faster and more accurate strain identification technology needs to be developed so as to ensure that each batch of strains used is a high-quality and accurate strain.
Aiming at the current development situation of the flammulina velutipes industry, the development of an accurate and effective flammulina velutipes strain identification system by utilizing the modern molecular biology technology is an extremely important work.
Disclosure of Invention
The invention aims to solve the technical problem of providing a microsatellite DNA marker fingerprint of flammulina velutipes FC89 strain and a construction method and application thereof, wherein the fingerprint has the advantages of short detection time, high accuracy and good repeatability compared with conventional morphological detection, antagonistic test and fruiting test.
Flammulina velutipes (Flammulina filiformis) FC89 is preserved in Guangdong province microbial strain preservation center at 2021, 2 and 8 days, and is addressed to Guangzhou city, mieli Zhou 100, large institute No. 59, building 5, guangdong province microbial research institute, and the preservation number is GDMCC No:61512.
the invention relates to a micro-satellite DNA marker fingerprint of flammulina velutipes FC89 strain, which consists of 6 pairs of micro-satellite DNA markers, is an SSR primer developed based on simple repetitive sequence segments of flammulina velutipes genome, has good amplification band type and high repeatability, and has detailed marking information shown in Table 1:
TABLE 1 microsatellite DNA marker details List
The invention relates to a method for constructing a microsatellite DNA marker fingerprint of a flammulina velutipes FC89 strain, which comprises the following steps:
(1) Hypha culture: inoculating the needle mushroom strain to a potato dextrose agar solid medium (PDA), culturing at 25 ℃ for 5-10 days, and collecting hypha;
(2) Extraction of genomic DNA: extracting the genome DNA of the hyphae by using a TaqHotStart amplification kit of TAKARA, detecting the concentration and purity of the total genome DNA by an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be consistent;
(3) Detection of microsatellite DNA markers: carrying out PCR amplification of gene microsatellite DNA markers on the extracted DNA;
(4) And (3) electrophoresis detection: mixing the product obtained by PCR amplification with formamide sample adding buffer solution, denaturing, and detecting on a computer;
(5) GeneMapper data analysis.
The specific process for extracting the genome DNA of the hyphae by the kit method in the step (2) comprises the following steps:
(1) Adding a hypha sample into liquid nitrogen, and fully grinding;
(2) Adding 360 mu L of Buffer STE and 40 mu L of Buffer SDS into the ground powder quickly, quickly whirling and uniformly mixing, placing the centrifuge tube in a water bath at 65 ℃ for 15min, and reversing the centrifuge tube in the water bath process to mix the sample for a plurality of times;
(3) Adding 5 mu L of RNase Solution into the lysate, uniformly mixing by vortex, and standing for 15-30min at room temperature;
(4) Adding 140 μ L Buffer PS, vortexing and shaking for 30s, and standing on ice for 10min;
(5) 13000g was centrifuged for 5min at room temperature, and 400. Mu.L of the supernatant was carefully transferred to a new centrifuge tube;
(6) Add 600. Mu.L Buffer PBD (diluted with absolute ethanol) to the sample, vortex and mix for 30s;
(7) Loading the DNA binding column in a collecting tube, transferring half of the mixed solution to the column, and centrifuging at 8000g for 1min;
(8) Pouring off the filtrate, putting the column back into the collecting pipe, transferring the residual mixed solution into the column, and centrifuging for 1min at 8000 g;
(9) Pouring the filtrate and putting the column back into the collecting pipe, adding 600 μ L Buffer GW2 (diluted with absolute ethyl alcohol) into the column, and centrifuging at 8000g for 1min;
(10) Repeating the step 9;
(11) Pouring off the filtrate, putting the column back into the collecting pipe, centrifuging for 2min at 10000g to remove the residual ethanol in the column;
(12) Transferring the column to a new 1.5ml centrifuge tube, adding 30 μ L of Buffer AE preheated to 65 deg.C to the center of the membrane of the column, standing at room temperature for 2min, centrifuging at 10000g for 1min;
(13) mu.L of DNA was subjected to 1.2% agarose gel electrophoresis, 2. Mu.L of DNA was subjected to NanoDrop spectrophotometry, and the remaining DNA was stored at-20 ℃.
The PCR amplification system in the step (3) is as follows: total volume 10 μ L, including: 10 XPCR buffer1 uL, 2.5mmol/L dNTP 0.8 uL, 5U/uL HSTaq DNA enzyme 0.1 uL, 5 umol/L microsatellite DNA mark forward primer and reverse primer total volume 0.6 uL respectively, template DNA extracted with concentration of 20 ng-30 ng/uL 1 uL, ddH 2 O 5.9μL;
And (3) PCR reaction conditions: 5min at 95 ℃; 30second at 95 ℃, 30second at 60 ℃, 30second at 72 ℃,35 cycles; 30min at 60 ℃.
The sample adding buffer solution in the step (4) is 9 mu L of a molecular weight internal standard and formamide mixed solution (0.5; the amount of the PCR amplification product added was 1. Mu.L.
The specific process of denaturation in the step (4) is to denature at 95 ℃ for 3min, and then to cool in an ice-water mixture for 3min.
The electrophoresis in the step (4) has the following technological parameters: the modified polyacrylamide gel is commercial POP7 gel, the electrophoresis buffer solution is 3730buffer EDTA, the injection voltage is 2000V, the operation voltage is 15000V, the sample injection time is 10s, the temperature is 60 ℃, the capillary length is 50cm, the power is 200W, the electrophoresis is performed for 20min, and the current and the power are dynamic.
The data analysis in the step (5) is specifically as follows: and (3) importing the detected original data file into analysis software genemapper ID3.2, and performing group structure analysis, clustering and heterozygosity analysis and core germplasm resource calculation analysis by using POPGENE, NTSYS and other software. Allele factors (Na, ne), nei's genetic diversity index (He), shannon's diversity information index (I) and gene observation heterozygosity (Ho) were analyzed.
TABLE 2 summary of allelic fragment information from SSR primer amplification
The invention discloses an application of a microsatellite DNA marker fingerprint of flammulina velutipes FC89 strains, which is characterized in that 6 pairs of SSR primers developed by simple repetitive sequence segments of flammulina velutipes genomes are utilized, a large number of SSR primers are screened, the number of allelic segments amplified by the 6 pairs of SSR primers in each flammulina velutipes culture is determined and numbered (table 2) by performing banding amplification on 105 collected SSR primers of main flammulina velutipes cultures, and the FC89 strains can be effectively identified in 105 collected main flammulina velutipes cultures through the number combination of different SSR allelic sites. The relative molecular weight of the allelic sites amplified by each SSR primer can be determined by analyzing capillary electrophoresis combined with software, the strain with the specific SSR allelic fragment combination of the strain FC89 is the strain of flammulina velutipes FC89, and the number combination of the strain is as follows: (5+11)/4/(3+5)/2/(2+4)/6.
The invention has the beneficial effects that: compared with conventional morphological detection, antagonism test and fruiting test, the method has the advantages of short detection time, high accuracy and good repeatability. The operation time required for detection is within 24h (including genome DNA extraction, PCR amplification, electrophoresis analysis and data analysis), while the time required for conventional antagonistic tests is at least two weeks, and the time required for fruiting tests is at least 3 months; the method has specificity of 'FC 89' strains in 105 collected main culture strains of commercially available flammulina velutipes (including Fv-DY, fv-FY, fv-SB, fv-CYS, fv-YH, fv-KL, fv-MG, fv-MH, fv-MI, fv-MJ, fv-SY, fv-FM, fv-WC, fv-GF, fv-BY, fv-HL, fv-RYJ, fv-XH, fv-HTC, fv-GR and the like), and has good application prospect.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the description of the embodiments will be briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without inventive exercise. Wherein:
FIG. 1 is a peak diagram of the relative molecular weights of allelic loci obtained by sequentially detecting primers FfSSR2 in selected needle mushroom cultivation material FC89 and several main cultivation commercial varieties respectively;
FIG. 2 is a peak diagram of the relative molecular weights of the allelic sites obtained by sequentially detecting the primers FfSSR4 in the selected flammulina velutipes cultivation material FC89 and several main cultivation commercial varieties respectively;
FIG. 3 is a peak diagram of the relative molecular weights of the allelic sites obtained by sequentially detecting the primers FfSSR6 in the selected flammulina velutipes cultivation material FC89 and several main cultivation commercial varieties respectively;
FIG. 4 is a peak diagram of the relative molecular weights of the allelic sites obtained by sequentially detecting the primers FfSSR7 in the selected flammulina velutipes cultivation material FC89 and several main cultivation commercial varieties respectively;
FIG. 5 is a peak diagram of the relative molecular weights of the allelic sites obtained by sequentially detecting the primers FfSSR12 in the selected flammulina velutipes cultivation material FC89 and several main cultivation commercial varieties respectively;
FIG. 6 is a diagram of the allelic site relative molecular weight peaks obtained by sequential detection of the primer FfSSR13 in the selected flammulina velutipes cultivation material FC89 and several main cultivation commercial varieties respectively.
Detailed Description
In order to make the aforementioned objects, features and advantages of the present invention more comprehensible, embodiments accompanying specific embodiments of the present invention are described in detail below.
In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, however, the present invention may be practiced otherwise than as specifically described herein, and it will be appreciated by those skilled in the art that the present invention may be practiced without departing from the spirit and scope of the present invention and that the present invention is not limited by the specific embodiments disclosed below.
Furthermore, reference herein to "one embodiment" or "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one implementation of the invention. The appearances of the phrase "in one embodiment" in various places in the specification are not necessarily all referring to the same embodiment, nor are separate or alternative embodiments mutually exclusive of other embodiments.
Example 1:
(1) Hypha culture: inoculating needle mushroom strain to potato glucose agar solid culture medium (PDA), culturing at 25 deg.C for 7d, and collecting mycelium;
(2) Extraction of genomic DNA: extracting the genome DNA of the hyphae by using a TaqHotStart amplification kit of TAKARA, detecting the concentration and purity of the total genome DNA by an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be consistent;
the CTAB method for extracting genome DNA of hyphae comprises the following steps:
(1) adding liquid nitrogen into the hypha sample, and fully grinding;
(2) adding 360 mu L of Buffer STE and 40 mu L of Buffer SDS into the ground powder quickly, quickly whirling and uniformly mixing, placing the centrifuge tube in a water bath at 65 ℃ for 15min, and reversing the centrifuge tube in the water bath process to mix the sample for a plurality of times;
(3) adding 5 mu L of RNase Solution into the lysate, uniformly mixing by vortex, and standing for 15-30min at room temperature;
(4) adding 140 mu L of Buffer PS, vortexing and shaking for 30s, and standing on ice for 10min;
(5) 13000g was centrifuged for 5min at room temperature, and 400. Mu.L of the supernatant was carefully transferred to a new centrifuge tube;
(6) add 600. Mu.L Buffer PBD (diluted with absolute ethanol) to the sample, vortex and mix for 30s;
(7) loading the DNA binding column in a collecting tube, transferring half of the mixed solution to the column, and centrifuging at 8000g for 1min;
(8) pouring off the filtrate, loading the column back into the collecting pipe, transferring the rest mixed solution into the column, and centrifuging at 8000g for 1min;
(9) pouring the filtrate and putting the column back into the collecting pipe, adding 600 μ L Buffer GW2 (diluted with absolute ethyl alcohol) into the column, and centrifuging at 8000g for 1min;
r repeats step 9;
pouring off the filtrate, putting the column back into the collecting pipe, centrifuging for 2min at 10000g to remove the residual ethanol in the column;
transferring the column to a new 1.5ml centrifuge tube, adding 30 μ L of Buffer AE preheated to 65 deg.C to the center of the membrane of the column, standing at room temperature for 2min, and centrifuging at 10000g for 1min;
2 μ L of DNA was applied to 1.2% agarDetecting by sugar gel electrophoresis, taking 2 mu L of DNA for measuring the concentration by a NanoDrop spectrophotometer, and storing the residual DNA at-20 ℃.
(3) Detection of microsatellite DNA markers: carrying out PCR amplification of gene microsatellite DNA markers on the extracted DNA;
the PCR amplification system is as follows: total volume 10 μ L, including: 10 XPCR buffer1 uL, 2.5mmol/L dNTP 0.8 uL, 5U/uL HSTaq DNA enzyme 0.1 uL, 5 umol/L microsatellite DNA mark forward primer and reverse primer total volume 0.6 uL respectively, template DNA extracted with concentration of 20 ng-30 ng/uL 1 uL, ddH 2 O 5.9μL;
And (3) PCR reaction conditions: 5min at 95 ℃; 30second at 95 ℃, 30second at 60 ℃, 30second at 72 ℃,35 cycles; 30min at 60 ℃.
(4) And (3) electrophoresis detection: mixing the product obtained by PCR amplification with 1 μ L sample buffer solution, denaturing at 95 deg.C for 3min, and cooling in ice water mixture for 3min; 3 mu L of sample is applied to a modified polyacrylamide gel for electrophoresis, the modified polyacrylamide gel is commercial POP7 gel, the electrophoresis buffer solution is 3730buffer EDTA, the injection voltage is 2000V, the operation voltage is 15000V, the sample injection time is 10s, the temperature is 60 ℃, the length of a capillary is 50cm, the power is 200W, the electrophoresis is 20min, the current and the power are dynamic,
(5) Analysis of results
Performing PCR amplification and capillary electrophoresis on needle mushroom strains by adopting 6 pairs of SSR primers, and finding a matched code combination by analyzing allele factors (Na, ne), nei's genetic diversity index (He), shannon's diversity information index (I) and gene observation heterozygosity (Ho) in combination with a relative molecular weight peak diagram of an allele: ffSSR2, ffSSR4, ffSSR6, ffSSR7, ffSSR12, ffSSR13, the corresponding banding pattern is: the strain (5 + 11)/4/(3 + 5)/2/(2 + 4)/6 can be determined as the strain of Flammulina velutipes (FC 89). To ensure the accuracy of the identification, three replicates were recommended.
BY taking several main commercial varieties as examples, peak maps of the relative molecular weights of the allelic sites obtained BY sequential detection of 6 pairs of primers are shown in FIGS. 1 to 6 (sequentially (1 FC89 (2))Fv-GR)。
The fingerprint spectrum of the invention refers to the combination of the primer and the band type thereof.
It should be noted that the above-mentioned embodiments are only for illustrating the technical solutions of the present invention and not for limiting, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, which should be covered by the claims of the present invention.
Sequence listing
<110> Shanghai city academy of agricultural sciences
<120> identification method of microsatellite DNA marker fingerprint of flammulina velutipes FC89 strain, construction method and application thereof
<130> 2021040801-zf-wjn
<141> 2021-04-08
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tcttcttggg tggaagacg 19
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ctgagctagg ttcctctac 19
<210> 3
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gaaggtgtgt tcgctgttc 19
<210> 4
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cattggagtg ggtaaagag 19
<210> 5
<211> 16
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gtctttcgcg caggtt 16
<210> 6
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tgaggggacg ggtatgaga 19
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
tcttcctgtc accactgttt 20
<210> 8
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
cgtctcgacc atcgttgga 19
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
atgcggcggt ttgtcagaac 20
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
aaccacaacc ttccttcccc 20
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
atttcttcgg atgctttgga 20
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
ttctctttgc acacgtcgaa 20
Claims (2)
1. A method for identifying microsatellite DNA marker fingerprint of flammulina velutipes FC89 strains is characterized by comprising the following steps: the fingerprint consists of 6 pairs of microsatellite DNA markers, and the specific sequences of 6 pairs of corresponding primers are as follows:
FfSSR2 forward primer: TCTTCTTGGGTGGAAGACG;
reverse primer: CTGAGCTAGGTTCCTCTAC;
FfSSR4 forward primer: gaaggtgtgtgttcgctgttc;
reverse primer: CATTGGAGTGGGTAAAGAG;
FfSSR6 forward primer: GTCTTTCGCGCAGGTT;
reverse primer: TGAGGGACGGGTATGAGA;
FfSSR7 forward primer: tcttcctgtcaccaccactgttt;
reverse primer: CGTCTCGACCATCGTTGGA;
FfSSR12 forward primer: ATGCGGCGGTTTGTCAGAAC;
reverse primer: AACCACAACCTTCCTTCCCC;
FfSSR13 forward primer: ATTTCTTCGGATGCTTTGGA;
reverse primer: TTCTCTTTGCACGTTCGAA;
the corresponding combination of the belt type numbers is as follows: (5 + 11)/4/(3 + 5)/2/(2 + 4)/6;
the belt type number corresponding to the primer FfSSR2 is 5+11, the size of the strip of the allele segment corresponding to the number 5 is 383 to 383.99bp, and the size of the strip of the allele segment corresponding to the number 11 is 388 to 388.99bp; the corresponding band type number of the primer FfSSR4 is 4, and the band size of the corresponding allele segment is 316 to 316.99bp; the band type number corresponding to the primer FfSSR6 is 3+5, wherein the size of the strip of the allele segment corresponding to the number 3 is 108 to 108.99bp, and the size of the strip of the allele segment corresponding to the number 5 is 111 to 111.99bp; the corresponding band type number of the primer FfSSR7 is 2, and the band size of the corresponding allele segment is 139 to 139.99bp; the band type number corresponding to the primer FfSSR12 is 2+4, wherein the size of the strip of the allele segment corresponding to the number 2 is 245 to 245.99bp, and the size of the strip of the allele segment corresponding to the number 4 is 248 to 248.99bp; the corresponding band type number of the primer FfSSR13 is 6, and the band size of the corresponding allele segment is 211 to 211.99bp;
the preservation number of the flammulina velutipes FC89 strain is GDMCC No:61512.
2. the use of a microsatellite DNA marker fingerprint of Flammulina velutipes FC89 strain as claimed in claim 1, wherein: the microsatellite DNA marker fingerprint of the flammulina velutipes FC89 strain is used for identifying the specific allelic variation of the flammulina velutipes FC89 strain and/or identifying the specificity of the flammulina velutipes FC89 strain.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110379739.8A CN113186327B (en) | 2021-04-08 | 2021-04-08 | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FC89 strain, construction method and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110379739.8A CN113186327B (en) | 2021-04-08 | 2021-04-08 | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FC89 strain, construction method and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN113186327A CN113186327A (en) | 2021-07-30 |
CN113186327B true CN113186327B (en) | 2023-03-24 |
Family
ID=76975154
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202110379739.8A Active CN113186327B (en) | 2021-04-08 | 2021-04-08 | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FC89 strain, construction method and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN113186327B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114790426B (en) * | 2022-05-19 | 2023-06-06 | 上海市农业科学院 | Application of desmodium Chaetomium strain in production of gamma aminobutyric acid and cultivation method thereof |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104131007B (en) * | 2014-07-04 | 2016-08-24 | 上海市农业科学院 | The SSR marker finger printing of a kind of Flammulina velutiper (Fr.) Sing river Huang strain and application |
CN105316329B (en) * | 2015-11-20 | 2018-09-11 | 中国科学院昆明植物研究所 | Needle mushroom SSR molecular marker and its corresponding primer and application |
-
2021
- 2021-04-08 CN CN202110379739.8A patent/CN113186327B/en active Active
Also Published As
Publication number | Publication date |
---|---|
CN113186327A (en) | 2021-07-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN113186327B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FC89 strain, construction method and application thereof | |
CN112941224A (en) | Identification method of SSR (simple sequence repeat) marker fingerprint of golden 6046 strain of flammulina velutipes, construction method and application thereof | |
CN112795690A (en) | Identification method of SSR (simple sequence repeat) marker fingerprint of flammulina velutipes J3931 strain as well as construction method and application of identification method | |
CN112941223A (en) | Golden needle mushroom 6168 strain and identification method and construction method and application of SSR marker fingerprint spectrum thereof | |
CN112725522A (en) | Golden needle mushroom 1767 strain and identification method and construction method and application of SSR marker fingerprint spectrum thereof | |
CN113186328B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes xujin 18 strain and construction method and application thereof | |
CN113151548B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FV1923 strain and construction method and application thereof | |
CN112980992B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FW178 strain, construction method and application thereof | |
CN112980995B (en) | Identification method of microsatellite DNA marker fingerprint of golden needle mushroom 1754 strain and construction method and application thereof | |
CN112961933B (en) | Identification method of microsatellite DNA marker fingerprint spectrum of flammulina velutipes FL159 strain and construction method and application thereof | |
CN112980994B (en) | Identification method of SSR marker fingerprint of needle mushroom strain and construction method and application thereof | |
CN112813193B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes X995 strain and construction method and application thereof | |
CN112961934B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes SCY12 strain and construction method and application thereof | |
CN113005220B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes J1011 strain, construction method and application thereof | |
CN113151547B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FL1980 strain, construction method and application thereof | |
CN112760406B (en) | SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM22 strain as well as construction method and application thereof | |
CN112708694B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-B-3 strain and construction method and application thereof | |
CN112795680B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-N-11 strain and construction method and application thereof | |
CN112795687B (en) | SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM21 strain as well as construction method and application thereof | |
CN112795681B (en) | SSR (simple sequence repeat) labeled fingerprint spectrum of hypsizigus marmoreus HM18 strain as well as construction method and application of SSR labeled fingerprint spectrum | |
CN112708696B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-F-4 strain and construction method and application thereof | |
CN112813183B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-B-6 strain and construction method and application thereof | |
CN112877457B (en) | SSR (simple sequence repeat) labeled fingerprint spectrum of hypsizigus marmoreus HM6 strain as well as construction method and application of SSR labeled fingerprint spectrum | |
CN112795688B (en) | SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM13 strain as well as construction method and application thereof | |
CN112877458B (en) | SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM36 strain as well as construction method and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |