CN112961933B - Identification method of microsatellite DNA marker fingerprint spectrum of flammulina velutipes FL159 strain and construction method and application thereof - Google Patents
Identification method of microsatellite DNA marker fingerprint spectrum of flammulina velutipes FL159 strain and construction method and application thereof Download PDFInfo
- Publication number
- CN112961933B CN112961933B CN202110379036.5A CN202110379036A CN112961933B CN 112961933 B CN112961933 B CN 112961933B CN 202110379036 A CN202110379036 A CN 202110379036A CN 112961933 B CN112961933 B CN 112961933B
- Authority
- CN
- China
- Prior art keywords
- primer
- flammulina velutipes
- strain
- microsatellite dna
- size
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an identification method of a microsatellite DNA marker fingerprint of flammulina velutipes FL159 strain and a construction method and application thereof, wherein the fingerprint consists of 6 pairs of microsatellite DNA markers. The construction method comprises the following steps: (1) hypha culture; (2) extracting genome DNA; (3) detecting microsatellite DNA molecular markers; and (4) detecting by capillary electrophoresis. The application comprises the following steps: performing microsatellite DNA marker amplification on the flammulina velutipes strain, comparing the obtained banding pattern with the fingerprint spectrum, and obtaining the flammulina velutipes FL159 strain if the banding pattern is consistent with the fingerprint spectrum. Compared with conventional morphological detection, antagonism test and fruiting test, the method has the advantages of short detection time, high accuracy and good repeatability, and has the specificity of the flammulina velutipes FL159 strain in the collected 105 flammulina velutipes cultivation main culture strains at home and abroad.
Description
Technical Field
The invention belongs to the technical field of detection of flammulina velutipes strains, and particularly relates to an identification method of a microsatellite DNA marker fingerprint of flammulina velutipes FL159 strains, and a construction method and application thereof.
Background
Flammulina velutipes (Flammulinaafiliformis) is a commonly cultivated edible fungus, and is generally classified into white and yellow varieties. The cultivation history is long, the total production amount is promoted year by year, and the strain is the fastest-developing and largest-scale strain in industrialized edible fungus enterprises in China at present. The daily yield of the industrial cultivation of the flammulina velutipes in China approximately accounts for 47.12 percent of the total industrial yield of the edible fungi in China. The needle mushroom is rich in nutrition, delicious in taste and high in medicinal value, is rich in various nutritional ingredients such as proteins, minerals and vitamins, has various medicinal health-care effects of resisting tumors, enhancing immunity regulation, resisting viruses, reducing blood fat, resisting fatigue, protecting liver and the like, and is popular with consumers.
The contribution rate of the high-quality strains in the yield per unit and the quality of the flammulina velutipes is significant. The industrialized culture strain of flammulina velutipes in China is mainly white strain which is bred abroad and has high first tide yield, short growth period and storage tolerance. Compared with foreign countries, the domestic needle mushroom breeding work is relatively lagged, and the reason for the small market share of the domestic strains is also caused. But compared with the current leading industrialized strains, china has rich wild and natural flammulina velutipes cultivation resources, the high-quality resources are efficiently utilized, the genetic basis of the strains is expanded, and the breeding of the domestic high-yield, high-quality and characteristic flammulina velutipes strains is facilitated. In 1999, china signed the protection law of new species of international plants, which not only required us to respect the intellectual property rights of species in other countries, but also strengthened the protection of the intellectual property rights of species in our country. In order to establish a new species registration system of edible fungi to really protect the property rights of species in China, a mature species identification technology must be established at first to lay a foundation for registering the new species. In China, the phenomenon of product homogenization caused by low diversity of needle mushroom culture strains not only brings economic loss to production enterprises, but also greatly influences the rapid development of the needle mushroom industry in China; on the other hand, the requirements of industrial cultivation modes and strain degeneration phenomena on the quality of needle mushroom cultivation strains are higher and higher, and a simpler, faster and more accurate strain identification technology needs to be developed so as to ensure that each batch of strains used is a high-quality and accurate strain.
Aiming at the current development situation of the flammulina velutipes industry, the development of an accurate and effective flammulina velutipes strain identification system by utilizing the modern molecular biology technology is an extremely important work.
Disclosure of Invention
The invention aims to solve the technical problem of providing a microsatellite DNA marker fingerprint of flammulina velutipes 'FL 159' strain and a construction method and application thereof.
Flammulina velutipes (Flammulina filiformis) FL159 was stored in Guangdong province culture collection center in 2021, 2/8/month, and the address is No. 59, no. 5, of Michelia Tokyo 100, guangdong province institute of microbiology, and the storage number is GDMCC No:61516.
the invention relates to a micro-satellite DNA marking fingerprint of flammulina velutipes 'FL 159' strain, which consists of 6 pairs of micro-satellite DNA marks, is an SSR primer developed based on simple repetitive sequence segments of flammulina velutipes genome, has good amplification band type and high repeatability, and detailed marking information is shown in Table 1:
TABLE 1 microsatellite DNA marker details List
The invention relates to a method for constructing a microsatellite DNA marker fingerprint of flammulina velutipes 'FL 159' strains, which comprises the following steps:
(1) Hypha culture: inoculating the needle mushroom strain to a potato glucose agar solid medium (PDA), culturing at 25 ℃ for 5-10 days, and collecting hyphae;
(2) Extraction of genomic DNA: extracting the genome DNA of the hyphae by using a TaqHotStart amplification kit of TAKARA, detecting the concentration and purity of the total genome DNA by an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be consistent;
(3) Detection of microsatellite DNA molecular markers: carrying out PCR amplification of gene microsatellite DNA markers on the extracted DNA;
(4) Electrophoresis detection: mixing the product obtained by PCR amplification with formamide sample adding buffer solution, denaturing, and detecting on a computer;
(5) GeneMapper data analysis.
The specific process for extracting the genome DNA of the hyphae by the kit method in the step (2) comprises the following steps:
(1) Adding liquid nitrogen into the hypha sample, and fully grinding;
(2) Adding 360 mu L of Buffer STE and 40 mu L of Buffer SDS into the ground powder rapidly, quickly whirling and uniformly mixing, placing the centrifugal tube in a water bath at 65 ℃ for 15min, and reversing the centrifugal tube in the water bath process to mix the sample for a plurality of times;
(3) Adding 5 μ L RNase Solution into the lysate, mixing by vortex, and standing at room temperature for 15-30min;
(4) Adding 140 mu L of Buffer PS, vortexing and shaking for 30s, and standing on ice for 10min;
(5) 13000g was centrifuged for 5min at room temperature, and 400. Mu.L of the supernatant was carefully transferred to a new centrifuge tube;
(6) Add 600. Mu.L Buffer PBD (diluted with absolute ethanol) to the sample, vortex and mix for 30s;
(7) Loading the DNA binding column in a collecting tube, transferring half of the mixed solution to the column, and centrifuging at 8000g for 1min;
(8) Pouring off the filtrate, putting the column back into the collecting pipe, transferring the residual mixed solution into the column, and centrifuging for 1min at 8000 g;
(9) Pouring the filtrate and putting the column back into the collecting pipe, adding 600 μ L Buffer GW2 (diluted with absolute ethyl alcohol) into the column, and centrifuging at 8000g for 1min;
(10) Repeating the step 9;
(11) Pouring off the filtrate, putting the column back into the collecting pipe, centrifuging for 2min at 10000g to remove the residual ethanol in the column;
(12) Transferring the column to a new 1.5ml centrifuge tube, adding 30 μ L of Buffer AE preheated to 65 deg.C to the center of the membrane of the column, standing at room temperature for 2min, and centrifuging at 10000g for 1min;
(13) mu.L of DNA was used for 1.2% agarose gel electrophoresis detection, 2. Mu.L of DNA was used for NanoDrop spectrophotometry, and the remaining DNA was stored at-20 ℃.
The PCR amplification system in the step (3) is as follows: total volume 10 μ L, including: 10 XPCR buffer 1 uL, 2.5mmol/L dNTP 0.8 uL, 5U/uL HSTaq DNA enzyme 0.1 uL, 5 umol/L microsatellite DNA mark forward primer and reverse primer total volume 0.6 uL respectively, concentration 20 ng-30 ng/uL extractionThe template DNA was taken 1. Mu.L, ddH 2 O 5.9μL;
And (3) PCR reaction conditions: 5min at 95 ℃; 30second at 95 ℃, 30second at 60 ℃, 30second at 72 ℃,35 cycles; 30min at 60 ℃.
The sample adding buffer solution in the step (4) is 9 mu L of a molecular weight internal standard and formamide mixed solution (0.5; the amount of the PCR amplification product added was 1. Mu.L.
The specific process of denaturation in the step (4) is to denature at 95 ℃ for 3min, and then to cool in an ice-water mixture for 3min.
The electrophoresis in the step (4) has the following process parameters: the modified polyacrylamide gel is commercial POP7 gel, the electrophoresis buffer solution is 3730buffer EDTA, the injection voltage is 2000V, the operation voltage is 15000V, the sample injection time is 10s, the temperature is 60 ℃, the capillary length is 50cm, the power is 200W, the electrophoresis is performed for 20min, and the current and the power are dynamic.
The data analysis in the step (5) is specifically as follows: and (3) importing the detected original data file into analysis software genemapper ID3.2, and performing group structure analysis, clustering and heterozygosity analysis and core germplasm resource calculation analysis by using POPGENE, NTSYS and other software. Allele factors (Na, ne), nei's genetic diversity index (He), shannon's diversity information index (I) and gene observation heterozygosity (Ho) were analyzed.
TABLE 2 summary of allelic fragment information from SSR primer amplification
The invention discloses an application of a microsatellite DNA marker fingerprint of flammulina velutipes 'FL 159' strains, which is characterized in that 6 pairs of SSR primers developed by simple repetitive sequence segments of flammulina velutipes genomes are utilized, a large number of SSR primers are screened, the number of allelic segments amplified by the 6 pairs of SSR primers in each flammulina velutipes cultivar is determined and numbered (table 2) by performing banding amplification on the SSR primers of 105 collected main flammulina velutipes cultivars, and the 'FL 159' strains can be effectively identified in 105 collected main flammulina velutipes cultivars by combining the numbers of different SSR allelic sites. The relative molecular weight of the allelic locus amplified by each SSR primer can be determined by analyzing capillary electrophoresis combined software, the strain with the specific SSR allelic fragment combination of the strain FL159 is the strain Flammulina velutipes FL159, and the number combination of the strain is as follows: (5+10)/(6+9)/(4+8)/(1+9)/(2+5)/5.
The invention has the beneficial effects that: compared with conventional morphological detection, antagonism test and fruiting test, the method has the advantages of short detection time, high accuracy and good repeatability. The operation time required for detection is within 24h (including genome DNA extraction, PCR amplification, electrophoresis analysis and data analysis), while the time required for conventional antagonistic tests is at least two weeks, and the time required for fruiting tests is at least 3 months; the method has specificity of 'FL 159' strain in 105 collected main culture strains of the commercially available flammulina velutipes (including Fv-DY, fv-FY, fv-SB, fv-CYS, fv-YH, fv-KL, fv-MG, fv-MH, fv-MI, fv-MJ, fv-SY, fv-FM, fv-WC, fv-GF, fv-BY, fv-HL, fv-RYJ, fv-XH, fv-HTC, fv-GR and the like), and has good application prospect.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the description of the embodiments will be briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without inventive exercise. Wherein:
FIG. 1 is a diagram of allelic locus relative molecular weight peaks obtained by sequentially detecting a primer FfSSR1 in a selected flammulina velutipes cultivation material FL159 and several main cultivation commercial varieties respectively;
FIG. 2 is a diagram of allelic locus relative molecular weight peaks obtained by sequentially detecting the primer FfSSR8 in the selected flammulina velutipes cultivation material FL159 and several main cultivation commercial varieties respectively;
FIG. 3 is a diagram of allelic site relative molecular weight peaks obtained by sequential detection of primers FfSSR12 in selected Flammulina velutipes cultivation material FL159 and several main cultivation commercial varieties respectively;
FIG. 4 is a diagram of allelic site relative molecular weight peaks obtained by sequential detection of primers FfSSR13 in selected Flammulina velutipes cultivation material FL159 and several main cultivation commercial varieties respectively;
FIG. 5 is a diagram of allelic site relative molecular weight peaks obtained by sequential detection of primers FfSSR16 in selected Flammulina velutipes cultivation material FL159 and several main cultivation commercial varieties respectively;
FIG. 6 is a diagram of allelic site relative molecular weight peaks obtained by sequential detection of the primer FfSSR17 in selected needle mushroom cultivation material FL159 and several main cultivation commercial varieties respectively.
Detailed Description
In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with examples are described in detail below.
In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, but the present invention may be practiced in other ways than those specifically described and will be readily apparent to those of ordinary skill in the art without departing from the spirit of the present invention, and therefore the present invention is not limited to the specific embodiments disclosed below.
Furthermore, reference herein to "one embodiment" or "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one implementation of the invention. The appearances of the phrase "in one embodiment" in various places in the specification are not necessarily all referring to the same embodiment, nor are separate or alternative embodiments mutually exclusive of other embodiments.
Example 1:
(1) Hypha culture: inoculating needle mushroom strain to potato glucose agar solid culture medium (PDA), culturing at 25 deg.C for 7d, and collecting mycelium;
(2) Extraction of genomic DNA: extracting the genome DNA of the hyphae by using a TaqHotStart amplification kit of TAKARA, detecting the concentration and purity of the total genome DNA by an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be consistent;
the CTAB method for extracting genome DNA of hyphae comprises the following steps:
(1) adding liquid nitrogen into the hypha sample, and fully grinding;
(2) adding 360 mu L of Buffer STE and 40 mu L of Buffer SDS into the ground powder rapidly, quickly whirling and uniformly mixing, placing the centrifugal tube in a water bath at 65 ℃ for 15min, and reversing the centrifugal tube in the water bath process to mix the sample for a plurality of times;
(3) adding 5 μ L RNase Solution into the lysate, mixing by vortex, and standing at room temperature for 15-30min;
(4) adding 140 mu L of Buffer PS, vortexing and shaking for 30s, and standing on ice for 10min;
(5) 13000g was centrifuged for 5min at room temperature, and 400. Mu.L of the supernatant was carefully transferred to a new centrifuge tube;
(6) add 600. Mu.L Buffer PBD (diluted with absolute ethanol) to the sample, vortex and mix for 30s;
(7) loading the DNA binding column in a collecting tube, transferring half of the mixed solution to the column, and centrifuging at 8000g for 1min;
(8) pouring off the filtrate, putting the column back into the collecting pipe, transferring the residual mixed solution into the column, and centrifuging for 1min at 8000 g;
(9) pouring the filtrate and putting the column back into the collecting pipe, adding 600 μ L Buffer GW2 (diluted with absolute ethyl alcohol) into the column, and centrifuging at 8000g for 1min;
r repeats step 9;
pouring off the filtrate, putting the column back into the collecting pipe, centrifuging at 10000g for 2min to remove the residual ethanol in the column;
transferring the column toAdding 30 μ L of Buffer AE preheated to 65 deg.C into a new 1.5ml centrifuge tube, standing at room temperature for 2min, centrifuging at 10000g for 1min;
mu.L of DNA was used for 1.2% agarose gel electrophoresis detection, 2. Mu.L of DNA was used for NanoDrop spectrophotometry, and the remaining DNA was stored at-20 ℃.
(3) Detecting the microsatellite DNA molecular marker: carrying out PCR amplification of gene microsatellite DNA markers on the extracted DNA;
the PCR amplification system is as follows: total volume 10 μ L, including: 10 XPCR buffer 1 uL, 2.5mmol/L dNTP 0.8 uL, 5U/uL HSTaq DNA enzyme 0.1 uL, 5 umol/L microsatellite DNA mark forward primer and reverse primer total volume 0.6 uL respectively, template DNA extracted with concentration of 20 ng-30 ng/uL 1 uL, ddH 2 O 5.9μL;
And (3) PCR reaction conditions: 5min at 95 ℃; 30second at 95 ℃, 30second at 60 ℃, 30second at 72 ℃,35 cycles; 30min at 60 ℃.
(4) And (3) electrophoresis detection: mixing the product obtained by PCR amplification with 1 μ L sample buffer solution, denaturing at 95 deg.C for 3min, and cooling in ice water mixture for 3min; 3 mu L of sample is applied to a modified polyacrylamide gel for electrophoresis, the modified polyacrylamide gel is commercial POP7 gel, the electrophoresis buffer solution is 3730buffer EDTA, the injection voltage is 2000V, the operation voltage is 15000V, the sample injection time is 10s, the temperature is 60 ℃, the length of a capillary is 50cm, the power is 200W, the electrophoresis is 20min, the current and the power are dynamic,
(5) Analysis of results
Adopting 6 pairs of SSR primers to carry out PCR amplification and capillary electrophoresis on needle mushroom strains, and finding a matched number combination by analyzing allelic gene factors (Na, ne), nei's genetic diversity index (He), shannon's diversity information index (I) and gene observation heterozygosity (Ho) and combining relative molecular weight peak maps of allelic sites: ffSSR1, ffSSR8, ffSSR12, ffSSR13, ffSSR16, ffSSR17, the corresponding banding pattern is: (5 + 10)/(6 + 9)/(4 + 8)/(1 + 9)/(2 + 5)/5), and the strain is determined to be flammulina velutipes strain FL 159. To ensure the accuracy of the identification, three replicates were recommended.
BY taking several main commercial varieties as examples, peak maps of the relative molecular weights of the allelic sites obtained BY sequential detection of 6 pairs of primers are shown in FIGS. 1 to 6 (sequentially (1 FL159 (2))Fv-GR)。
The fingerprint spectrum of the invention refers to the combination of the primer and the band type thereof.
It should be noted that the above-mentioned embodiments are only for illustrating the technical solutions of the present invention and not for limiting, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, which should be covered by the claims of the present invention.
Sequence listing
<110> Shanghai city academy of agricultural sciences
<120> identification method of microsatellite DNA marker fingerprint of flammulina velutipes FL159 strain, construction method and application thereof
<130> 2021040802-zf-wjn
<141> 2021-04-08
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tctgaatgtc ccggagcgt 19
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gatacgagca gcactcgcg 19
<210> 3
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
catggatgtt gacgggaa 18
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ctggaacggt ggtagactct c 21
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
atgcggcggt ttgtcagaac 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
aaccacaacc ttccttcccc 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
atttcttcgg atgctttgga 20
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ttctctttgc acacgtcgaa 20
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
agacccaaca ccggacatat 20
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
ggttagggat gtgacgcggt 20
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
cccagatgat gctgcaatgc 20
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
cgctttgtgg cactatctgc 20
Claims (2)
1. A method for identifying a microsatellite DNA marker fingerprint of flammulina velutipes FL159 strains is characterized by comprising the following steps: the fingerprint consists of 6 pairs of microsatellite DNA markers, and the specific sequences of 6 pairs of corresponding primers are as follows:
FfSSR1 forward primer: TCTGAATGTCCCCGGAGCGT;
reverse primer: gatacgagcaggccgcg;
FfSSR8 forward primer: cattggatttgacgggaa;
reverse primer: CTGGAACGGTGGTAGACTCTC;
FfSSR12 forward primer: ATGCGGCGGTTTGTCAGAAC;
reverse primer: AACCACACCTTCCTTCCCC;
FfSSR13 forward primer: ATTTCTTCGGATGCTTTGGA;
reverse primer: TTCTCTTTGCACACGTCGAAA;
FfSSR16 forward primer: AGACCCAACCGGACATAT;
reverse primer: GGTTAGGGATGTGACGCGGT;
FfSSR17 forward primer: cccagatgatgatgcctgcaatgc;
reverse primer: CGCTTTGTGGCACTATTCTGC;
the corresponding combination of the belt type numbers is as follows: (5 + 10)/(6 + 9)/(4 + 8)/(1 + 9)/(2 + 5)/5;
wherein the band type number corresponding to the primer FfSSR1 is 5+10, the size of the strip of the allele segment corresponding to the number 5 is 282 to 282.99bp, and the size of the strip of the allele segment corresponding to the number 10 is 302 to 302.99bp; the tape type corresponding to the primer FfSSR8 is numbered 6+9, wherein the stripe size of the allele segment corresponding to the primer FfSSR8 is numbered 130 to 130.99bp, and the stripe size of the allele segment corresponding to the primer FfSSR8 is numbered 144 to 144.99bp; the tape type corresponding to the primer FfSSR12 is numbered 4+8, wherein the stripe size of the allele segment corresponding to the primer FfSSR12 is 248 to 248.99bp, and the stripe size of the allele segment corresponding to the primer FfSSR12 is 251 to 251.99bp; the band type number corresponding to the primer FfSSR13 is 1+9, wherein the size of the strip of the allele segment corresponding to the number 1 is 193-193.99bp, and the size of the strip of the allele segment corresponding to the number 9 is 202-202.99bp; the tape type corresponding to the primer FfSSR16 is numbered 2+5, wherein the stripe size of the allele segment corresponding to the number 2 is 217 to 217.99bp, and the stripe size of the allele segment corresponding to the number 5 is 226 to 226.99bp; the corresponding band type number of the primer FfSSR17 is 5, and the band size of the corresponding allele segment is 293 to 293.99bp;
the preservation number of the flammulina velutipes FL159 strain is GDMCC No:61516.
2. the use of a microsatellite DNA marker fingerprint of Flammulina velutipes FL159 strain as set forth in claim 1, wherein: the microsatellite DNA marker fingerprint of the flammulina velutipes FL159 strain is used for identifying the specific allelic variation of the flammulina velutipes FL159 strain and/or identifying the specificity of the flammulina velutipes FL159 strain.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110379036.5A CN112961933B (en) | 2021-04-08 | 2021-04-08 | Identification method of microsatellite DNA marker fingerprint spectrum of flammulina velutipes FL159 strain and construction method and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110379036.5A CN112961933B (en) | 2021-04-08 | 2021-04-08 | Identification method of microsatellite DNA marker fingerprint spectrum of flammulina velutipes FL159 strain and construction method and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN112961933A CN112961933A (en) | 2021-06-15 |
CN112961933B true CN112961933B (en) | 2023-02-24 |
Family
ID=76281384
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202110379036.5A Active CN112961933B (en) | 2021-04-08 | 2021-04-08 | Identification method of microsatellite DNA marker fingerprint spectrum of flammulina velutipes FL159 strain and construction method and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN112961933B (en) |
-
2021
- 2021-04-08 CN CN202110379036.5A patent/CN112961933B/en active Active
Non-Patent Citations (1)
Title |
---|
Development and characterization of simple sequence repeat (SSR) markers for the mushroom Flammulina velutipes;Ruiying Zhang等;《Journal of Bioscience and Bioengineering》;20101231;第110卷(第3期);第273页右栏第1-3段,第274页右栏第2-3段-第275页左栏第1-2段、表1-2、图1 * |
Also Published As
Publication number | Publication date |
---|---|
CN112961933A (en) | 2021-06-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN113186327B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FC89 strain, construction method and application thereof | |
CN112941224A (en) | Identification method of SSR (simple sequence repeat) marker fingerprint of golden 6046 strain of flammulina velutipes, construction method and application thereof | |
CN112795690A (en) | Identification method of SSR (simple sequence repeat) marker fingerprint of flammulina velutipes J3931 strain as well as construction method and application of identification method | |
CN112961933B (en) | Identification method of microsatellite DNA marker fingerprint spectrum of flammulina velutipes FL159 strain and construction method and application thereof | |
CN112725522A (en) | Golden needle mushroom 1767 strain and identification method and construction method and application of SSR marker fingerprint spectrum thereof | |
CN112941223A (en) | Golden needle mushroom 6168 strain and identification method and construction method and application of SSR marker fingerprint spectrum thereof | |
CN112813193B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes X995 strain and construction method and application thereof | |
CN112980992B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FW178 strain, construction method and application thereof | |
CN113151548B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FV1923 strain and construction method and application thereof | |
CN112980994B (en) | Identification method of SSR marker fingerprint of needle mushroom strain and construction method and application thereof | |
CN112980995B (en) | Identification method of microsatellite DNA marker fingerprint of golden needle mushroom 1754 strain and construction method and application thereof | |
CN112961934B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes SCY12 strain and construction method and application thereof | |
CN113186328B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes xujin 18 strain and construction method and application thereof | |
CN113005220B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes J1011 strain, construction method and application thereof | |
CN113151547B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FL1980 strain, construction method and application thereof | |
CN112795680B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-N-11 strain and construction method and application thereof | |
CN112795682B (en) | SSR (simple sequence repeat) marker fingerprint of Shanghai Zhen 6 strain of hypsizigus marmoreus, construction method and application thereof | |
CN112760406B (en) | SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM22 strain as well as construction method and application thereof | |
CN112877458B (en) | SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM36 strain as well as construction method and application thereof | |
CN112708694B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-B-3 strain and construction method and application thereof | |
CN112795687B (en) | SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM21 strain as well as construction method and application thereof | |
CN112695131B (en) | SSR (simple sequence repeat) marker fingerprint of Shanghai Zhen 29 strain of hypsizigus marmoreus, construction method and application thereof | |
CN112760411A (en) | Identification method of SSR marker fingerprint of flammulina velutipes J4137 strain and construction method and application thereof | |
CN112746128B (en) | SSR (simple sequence repeat) marker fingerprint of hypsizigus marmoreus HM3 strain, and construction method and application thereof | |
CN112795681B (en) | SSR (simple sequence repeat) labeled fingerprint spectrum of hypsizigus marmoreus HM18 strain as well as construction method and application of SSR labeled fingerprint spectrum |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |