CN112501326A

CN112501326A - Absolute quantitative probe, method and kit for bacillus and application of absolute quantitative probe

Info

Publication number: CN112501326A
Application number: CN202011459493.7A
Authority: CN
Inventors: 吴群; 徐岩; 杜如冰
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2020-12-11
Filing date: 2020-12-11
Publication date: 2021-03-16
Anticipated expiration: 2040-12-11
Also published as: CN112501326B

Abstract

The invention discloses a bacillus absolute quantitative probe, a method, a kit and application thereof, belonging to the fields of biology, fermentation and detection. The bacillus microorganism quantitative probe and the kit can realize the total amount detection of all bacillus microorganisms, do not need expensive instruments when used for detection and bacillus microorganism quantification, and can quickly complete the quantification work within 2.5 h. Meanwhile, the sample used in the present invention does not have to be subjected to nucleic acid extraction. The probe and the detection kit based on the invention are used for quantifying the bacillus microorganism and have the characteristics of rapidness, convenience, cheapness and accuracy.

Description

Absolute quantitative probe, method and kit for bacillus and application of absolute quantitative probe

Technical Field

The invention relates to an absolute quantification method of bacillus microorganisms, a kit and application thereof, belonging to the fields of biology, fermentation and detection.

Background

Bacillus (Bacillus) is widely distributed in a traditional fermented food brewing system, and is involved in metabolism and product and synthesis of various substrates in a fermentation process, such as degradation of macromolecular proteins, degradation of polysaccharides, synthesis of pyrazine compounds and the like. Therefore, the regular succession of bacillus microorganisms is a fundamental guarantee of stable food quality. At present, the quantification of bacillus is mainly a fluorescence quantitative PCR method, which depends on a fluorescence quantitative PCR instrument, but the price is high and the operation process is complex. In order to track the dynamic change rule of the bacillus in the re-fermentation process in real time and promote the stability and the upgrade of products, a simple, convenient, rapid and accurate quantitative method is very necessary to be provided.

The principle of enzyme activity detection of the G quadruplex/heme analogue is that the G quadruplex can form DNA mimic enzyme with catalase activity with heme, can catalyze hydrogen peroxide to oxidize ABTS to generate ABTS +, presents green color development reaction, and can detect characteristic light absorption value under the wavelength of 420 nm. The stability of the structure of the G quadruplex is crucial to the whole detection process, if the design is not proper, when the G quadruplex sequence and other bases form a dimer, the G quadruplex sequence cannot form the G quadruplex, and a quantitative method based on the principle can underestimate the content of a target gene in a sample in use and reduce the sensitivity and the accuracy of the detection method.

At present, the principle of enzyme activity detection based on G quadruplex/heme simulation has been reported to be used for specific detection of microorganisms; for example, the documents Wang Y, Li X, Xi D, Wang X.visual detection of Fusarium proliferatum based on enzymmetric digestion polymerization and hemin/G-quadruplex DNAzyme. Rsc Advances 2019; 37144-37147. in the method, an asymmetric specific primer (an upstream primer is modified by adding a reverse sequence of a G quadruplex, and the downstream primer is not modified) is used, so that the method is only suitable for detecting the specific bacteria Fusarium proliferatatum in a sample, and cannot realize the total amount detection of all bacillus microorganisms; in the case of detection using the asymmetric specific primer, the upstream primer and the downstream primer are added to a PCR system at different concentrations (the upstream primer is low in concentration and the downstream primer is high in concentration), a double-stranded product is formed by amplification using Recombinant Polymerase Amplification (RPA), the upstream primer is depleted as the PCR reaction proceeds, the downstream primer is amplified using newly synthesized double-stranded DNA as a template, and a single-stranded DNA having a G quadruplex end is formed, and Fusarium proliferatum in a detection sample is detected using a G quadruplex/heme mimic enzyme activity. However, this quantitative method still requires a PCR step to generate G quadruplexes, and the PCR process still requires high-volume PCR equipment and a strict operating environment.

Disclosure of Invention

The invention discloses a method, a kit and application for absolute quantification of bacillus microorganisms, which solve at least one technical problem as follows: (1) the existing method can not realize the total amount detection of all bacillus microorganisms; (2) the existing quantitative method has low species resolution and/or insufficient detection accuracy; (3) the existing quantitative method needs high-volume instruments and equipment and/or strict operation environment, and is not suitable for timely detection after production sampling; (4) the existing quantitative method has complicated operation and the like.

The first purpose of the invention is to provide a group of probes, which comprise a signaling probe and a quenching probe; the sequence of the signal probe is shown as SEQ ID NO.1 (GGGTGGGTGGGTGGGTAAAGCTGATTTGAAAGTCATTGGAGAT) or SEQ ID NO.3 (GGGATTGGGATTGGGATTGGGAAAGCTGATTTGAAAGTCATTGGAGAT).

In one embodiment, the quenching probe sequence is shown as SEQ ID NO.2 (ATCTCCAATGACTTTCAAATCAGCTTTACCCA) or SEQ ID NO.4 (ATCTCCAATGACTTTCAAATCAGCTTTCCCAA).

In one embodiment, the signaling probe sequence is set forth in SEQ ID NO.1 and the quenching probe sequence is set forth in SEQ ID NO. 2. Or SEQ ID NO.3 and the quenching probe sequence is shown in SEQ ID NO. 4.

It is a second object of the present invention to provide a method for quantifying a bacillus microorganism, the method comprising using the probe of the present invention.

The method comprises the following steps: melting DNA in a sample to be detected; adding excessive signal probe (with sequence shown as SEQ ID NO.1 or SEQ ID NO.3), and combining with target nucleotide fragment of the sample to be detected to form double chains, so that the G quadruplex is exposed outside the sequence; adding sufficient quenching probe (with sequence as SEQ ID NO.2 or SEQ ID NO.4) to form double chains with the unbound signal probe, and destroying the G quadruplex structure; the G quadruplex with the naked leak outside reacts with the heme to form G quadruplex/heme mimic enzyme with catalase activity, and the biomass of the bacillus microorganism is represented by combining the activity of the catalase.

In one embodiment, the method is an absolute quantitative method, further comprising: establishing a standard curve of catalase activity (or an index which is correlated with the catalase activity, such as an absorbance value of a solution at a wavelength of 420nm after ABTS + is generated by catalyzing hydrogen peroxide oxidation ABTS) and biomass of the bacillus microorganisms; and when a sample to be detected is detected, substituting the detected catalase activity into the standard curve to obtain the biomass of the bacillus microorganism in the sample to be detected.

In one embodiment, the method is a relative quantification method, further comprising: a plurality of samples were tested and the relative amount of biomass of the Bacillus microorganisms in the plurality of different samples was determined based on the relative amount of catalase activity measured in the different samples.

In one embodiment, the sample to be tested is a sample containing bacteria, genome, metagenome, or the like. Optionally, the sample to be detected is a fermented food finished product or a sample obtained in a fermented food fermentation process, or an environmental sample such as intestinal tract, soil, water and the like; optionally, the sample to be tested is subjected to pretreatment such as centrifugation and collection of bacteria, and then subsequent measurement is performed. Preferably, the cells in the sample are collected and subjected to DNA melting directly without genome extraction.

In one embodiment, the sample is a fermented food product or a sample taken from a fermentation process of a fermented food product.

In one embodiment, the fermented food is any one or more of: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverages, alcoholic drinks, yogurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd, fermented rice and flour foods and the like.

In one embodiment, the melting of the DNA in the sample to be tested is performed at a high temperature. Optionally, the sample to be tested is treated at a temperature above 90 ℃. Can be any one of metal bath, water bath, oven, heat preservation instrument and the like which can provide the environment with corresponding temperature.

In one embodiment, the melting is performed in a buffer. Optionally, the buffer solution can be Tris-HCl buffer solution, and also contains KCl and NH₄Any one or more of Cl and NaCl. Optionally, the buffer is Tris-HCl, KCl, pH 7.9.

In one embodiment, the excess is an amount that is greater than the amount of signaling probe required to form a duplex with all of the target nucleotide fragments of the sample to be tested. The specific amount can be determined by one skilled in the art by combining with common knowledge in the art or a specific sample to be tested, or by pre-experiment.

In one embodiment, the excess is in excess of 10¹⁰Copies of the signal probe.

In one embodiment, the binding of the signaling probe to the target nucleotide fragment of the sample to be tested to form a duplex is performed at a temperature in the range of 50-60 ℃.

In one embodiment, the sufficient amount is an amount of quenching probe that is required to form a double strand with all unbound signaling probes. The specific amount can be determined by one skilled in the art by combining with common knowledge in the art or by a specific sample to be tested, or by preliminary experiments.

In one embodiment, the sufficient amount is a double amount of signaling probe.

In one embodiment, the addition of a sufficient amount of quenching probe to form a duplex with the unbound signaling probe is at a temperature such that the quenching probe forms a duplex with the unbound signaling probe; one skilled in the art can determine or determine the specific sample to be tested in combination with common knowledge in the art.

In one embodiment, the G quadruplex/heme mimic enzyme having catalase activity is formed by reaction of the naked-leak outside G quadruplex with heme, and the biomass of the Bacillus microorganism is characterized in combination with the catalase activityIt means that ABTS and H are added after heme is added into the system for reaction₂O₂The catalase activity was then characterized by the absorbance of the reaction.

In one embodiment, the absorbance is at a wavelength of 420 nm.

In one embodiment, the quantification method is, in particular:

(1) carrying out DNA unzipping treatment on a sample to be detected;

(2) adding a signal probe, and reacting at 55 ℃ for 30 min;

(3) adding a quenching probe, and reacting at 55 ℃ for 30 min;

(4) adding heme, and reacting at 37 deg.C for 30 min;

(5) adding 2, 2-azino-bis- (3-ethylbenzodihydropyrazoline-6-sulfonic acid) diammonium salt (ABTS) and H₂O₂Reacting at 37 ℃ for 30 min;

(6) detecting the light absorption value of the reactant at the wavelength of 420 nm;

(7) and quantifying the bacillus microorganism in the sample by combining the absorbance value.

In one embodiment, the quantification method further comprises: preparing samples with different known bacillus microorganism contents, and measuring light absorption values of different samples after the different samples are treated by the method; drawing a standard curve of the light absorption value and the microbial contents of different bacillus; substituting the light absorption value obtained by processing the sample to be detected by the method into the standard curve to obtain the content of the bacillus microorganism in the sample to be detected.

The third purpose of the invention is to provide a detection kit for absolute quantification of bacillus microorganisms, which contains the signal probe with the sequence shown as SEQ ID NO.1 or SEQ ID NO. 3.

In one embodiment, the detection kit further comprises a quenching probe having a sequence as set forth in SEQ ID NO.2 or SEQ ID NO. 4.

In one embodiment, the test kit further comprises any one or more of: heme, buffer solution, 2-azino-bis- (3-ethylbenzodihydrophthaloline-6-sulfonic acid) diammonium salt (ABTS),H₂O₂. These reagents may not be contained, and an operator may prepare the reagent kit separately when the reagent kit is used.

In one embodiment, in the detection kit, the buffer solution can be Tris-HCl buffer solution, and also contains KCl and NH₄Any one or more of Cl and NaCl. Optionally, the buffer is Tris-HCl, KCl, pH 7.9.

In one embodiment, the detection kit is a bacillus microorganism absolute quantification kit, which comprises four reagents (reagent 1, reagent 2, reagent 3, reagent 4) and a set of bacillus microorganism quantification probes (signaling probe, quenching probe); the reagent 1 comprises heme; the reagent 2 comprises a buffer solution (Tris-HCl, KCl, pH 7.9; wherein KCl can be replaced by NH)₄Cl, NaCl); the reagent 3 comprises 2, 2-azino-bis- (3-ethylbenzodihydropyrazoline-6-sulfonic acid) diammonium salt (ABTS); the reagent 4 comprises H₂O₂。

In one embodiment, the reagent or probe in the test kit may be in a liquid state or a solid state, and may be adjusted to a suitable concentration by those skilled in the art in use.

The fourth purpose of the invention is to provide a using method of the kit.

In one embodiment, the method of use comprises: adding excessive signal probes into a sample to be detected after the DNA is unzipped, and reacting for a period of time to enable the signal probes to be combined with target fragments in the sample to be detected; then adding a sufficient amount of quenching probe to form a double strand with the unbound signaling probe; adding heme, reacting for a while, adding ABTS and H₂O₂And reacting for a period of time, detecting the light absorption value of the reactant, and quantifying the bacillus microorganism in the sample by combining the light absorption value.

In one embodiment, the method comprises adjusting the reagents and probes to concentrations suitable for use.

(1) Carrying out DNA unzipping treatment on a sample to be detected; (2) adding a signal probe, and reacting at 55 ℃ for 30 min; (3) addition of quenchProbe, reacting at 55 deg.C for 30 min; (4) adding heme, and reacting at 37 deg.C for 30 min; (5) adding 2, 2-azino-bis- (3-ethylbenzodihydropyrazoline-6-sulfonic acid) diammonium salt (ABTS) and H₂O₂Reacting at 37 ℃ for 30 min; (6) detecting the light absorption value of the reactant at the wavelength of 420 nm; (7) and quantifying the bacillus microorganism in the sample by combining the absorbance value.

The fifth purpose of the invention is to provide the application of the kit in the quantification of bacillus microorganisms.

In one embodiment, the application is used in the technical field of fermented food or the technical field of detection of microorganisms in the environment such as intestinal tracts, soil, water bodies and the like; optionally, the fermented food is any one or more of the following: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverages, alcoholic drinks, yogurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd, fermented rice and flour foods and the like.

In one embodiment, the sample to be tested may be a sample containing bacteria, genome, metagenome, or the like. Optionally, the sample to be detected is a finished fermented food product or a sample obtained in a fermentation process of fermented food; optionally, the sample to be tested is subjected to pretreatment such as centrifugation and collection of bacteria, and then subsequent measurement is performed. Preferably, the cells in the sample are collected and subjected to DNA melting directly without genome extraction.

Has the advantages that:

the invention combines the G quadruplex with a specific sequence to form a signal probe, the signal probe is combined with a target sequence to ensure that the G quadruplex is barely leaked outside the sequence, a sufficient amount of quenching probe is added to form a double chain with an unreacted signal probe, the structure of the G quadruplex is damaged, a G quadruplex/heme mimic enzyme is formed by reaction with heme, catalase activity is shown, and the biomass of microorganisms is represented by the catalase activity. The bacillus microorganism quantitative probe can realize the total amount detection of all bacillus microorganisms; further, the signaling probe was optimized with the sequence of the signaling probe GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO.1) and the quenching probe CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO. 2). Compared with the signal sequence of SEQ ID NO.3, the G quadruplex sequence in the signal probe of SEQ ID NO.1 does not generate an additional spatial structure with a specific sequence (FIG. 1), the detection accuracy is higher, and the minimum detection limit is improved.

When the probe is used for detection and quantification of bacillus microorganisms, a detection process of an expensive instrument is not needed. The kit for absolutely quantifying the microorganisms is also provided for the first time, and the quantification work can be completed within 2.5 hours. The invention aims to avoid using high-cost equipment such as a PCR instrument and realize the quantification of microorganisms by combining a signal probe and a quenching probe. The invention solves the problem that the prior microorganism quantitative means all depend on expensive instruments and are very limited in the practical application process.

Furthermore, the rapid detection method can realize rapid detection of the bacillus microorganism, and the sample does not need to be subjected to nucleic acid extraction, and only the microorganism in the sample needs to be eluted into the buffer solution for directly carrying out subsequent experiments. Meanwhile, compared with the fluorescent quantitative PCR quantitative result, the quantitative result obtained by the method has no significant difference.

In conclusion, the probe and the detection kit provided by the invention are used for quantifying bacillus microorganisms, and have the characteristics of rapidness, cheapness and accuracy.

Drawings

FIG. 1: a dimeric structure of a signaling probe. (A) The G quadruplex sequence of SEQ ID No.1 does not form a loop with the specific sequence; (A) the G quadruplex sequence of SEQ ID NO.3 self-forms a loop with the specific sequence.

FIG. 2: specificity of Bacillus Probe

FIG. 3: standard curves for probes for microorganisms of the genus Bacillus based on genome extraction. (A) Taking a Bacillus coagulans genome as a gradient dilution standard; (B) bacillus licheniformis genome is taken as gradient dilution standard

FIG. 4: standard curves based on probes for microorganisms of the genus bacillus without extracting the genome of the sample. (A) Taking a Bacillus coagulans genome as a gradient dilution standard; (B) bacillus licheniformis genome is taken as gradient dilution standard

FIG. 5: qPCR standard curve.

FIG. 6: comparing the bacillus microorganism probe quantitative experiment based on genome extraction, the bacillus microorganism probe quantitative experiment based on non-extracted sample genome and the qPCR bacillus microorganism quantitative experiment; the method comprises the following steps of (A) a bacillus microorganism probe quantitative experiment based on genome extraction, (B) a bacillus microorganism probe quantitative experiment based on non-extracted sample genome, and (C) a qPCR bacillus microorganism quantitative experiment.

FIG. 7: the stability of the results of the detection based on the probe (A) of SEQ ID NO.1/SEQ ID NO.2 and the probe (B) of SEQ ID NO.3/SEQ ID NO.4 is compared.

The specific implementation mode is as follows:

example 1: quantitative probe combined reagent for bacillus microorganisms

A probe combination reagent; comprises a signaling probe reagent and a quenching probe reagent which are packaged separately; wherein, the sequence of the signal probe is shown as SEQ ID NO.1 or SEQ ID NO.3, and the sequence of the quenching probe is shown as SEQ ID NO.2 or SEQ ID NO. 4.

The signal probe reagent and the quenching probe reagent are in a dry powder or liquid state; in the case of dry powder, it may be diluted to an appropriate concentration prior to the experiment, for example, to a concentration of 20. mu.M using sterile water or buffer; in the case of liquid, the concentration may be 20 to 200. mu.M, and the reagent may be diluted before use or may be used as it is.

Example 2: bacillus microorganism quantification kit and use thereof

The bacillus microorganism quantitative kit comprises a signal probe reagent and a quenching probe reagent which are independently packaged; wherein, the sequence of the signal probe is shown as SEQ ID NO.1 or SEQ ID NO.3, and the sequence of the quenching probe is shown as SEQ ID NO.2 or SEQ ID NO. 4.

When the kit is used, the kit can be mixed with heme, buffer solution, 2-azino-bis- (3-ethylbenzodihydro-thiazoline-6-sulfonic acid) diammonium salt (ABTS), and H₂O₂Can be used in combination.

The using method comprises the following steps:

(1) And (4) solution preparation. Prepare 100nM heme solution (reagent 1); Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and a final pH of 7.9 (reagent 2); 7mM of 2, 2-azino-bis- (3-ethylbenzodithiazoline-6-sulfonic acid) diammonium salt (ABTS) (reagent 3) and 7mM of H₂O₂Solution (reagent 4); the solvent is sterile water.

(2) The signal probe forms a double strand with the sample DNA. To 2mL of

reagent

2, 4. mu.L of the sample genomic DNA was added, and the mixture was treated with a water bath at 90 ℃ for 10 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(3) The quenching probe forms a double strand with the unbound signaling probe. The quenching probe forms a double chain with the unbound signal probe, and the G quadruplex structure is damaged. To the system after the reaction in step (4), 8. mu.L of 20. mu.M quenching probe was added and the reaction was carried out at 55 ℃ for 30 min.

(4) Forming a heme/G quadruplex structure. To the system after the reaction in step (5), a reagent 1 was added to a final concentration of 100nM and treated at 37 ℃ for 30 min.

(5) And (4) color reaction. To the reaction-terminated system of (4), a reagent (ABTS) having a final concentration of 7mM and a reagent 4 having a final concentration of 7mM were added, and the mixture was treated at 37 ℃ for 30min to effect a revealing reaction (green).

Detecting the light absorption value of the reactant at the wavelength of 420 nm; and quantifying the bacillus microorganism in the sample by combining the absorbance value.

Of course, when absolute quantification is performed, a standard curve of the absorbance and the biomass of the bacillus microorganism can be automatically drawn, or the biomass of the bacillus microorganism can be directly converted according to the use method recommended by the kit and the standard curve.

Example 3: bacillus microorganism quantitative kit

The kit also contains 100nM heme solution (reagent 1), Tris-HCL buffer solution, 7mM 2, 2-azino-bis- (3-ethylchromanone-6-sulfonic acid) diammonium salt (ABTS), 7mM H₂O₂And (3) solution.

Example 4: specificity of a kit for quantifying a microorganism of the genus Bacillus

(1) 5 microorganisms of the genus Bacillus widely present in the fermented food sample were selected as positive controls, namely Bacillus coagulans, Bacillus licheniformis, Bacillus tequilensis, Bacillus subtilis, and Bacillus velezensis. As negative controls, 31 non-Bacillus microorganisms and 7 fungal microorganisms widely present in the fermented specimen were selected, wherein 31 non-Bacillus microorganisms include Lactobacillus buchneri, Lactobacillus diovorans, Lactobacillus brevis, Lactobacillus crustorum, Lactobacillus plantarum, Lactobacillus harbinensis, Lactobacillus acidophilus, Pediococcus acetodurans, Pediococcus Acetobacter, Pediococcus pentosaceus, Lactobacillus murinus, Lactobacillus curvatus, Lactobacillus casei, Lactobacillus reuteri, Lactobacillus plantarum, Lactobacillus sans, Lactobacillus acidophilus, Lestrain strain, Lestrain strain, Lestrain. The 7 fungal microorganisms include Aspergillus tubingenius, Mucor rouxianus, Schizosaccharomyces pombe, Zygosaccharomyces bailii, Pichia kudriavzevii, Saccharomyces fibuligera, Saccharomyces cerevisiae.

(2) The microorganisms mentioned above are cultured by selecting different culture media according to their habits, among which Lactobacillus buchneri, Lactobacillus diovorans, Lactobacillus brevis, Lactobacillus crustorum, Lactobacillus plantarum, Lactobacillus harbinensis, Lactobacillus acidophilus, Lactobacillus acetobacter ethanolica, Lactobacillus acidophilus, Lactobacillus curinus, Lactobacillus curvatus, Lactobacillus casei, Lactobacillus reuteri, Lactobacillus panis, Lactobacillus fermentum, Lactobacillus reuteri, Lactobacillus sans, Lactobacillus reuteri, Lactobacillus johnson, Lactobacillus plantarum, Lactobacillus jehni, Lactobacillus buchneri, Lactobacillus plantarum, Lactobacillus sans, Lactobacillus jehni, Lactobacillus jejuni, etcsonii, Lactobacillus delbrueckii, Lactococcus lactis, Weissella confuga, Weissella paramesenoides, Weissella virescens, Leucosoc citrum, Leucosoc lactis, Leucosoc mesenteroides, Leucosoc pseudosens using MRS medium formulated with tryptone 10.0g/L, beef extract 8.0g/L, yeast extract 4.0g/L, glucose 18.0g/L, anhydrous sorbitol oleate 0.8mL/L, K₂HPO₄2.5g/L, 6.0g/L of sodium acetate trihydrate, 2.0g/L of ammonium citrate tribasic, MgSO₄·7H₂O 0.3g/L，MnSO₄·4H₂O is 0.08 g/L. The culture conditions were 30 ℃ for 48 h. LB culture medium is used for Enterococcus italicus, Enterococcus lactis, Enterococcus faecalis, Bacillus coagulons, Bacillus licheniformis, Bacillus tequilensis, Bacillus subtilis, Bacillus velezensis, Acetobacter passaturius, Enterococcus faecalis, Escherichia coli, and the formula of the culture medium is 10.0g/L of peptone, 5g/L of yeast powder, and 10g/L of sodium chloride. The culture conditions were 37 ℃ for 24 h. Aspergillus tubinensis, Mucor rouxianus, Schizosaccharomyces pombe, Zygosaccharomyces bailii, Pichia kudriavzevii, Saccharomyces fibuligera, Saccharomyces cerevisiae, YPD medium was used, and yeast extract was 10g/L, peptone was 20g/L, and glucose was 20 g/L. The culture conditions were: the mold is cultured for 5 days at 30 ℃, and the yeast is cultured for 2 days at 30 ℃.

(3) Extracting genome DNA of pure microbial culture. And (3) centrifuging the bacterial liquid for 2min at 12000rpm, and collecting precipitates. The genomes of the pure cultures of 43 microorganisms were extracted according to the DNeasy Tissue Kit instructions of the Gene extraction Kit. (4) The probe is selected from Bacillus probes, the sequence of the signal probe is GGGTGGGTGGGTGGGTAAAGCTGATTTGAAAGTCATTGGAGAT (SEQ ID NO.1), and the sequence of the quenching probe is TCTCCAATGACTTTCAAATCAGCTTTACCCA (SEQ ID NO. 2).

(4) The signal probe forms a double strand with the sample DNA. To 2mL of each of the reagents 2 (including Tris-HCl of 50mM final concentration, KCl of 50mM final concentration, final pH 7.9) was added 4. mu.L of genomic DNA of different microorganisms, and treated in a water bath at 90 ℃ for 10 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(5) The quenching probe forms a double chain with the unbound signal probe, and the G quadruplex structure is damaged. To the system after the reaction in step (4), 8. mu.L of 20. mu.M quenching probe was added and the reaction was carried out at 55 ℃ for 30 min.

(6) Forming a heme/G quadruplex structure. To the system after the reaction in step (5), reagent 1 (heme) was added to a final concentration of 100nM and treated at 37 ℃ for 30 min.

(7) And (4) color reaction. To the reaction-terminated system of (6), reagent 3(ABTS) was added at a final concentration of 7mM, and reagent 4 (H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The results are shown in fig. 2, the experimental group added with the bacillus species genome shows a color reaction, and the experimental group added with the non-bacillus microorganism genome DNA and the blank control group do not show a color reaction, so that the specificity of the bacillus microorganism detected in the kit is proved.

Example 5: quantitative method accuracy assessment

Quantitative accuracy of Bacillus coagulans

(1) Bacillus coagulons bacterial liquid was obtained according to the culture method in example 4, the microbial concentration was measured by plate counting method, and the genome was extracted as in example 4.

(2) The Bacillus coagulons genomic DNA was diluted by a 10-fold gradient.

(3) Selecting a probe of Bacillus, and carrying out color reaction by using Bacillus coegulans genome DNA with different concentrations as a template. The sequence of the signal probe is GGGTGGGTGGGTGGGTAAAGCTGATTTGAAAGTCATTGGAGAT (SEQ ID NO.1), and the sequence of the quenching probe is TCTCCAATGACTTTCAAATCAGCTTTACCCA (SEQ ID NO. 2).

(4) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, final pH 7.9) was added 4. mu.L of genomic DNA at different dilutions (blank control without sample DNA). Treating with water bath at 90 deg.C for 10 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(6) Forming a heme/G quadruplex structure. To the system after the reaction in step (5), reagent 1 (heme) was added at a final concentration of 100nM and treated at 37 ℃ for 30 min.

(7) And (4) color reaction. To the reaction-terminated system of (6), reagent 3(ABTS) was added at a final concentration of 7mM, and reagent 4 (H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance at a wavelength of 420nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank.

(8) A standard curve is constructed by calculating the linear relationship between the absorbance and the concentration of the bacteria liquid, as shown in FIG. 3A, R²0.99 (unit of x is log)₁₀CFU/mL, y is in OD₄₂₀Linear range of 10³～10⁷). The accuracy of the quantitative method of the kit provided by the invention is proved.

Second, quantitative accuracy of Bacillus licheniformis

(1) Bacillus licheniformis bacterial solution was obtained according to the cultivation method in example 4, the microbial concentration was measured by plate counting method, and the genome was extracted as in example 4.

(2) The Bacillus licheniformis genomic DNA was diluted by a 10-fold gradient.

(3) The coloration reaction was carried out using a probe of Bacillus at various concentrations of Bacillus licheniformis genomic DNA. The sequence of the signal probe is GGGTGGGTGGGTGGGTAAAGCTGATTTGAAAGTCATTGGAGAT (SEQ ID NO.1), and the sequence of the quenching probe is TCTCCAATGACTTTCAAATCAGCTTTACCCA (SEQ ID NO. 2). (4) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, final pH 7.9) was added 4. mu.L of genomic DNA at different dilutions (blank control without sample DNA). Treating with water bath at 90 deg.C for 10 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(8) A standard curve is constructed by calculating the linear relationship between the absorbance and the concentration of the bacteria liquid, as shown in FIG. 3B, R²0.99 (unit of x is log)₁₀(CFU/mL), y is in OD₄₂₀Linear range of 10³～10⁷). The accuracy of the quantitative method of the kit provided by the invention is proved.

Example 6: quantitative test of Bacillus in yogurt sample

(1) Reference is made to Achilleos C, Berthier F.quantitative PCR for the specific quantification of Lactobacillus lactis and Lactobacillus paracasei and its inteest for Lactobacillus lactis in blood samples 2013; 36: 286-. The genome concentration was 205.89 ng/. mu.L.

(2) The chromogenic reaction was carried out using a probe of the genus Bacillus. The sequence of the signal probe is GGGTGGGTGGGTGGGTAAAGCTGATTTGAAAGTCATTGGAGAT (SEQ ID NO.1), and the sequence of the quenching probe is TCTCCAATGACTTTCAAATCAGCTTTACCCA (SEQ ID NO. 2).

(4) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, final pH 7.9) was added 4. mu.L of yogurt metagenomic DNA (blank control without sample DNA). Treating with water bath at 90 deg.C for 10 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(7) And (4) color reaction. To the reaction-terminated system of (6), reagent 3(ABTS) was added at a final concentration of 7mM and reagent 4(7mM H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance at a wavelength of 420nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0 as a blank control using the test group without the sample DNA.

(8) According to the standard curve obtained in example 5 (one), the total amount of microorganisms belonging to the genus Bacillus in the sample was calculated as 0log₁₀CFU/mL, calculated as 0log of the total amount of microorganisms of the genus Bacillus in the sample according to the standard curve obtained in example 5 (two)₁₀CFU/mL。

(9) The quantification of Bacillus bacteria in the same yogurt samples was carried out by the fluorometric method (the quantification procedure and materials were the same as in example 13(6)), and the presence of Bacillus bacteria was not detected and was substantially identical to the two sets of data measured by the method described above.

Example 7: absolute quantification of bacillus in fermented grain sample

(1) Reference is made to Song Z W, Du H, Zhang Y, Xu Y. innovative core functional microbiological in a catalytic solid-state compensation by high-throughput amplification and formatting strategies in microbiology 2017; 8:1294, extracting the metagenome from the fermented grain sample from Jingzhizhen, Shandong province, with the genome concentration of 120.06 ng/muL.

(3) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (containing Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH 7.9), 4. mu.L of fermented grain metagenomic DNA was added (blank control without sample DNA). Treating with water bath at 90 deg.C for 10 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(4) The quenching probe forms a double chain with the unbound signal probe, and the G quadruplex structure is damaged. To the system after the reaction in step (3), 8. mu.L of 20. mu.M quenching probe was added and the reaction was carried out at 55 ℃ for 30 min.

(5) Forming a heme/G quadruplex structure. To the system after the reaction in step (4), reagent 1 (heme) was added to a final concentration of 100nM, and treated at 37 ℃ for 30 min.

(6) And (4) color reaction. To the reaction-terminated system of (5), reagent 3(ABTS) was added at a final concentration of 7mM, and reagent 4 (H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance at a wavelength of 420nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0.425 as a blank control with the test group without sample DNA added.

(7) The total amount of Bacillus microorganisms in the sample was calculated to be 4.13log based on the standard curve obtained in example 5 (one)₁₀CFU/mL, calculated as 3.96log of the total amount of Bacillus microorganisms in the sample according to the standard curve obtained in example 5 (two)₁₀CFU/mL。

(8) The amount of Bacillus in the same fermented grain sample was determined by fluorometric method (the determination procedure and materials were the same as in example 13(6)), and the results showed that the total microbial amount of Bacillus was 4.06log₁₀CFU/mL was substantially identical to the two sets of data measured by the above method (coefficient of variation, CV ═ 0.02).

Example 8: absolute quantification of Bacillus in cheese samples

(1) Reference is made to Achilleos C, Berthier F.quantitative PCR for the specific quantification of Lactobacillus lactis and Lactobacillus paracasei and its inteest for Lactobacillus lactis in blood samples 2013; 36: 286-. The metagenome concentration was 20.18 ng/. mu.L.

(3) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (containing Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, final pH 7.9) was added 4. mu.L of cheese metagenomic DNA (blank control without sample DNA). Treating with water bath at 90 deg.C for 10 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(6) And (4) color reaction. To the reaction-terminated system of (5), reagent 3(ABTS) was added at a final concentration of 7mM and reagent 4(7mM H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance at a wavelength of 420nm was measured using an ultraviolet spectrophotometer, and the absorbance was 025 as shown by blank control with no sample DNA added.

(7) According to the standard curve obtained in example 5 (one), the total amount of Bacillus in the sample was calculated to be 2.38log₁₀CFU/mL, calculated as 2.26log total Bacillus in the sample based on the standard curve obtained in example 5 (two)₁₀CFU/mL。

(8) The quantification of Bacillus in the same cheese sample as described above was carried out by the fluorometric method (the procedure and materials were as in example 13(6)), and the results showed that the total amount of Bacillus was 2.23log₁₀CFU/mL, which substantially agrees with the two sets of data measured by the above method (coefficient of variation, CV 2.33%).

Example 9: bacillus absolute quantification method based on non-extraction of sample genome

Quantitative accuracy of Bacillus coagulans

(1) Bacillus coagulons bacterial solution was obtained according to the culture method in example 4, and the microbial concentration was measured by plate counting method.

(2) Diluting the Bacillus coagulons bacterial solution in the step (1) by 10 times of gradient

(3) The chromogenic reaction was carried out using a probe of the genus Bacillus. The sequence of the signal probe is GGGTGGGTGGGTGGGTAAAGCTGATTTGAAAGTCATTGGAGAT (SEQ ID NO.1), and the sequence of the quenching probe is TCTCCAATGACTTTCAAATCAGCTTTACCCA (SEQ ID NO. 2).

(4) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (containing 50mM Tris-HCl, 50mM KCl, and 7.9 final pH) was added 10. mu.L of each of the dilutions (blank samples without addition of the sample). Treating in boiling water bath for 20 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(8) A standard curve is constructed by calculating the linear relationship between the absorbance and the concentration of the bacteria liquid, as shown in FIG. 4A, R²0.99 (unit of x is log)₁₀CFU/mL, y is in OD₄₂₀Linear range of 10³～10⁷). The accuracy of the quantitative method of the kit provided by the invention is proved

Second, the quantitative accuracy of Bacillus velezensis

(1) Bacillus velezensis liquid was obtained according to the cultivation method in example 4, and the concentration of Bacillus was measured by plate counting method.

(2) Diluting the Bacillus velezensis bacterial liquid in the step (1) by 10-time gradient

(8) A standard curve is constructed by calculating the linear relationship between the absorbance and the concentration of the bacteria liquid, as shown in FIG. 4B, R²0.99 (unit of x is log)₁₀CFU/mL, y is in OD₄₂₀Linear range of 10³～10⁷). The accuracy of the quantitative method of the kit provided by the invention is proved.

Example 10: method for determining content of bacillus in yoghourt sample based on bacillus absolute quantification method without extracting sample genome

(1) The sample is yoghourt purchased from a local supermarket, and the sample processing method comprises the following steps: 5mL of phosphate buffer was added to 1mL of the sample, and the mixture was centrifuged at 3000 Xg for 10min to collect the cells.

(2) And (6) washing. 5mL of phosphate buffer was added to the cells obtained in (1), and the cells were collected by centrifugation at 12000 Xg for 2min and repeated once.

(3) Resuspend the cells, add 1mL of reagent 2 (containing 50mM Tris-HCl, 50mM KCl, final pH 7.9) to the cells obtained in (2), aspirate and mix well.

(4) The chromogenic reaction was carried out using a probe for Bacillus. The sequence of the signal probe is GGGTGGGTGGGTGGGTAAAGCTGATTTGAAAGTCATTGGAGAT (SEQ ID NO.1), and the sequence of the quenching probe is TCTCCAATGACTTTCAAATCAGCTTTACCCA (SEQ ID NO. 2).

(5) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (containing 50mM Tris-HCl, 50mM KCl, and 7.9 final pH), 10. mu.L of yogurt buffer solution (blank control without sample solution) was added. Treating in boiling water bath for 20 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(6) The quenching probe forms a double chain with the unbound signal probe, and the G quadruplex structure is damaged. To the system after the reaction in step (5), 8. mu.L of 20. mu.M quenching probe was added and the reaction was carried out at 55 ℃ for 30 min.

(7) Forming a heme/G quadruplex structure. To the system after the reaction in step (6), reagent 1 (heme) was added at a final concentration of 100nM and treated at 37 ℃ for 30 min.

(8) And (4) color reaction. To the reaction-terminated system of (7), reagent 3(ABTS) was added at a final concentration of 7mM, and reagent 4 (H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance at a wavelength of 420nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0 as a blank control using the test group without the sample DNA.

(9) According to the standard curve obtained in example 9 (one), the total amount of Bacillus microorganisms in the sample was calculated to be 0log₁₀CFU/mL, calculated as 0log of the total amount of Bacillus microorganisms in the sample according to the standard curve obtained in example 9 (II)₁₀CFU/mL。

(10) The quantification of Bacillus in the same yogurt samples was carried out by the fluorometric method (the quantification procedure and materials were as in example 13(6)), and the results showed that the total amount of Bacillus microorganisms was 0log₁₀CFU/mL, substantially identical to the two sets of data determined by the method described above: (Coefficient of variation, CV ═ 1.38%).

Example 11: bacillus content determination method for fermented grain sample based on bacillus absolute quantification method without sample genome extraction

(1) The sample is from fermented grains of a certain brewery of Shandong Jingzhizhen, and the sample treatment method comprises the following steps: 5mL of phosphate buffer was added to 1g of the sample, and the mixture was centrifuged at 3000 Xg for 10min to collect the cells.

(4) The chromogenic reaction was carried out using a probe of the genus Bacillus. The sequence of the signal probe is GGGTGGGTGGGTGGGTAAAGCTGATTTGAAAGTCATTGGAGAT (SEQ ID NO.1), and the sequence of the quenching probe is TCTCCAATGACTTTCAAATCAGCTTTACCCA (SEQ ID NO. 2).

(5) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (containing 50mM Tris-HCl, 50mM KCl, and 7.9 final pH), 10. mu.L of fermented grain suspension was added (blank control without addition of this suspension). Treating in boiling water bath for 20 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(8) And (4) color reaction. To the reaction-terminated system of (7), reagent 3(ABTS) was added at a final concentration of 7mM, and reagent 4 (H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance at a wavelength of 420nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0.422 as a blank control with the test group without sample DNA added.

(9) According to the standard curve obtained in example 9 (one), the total amount of Bacillus in the sample was calculated to be 3.95log₁₀CFU/mL, calculated as 3.79log of the total amount of Bacillus microorganisms in the sample according to the standard curve obtained in example 9 (II)₁₀CFU/mL。

(10) The amount of Bacillus in the same fermented grain sample was determined by fluorometric method (the same procedure and materials as in example 13 and 6), and the results showed that the total amount of Bacillus was 3.85log₁₀CFU/mL was substantially identical to the two sets of data measured by the above method (coefficient of variation, CV ═ 0.02).

Example 12: method for determining content of bacillus in cheese sample based on bacillus absolute quantification method without sample genome extraction

(1) The sample is cheese purchased in a local supermarket, and the sample processing method comprises the following steps: 5mL of phosphate buffer was added to 1g of the sample, and the mixture was centrifuged at 3000 Xg for 10min to collect the cells.

(5) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (containing 50mM Tris-HCl, 50mM KCl, and 7.9 final pH) was added 10. mu.L of cheese lysate (blank control without sample lysate). Treating in boiling water bath for 20 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(8) And (4) color reaction. To the reaction-terminated system of (7), reagent 3(ABTS) was added at a final concentration of 7mM, and reagent 4 (H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance at a wavelength of 420nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0.23 as a blank control with the test group without sample DNA added.

(9) Based on the standard curve obtained in example 9 (one), the total amount of Bacillus in the sample was calculated to be 2.10log₁₀CFU/mL, calculated as 1.98log total Bacillus in the sample based on the standard curve obtained in example 9 (two)₁₀ CFU/mL。

(10) The microorganism belonging to the genus Bacillus in the same cheese sample was quantified by the fluorometric method (the procedure and materials were as in example 13(6)), and the results showed that the total amount of the microorganism belonging to the genus Bacillus was 2.03log₁₀CFU/mL was substantially identical to the two sets of data measured by the above method (coefficient of variation, CV ═ 0.03).

Example 13: comparison of results of quantitative detection kit and fluorescent quantitative PCR (polymerase chain reaction) detection for microorganisms

(1) The samples are three samples of fermented grains of white spirit from the fermentation end point of a certain brewery of Shandong Jingzhi.

(2) Sample treatment:

(i) total genome concentrations of 369 ng/. mu.L, 321.89 ng/. mu.L and 590 ng/. mu.L were extracted from the three samples.

(ii) 5mL of phosphate buffer was added to 1g of the sample, and the mixture was centrifuged at 3000 Xg for 10min to collect the cells. To the obtained cells, 5mL of phosphate buffer was added, and the cells were collected by centrifugation at 12000 Xg for 2min and repeated once. Resuspend the cells, add 1mL of reagent 2 buffer to the obtained cells, aspirate and mix them well.

(4) The quantitative method is determined based on a kit without extracting genome.

(i) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (containing 50mM Tris-HCl, 50mM KCl, and 7.9 final pH), 10. mu.L of fermented grain suspension was added (blank control without addition of this suspension). Treating in boiling water bath for 20 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(ii) The quenching probe forms a double chain with the unbound signal probe, and the G quadruplex structure is damaged. To the system after the reaction in step (i), 8. mu.L of 20. mu.M quenching probe was added and the reaction was carried out at 55 ℃ for 30 min.

(iii) Forming a heme/G quadruplex structure. To the system after the reaction in step (ii), reagent 1 (heme) was added at a final concentration of 100mM, and the mixture was treated at 37 ℃ for 30 min.

(iv) And (4) color reaction. (iv) to the reaction-terminated system of (iii), reagent 3(ABTS) was added at a final concentration of 7mM, and reagent 4 (H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance at a wavelength of 420nm was measured using an ultraviolet spectrophotometer, and the blank was prepared from the test group without the sample DNA, and showed absorbance values of 0.43, 0.450, and 0.500.

(v) The total amount of Bacillus microorganisms in the sample was calculated to be 4.31. + -. 0.35log according to the standard curve obtained in example 9 (one)₁₀CFU/mL。

(5) Kit quantitative method determination based on genome extraction

(i) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (containing Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH 7.9), 4. mu.L of fermented grain metagenomic DNA was added (blank control without sample DNA). Treating with water bath at 90 deg.C for 10 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(iii) Forming a heme/G quadruplex structure. To the system after the reaction in step (ii), reagent 1 (heme) was added at a final concentration of 100nM and treated at 37 ℃ for 30 min.

(iv) And (4) color reaction. To the reaction-terminated system of (5), reagent 3(ABTS) was added at a final concentration of 7mM, and reagent 4 (H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance values at a wavelength of 420nm were measured using an ultraviolet spectrophotometer, and the blank with no sample DNA added showed absorbance values of 0.432, 0.456, 0.490.

(v) The total amount of Bacillus microorganisms in the sample was calculated to be 4.41. + -. 0.34log according to the standard curve obtained in example 5 (one)₁₀CFU/mL。

(6) qPCR quantitative sample bacillus microorganism content

(i) Bacillus velezensis bacterial liquid is obtained according to the culture method in the embodiment 4, the microbial concentration is determined by a plate counting method, and the genome is extracted as in the embodiment 4.

(ii) Bacillus velezensis genomic DNA was diluted by a 10-fold gradient.

(iii) The qPCR system was SYBR Green 10. mu.L, upstream and downstream primers 20. mu.M, template DNA 0.5. mu.L, and sterile water supplemented 20. mu.L.

(iv) Reaction procedure for qPCR: pre-denaturation 95 ℃ for 5min, cycle phase: 5s at 95 ℃ and 20s at 60 ℃; the number of cycles was 40, the dissolution curve was raised from 65 ℃ to 95 ℃ by 0.5 ℃ every 5 s.

(v) The extracted genome was subjected to qPCR using bacillus specific primers with a sequence downstream of the primer sequence of AAAGCTGATTTGAAAGTCATTGGAGAT (SEQ ID No.5) and a sequence downstream of GAGTGGCGAGCGTATCATAGTC (SEQ ID No. 6).

(vi) A standard curve of the CT value and the Bacillus velezensis bacterial concentration is established by diluting the genome DNA by 10-fold gradient, as shown in FIG. 4, R²＝0.99。

(vii) The qPCR system and reaction conditions were as in (iii), (iv). The concentration of the Bacillus microorganisms in the sample was calculated to be 4.45. + -. 0.46Lg (CFU/g) from the established standard curve based on the CT value at the end of the reaction.

(7) By significant difference analysis, the results are shown in FIG. 6, there is no significant difference between the three quantitative methods (P <0.05)

Example 14: detection limit for detection by using two different sequence signal probes

Quantification was performed using signal probes of different sequences, respectively.

(1) Bacillus velezensis bacterial liquid is obtained according to the culture method in the example 4, the microbial concentration is determined by a plate counting method, and the extraction of the genome with the concentration of 7.08log10 CFU/mL is the same as the example 4.

(2) The Bacillus velezensis genomic DNA was diluted by a 10-fold gradient to give a DNA template of 2.08log10 CFU/mL.

(3) The Bacillus signaling probe sequence was GGGTGGGTGGGTGGGTAAAGCTGATTTGAAAGTCATTGGAGAT (SEQ ID NO.1) and the quenching probe sequence was TCTCCAATGACTTTCAAATCAGCTTTACCCA (SEQ ID NO. 2). 2.08log10 CFU/mL Bacillus velezensis genomic DNA obtained in (2) was added to conduct a color development reaction.

(4) The Bacillus signaling probe sequence was GGGATTGGGATTGGGATTGGGAAAGCTGATTTGAAAGTCATTGGAGAT (SEQ ID NO.3) and the quenching probe sequence was ATCTCCAATGACTTTCAAATCAGCTTTCCCAA (SEQ ID NO. 4). 2.08log10 CFU/mL Bacillus velezensis genomic DNA obtained in (2) was added to conduct a color development reaction.

(5) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, final pH 7.9) was added 4. mu.L of Bacillus velezensis genomic DNA (blank control without sample DNA). Treating with water bath at 90 deg.C for 10 min. After adding 4. mu.L of each 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(6) The quenching probe forms a double chain with the unbound signal probe, and the G quadruplex structure is damaged. To the system after the reaction in step (5), 8. mu.L of 20. mu.M quenching probes were added, and the reaction was carried out at 55 ℃ for 30 min.

(8) And (4) color reaction. To the reaction-terminated system of (7), reagent 3(ABTS) was added at a final concentration of 7mM and the final concentration thereof, respectivelyReagent 4 (H) at 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance at a wavelength of 420nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank.

(9) Repeating the steps (5), (6), (7) and (8) for 9 times, comparing the stability of the detection result, and as shown in FIG. 7, the detection can be basically realized when the Coefficient of Variation (CV) of the quantitative result of the signal sequence based on SEQ ID NO.3 is 24.92%; the coefficient of variation of the quantitative result of the signal sequence based on SEQ ID NO.1 is 0.84%, and the detection effect is stable.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> absolute quantitative probe, method and kit of bacillus and application thereof

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 43

<212> DNA

<213> Artificial Synthesis

<400> 1

gggtgggtgg gtgggtaaag ctgatttgaa agtcattgga gat 43

<210> 2

<211> 32

<212> DNA

<213> Artificial Synthesis

<400> 2

atctccaatg actttcaaat cagctttacc ca 32

<210> 3

<211> 48

<212> DNA

<213> Artificial Synthesis

<400> 3

gggattggga ttgggattgg gaaagctgat ttgaaagtca ttggagat 48

<210> 4

<211> 32

<212> DNA

<213> Artificial Synthesis

<400> 4

atctccaatg actttcaaat cagctttccc aa 32

<210> 5

<211> 27

<212> DNA

<213> Artificial Synthesis

<400> 5

aaagctgatt tgaaagtcat tggagat 27

<210> 6

<211> 22

<212> DNA

<213> Artificial Synthesis

<400> 6

gagtggcgag cgtatcatag tc 22

Claims

1. A set of probes, comprising a signaling probe and a quenching probe; the signal probe sequence comprises a sequence shown in SEQ ID NO.1 or SEQ ID NO. 3; the quenching probe sequence comprises a sequence shown in SEQ ID NO.2 or SEQ ID NO. 4.

2. A detection kit comprising the signaling probe of claim 1 and a quenching probe.

3. The detection kit according to claim 2, further comprising any one or more of: heme, buffer solution, 2-azino-bis- (3-ethylbenzodihydropyrazoline-6-sulfonic acid) diammonium salt, and H₂O₂。

4. A method for quantifying a microorganism belonging to Bacillus, which comprises using the probe according to claim 1 or the detection kit according to any one of claims 2 to 3.

5. A quantification method according to claim 4, characterized in that the method comprises: melting DNA in a sample to be detected; adding an excessive signal probe, and combining with a target nucleotide fragment of a sample to be detected to form a double chain so that a G quadruplex is exposed outside a sequence; adding sufficient quenching probe to form double chains with the unbound signal probe, and destroying the G quadruplex structure; the G quadruplex with the naked leak outside reacts with the heme to form G quadruplex/heme mimic enzyme with catalase activity, and the biomass of the bacillus microorganism is represented by combining the activity of the catalase.

6. A quantification method according to claim 4, wherein the method is absolute quantification or relative quantification; optionally, when the method is absolute quantification, the method further comprises: establishing a standard curve of catalase activity or an index which is correlated with the catalase activity and the biomass of the bacillus microorganism; and when a sample to be detected is detected, substituting the detected catalase activity or indexes which are correlated with the catalase activity into the standard curve to obtain the biomass of the bacillus microorganism in the sample to be detected.

7. The method according to any one of claims 4 to 6, wherein the sample to be tested is a sample containing a cell, a genome, a metagenome, or the like; optionally, the sample is fermented food or a sample obtained in a fermentation process of fermented food, or an environmental sample such as intestinal tract, soil, water body and the like.

8. The method of claim 7, wherein the fermented food is any one or more of: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverages, alcoholic drinks, yoghourt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd and fermented rice and flour foods.

9. An agent according to any one of claims 2 to 3A method of using a cartridge, the method comprising: adding excessive signal probes into a sample to be detected after the DNA is unzipped, and reacting for a period of time to enable the signal probes to be combined with target fragments in the sample to be detected; then adding a sufficient amount of quenching probe to form a double strand with the unbound signaling probe; adding heme, reacting for a while, adding ABTS and H₂O₂And reacting for a period of time, detecting the light absorption value of the reactant, and quantifying the bacillus microorganism in the sample by combining the light absorption value.

10. A method of detecting the microbial content of bacillus in a fermented food product, an intestine, soil or a water body, comprising using the probe of claim 1, or the kit of claims 2-3; the fermented food is any one or more of the following:

white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverages, alcoholic drinks, yogurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd, fermented rice and flour foods and the like.