CN112782145B

CN112782145B - Aspergillus tubingensis absolute quantitative probe and application thereof

Info

Publication number: CN112782145B
Application number: CN202110163207.0A
Authority: CN
Inventors: 吴群; 徐岩; 杜如冰
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2021-02-05
Filing date: 2021-02-05
Publication date: 2022-04-29
Anticipated expiration: 2041-02-05
Also published as: CN112782145A

Abstract

The invention discloses an Aspergillus tubingensis absolute quantitative probe and application thereof, belonging to the fields of biology, fermentation and detection. The Aspergillus tubingensis quantitative probe and the kit can realize the total amount detection of Aspergillus tubingensis, do not need expensive instruments when used for detection and Aspergillus tubingensis quantification, and can quickly complete the quantification within 2.5 h. Meanwhile, the sample used in the present invention does not have to be subjected to nucleic acid extraction. The probe and the detection kit based on the invention are used for the quantification of Aspergillus tubingenises, and have the characteristics of rapidness, convenience, cheapness and accuracy.

Description

Aspergillus tubingensis absolute quantitative probe and application thereof

Technical Field

The invention relates to an Aspergillus tubingensis absolute quantitative probe and application thereof, belonging to the fields of biology, fermentation and detection.

Background

Aspergillus tubingenis is widely existed in traditional fermented food, and the biological reaction process involved in the fermentation process comprises white wine, Pu' er tea, etc. For example, in the process of white spirit fermentation, Aspergillus tubingensis can be metabolized to generate acid compounds to inhibit the growth of mixed bacteria, and meanwhile, various enzymes are secreted and have strong stress resistance. Therefore, the biomass of Aspergillus tubingensis needs to be tracked in real time, and the method has important guiding significance for judging the stability of fermentation batches and regulating and controlling fermentation parameters. However, most of the conventional fermented food systems are multi-strain co-fermentation systems, the content of Aspergillus tubinensis in a sample cannot be judged by a simple OD colorimetric method, and although the quantification of Aspergillus tubinensis in a mixed strain system can be realized by combining a fluorescent quantitative PCR method with a specific primer or probe, high-equipment and high-requirement operating environments are required. Therefore, in order to conveniently, rapidly and accurately track the growth variation trend of Aspergillus tubinensis in a sample, it is necessary to develop a corresponding Aspergillus tubinensis quantitative method and kit.

The principle of enzyme activity detection of the G quadruplex/heme analogue is that the G quadruplex can form DNA mimic enzyme with catalase activity with heme, can catalyze hydrogen peroxide to oxidize ABTS to generate ABTS +, presents green color development reaction, and can detect characteristic light absorption value under the wavelength of 420 nm. The stability of the structure of the G quadruplex is crucial to the whole detection process, if the design is not proper, when the G quadruplex sequence and other bases form a dimer, the G quadruplex sequence cannot form the G quadruplex, and a quantitative method based on the principle can underestimate the content of a target gene in a sample in use and reduce the sensitivity and the accuracy of the detection method.

At present, the principle of enzyme activity detection based on G quadruplex/heme simulation has been reported to be used for specific detection of microorganisms; for example, the documents WangY, Li X, Xi D, Wang X.visual detection of Fusarium proliferatum based on enzymmetric digestion polymerization and amplification and deletion/G-quadruplex DNAzyme. Rsc Advances 2019; 37144-37147. in the method, an asymmetric specific primer (an upstream primer is modified by adding a reverse sequence of a G quadruplex, and the downstream is not modified) is used, so that the method is only suitable for detecting the specific bacterium Fusarium proliferatum in a sample, and cannot realize the total amount detection of Aspergillus tubingensis; in the case of detection using the asymmetric specific primer, the upstream and downstream primers are added to the PCR system at different concentrations (the upstream primer concentration is low and the downstream primer concentration is high), a double-stranded product is formed by amplification using Recombinant Polymerase Amplification (RPA), the upstream primer is depleted as the PCR reaction proceeds, the downstream primer is amplified using newly synthesized double-stranded DNA as a template, and a single-stranded DNA having a G quadruplex end is formed, and fusarium proliferatum in a detection sample is detected using a G quadruplex/heme mimic enzyme activity. However, this quantitative method still requires a PCR step to generate G quadruplexes, and the PCR process still requires high-volume PCR equipment and a strict operating environment.

Disclosure of Invention

The invention relates to a probe, a kit and application for absolute quantification of Aspergillus tubingensis, which solve at least one technical problem as follows: (1) the existing method can not realize the total amount detection of all Aspergillus tubingensis; (2) the existing quantitative method has low species resolution and/or insufficient detection accuracy; (3) the existing quantitative method needs high-volume instruments and equipment and/or strict operation environment, and is not suitable for timely detection after production sampling; (4) the existing quantitative method has complicated operation and the like.

The first purpose of the invention is to provide a group of probes, which comprise a signaling probe and a quenching probe; the sequence of the signal probe is shown as SEQ ID NO.1 (GGGTGGGTGGGTGGGTGTCCGATCCTCGAGCGTATG).

In one embodiment, the quenching probe has the sequence shown in SEQ ID NO.2 (CATACGCTCGAGGATCGGACACCCA).

It is a second object of the present invention to provide a method for the quantification of Aspergillus tubingensis, said method comprising the use of a probe of the present invention.

The method comprises the following steps: melting DNA in a sample to be detected; adding excessive signal probe (sequence shown as SEQ ID NO.1), and combining with target nucleotide fragment of the sample to be detected to form double chains, so that the G quadruplex is exposed outside the sequence; adding sufficient quenching probe (with sequence shown as SEQ ID NO.2) to form double chains with the unbound signal probe, and destroying the structure of the G quadruplex; the biomass of Aspergillus tubingenis was characterized by the naked-leak in the outer G quadruplex reacting with heme to form a G quadruplex/heme mimic enzyme with catalase activity in combination with catalase activity.

In one embodiment, the method is an absolute quantitative method, further comprising: establishing a standard curve of catalase activity (or an index which is correlated with catalase activity, such as an absorbance value of a solution at a wavelength of 420nm after ABTS + is generated by catalyzing hydrogen peroxide oxidation ABTS) and biomass of Aspergillus tubingensis; when detecting the sample to be detected, the detected catalase activity is substituted into the standard curve, and the biomass of Aspergillus tubingensis in the sample to be detected is obtained.

In one embodiment, the method is a relative quantification method, further comprising: a plurality of samples were tested and the relative amount of Aspergillus tubingensis biomass in the plurality of different samples was determined from the relative amount of catalase activity measured in the different samples.

In one embodiment, the sample to be tested is a sample containing bacteria, genome, metagenome, or the like. Optionally, the sample to be detected is a finished fermented food product or a sample obtained in a fermentation process of fermented food; optionally, the sample to be tested is subjected to pretreatment such as centrifugation and collection of bacteria, and then subsequent measurement is performed. Preferably, the cells in the sample are collected and subjected to DNA melting directly without genome extraction.

In one embodiment, the sample is a fermented food product or a sample taken from a fermentation process of a fermented food product or an environmental sample.

In one embodiment, the fermented food is any one or more of: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverages, alcoholic drinks, yogurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd, fermented rice and flour foods and the like; the environmental sample is selected from intestinal tract, soil, water body and the like.

In one embodiment, the melting of the DNA in the sample to be tested is performed at a high temperature. Optionally, the sample to be tested is treated at a temperature above 90 ℃. Can be any one of metal bath, water bath, oven, heat preservation instrument and the like which can provide the environment with corresponding temperature.

In one embodiment, the melting is performed in a buffer. Optionally, the buffer solution can be Tris-HCl buffer solution, and also contains KCl and NH₄Any one or more of Cl and NaCl. Optionally, the buffer is Tris-HCl, KCl, pH 7.9.

In one embodiment, the excess is an amount that is greater than the amount of signaling probe required to form a duplex with all of the target nucleotide fragments of the sample to be tested. The specific amount can be determined by one skilled in the art by combining with common knowledge in the art or a specific sample to be tested, or by pre-experiment.

In one embodiment, the excess is in excess of 10¹⁰Copies of the signal probe.

In one embodiment, the binding of the signaling probe to the target nucleotide fragment of the sample to be tested to form a duplex is performed at a temperature in the range of 50-60 ℃.

In one embodiment, the sufficient amount is an amount of quenching probe that is required to form a double strand with all unbound signaling probes. The specific amount can be determined by one skilled in the art by combining with common knowledge in the art or by a specific sample to be tested, or by preliminary experiments.

In one embodiment, the sufficient amount is a double amount of signaling probe.

In one embodiment, the addition of a sufficient amount of quenching probe to form a duplex with the unbound signaling probe is at a temperature such that the quenching probe forms a duplex with the unbound signaling probe; one skilled in the art can determine or determine the specific sample to be tested in combination with common knowledge in the art.

In one embodiment, the step of reacting the naked-leak-outside G quadruplex with heme to form a G quadruplex/heme mimic enzyme having catalase activity, and the step of characterizing the biomass of Aspergillus tubingene in combination with the catalase activity, is to add ABTS and H after the heme reaction is added to the system₂O₂The catalase activity was then characterized by the absorbance of the reaction.

In one embodiment, the absorbance is at a wavelength of 420 nm.

In one embodiment, the quantification method is, in particular:

(1) carrying out DNA unzipping treatment on a sample to be detected;

(2) adding a signal probe, and reacting at 55 ℃ for 30 min;

(3) adding a quenching probe, and reacting at 55 ℃ for 30 min;

(4) adding heme, and reacting at 37 deg.C for 30 min;

(5) adding 2, 2-azino-bis- (3-ethylbenzodihydropyrazoline-6-sulfonic acid) diammonium salt (ABTS) and H₂O₂Reacting at 37 ℃ for 30 min;

(6) detecting the light absorption value of the reactant at the wavelength of 420 nm;

(7) the Aspergillus tubingensis in the sample is quantified in combination with the absorbance.

In one embodiment, the quantification method further comprises: preparing samples with different known Aspergillus tubingensis contents, and measuring light absorption values of the different samples after treatment by the method; drawing a standard curve of the light absorption value and different Aspergillus tubingensis contents; substituting the light absorption value obtained by processing the sample to be detected by the method into the standard curve to obtain the Aspergillus tubingensis content in the sample to be detected.

The third purpose of the invention is to provide a detection kit for absolute quantification of Aspergillus tubingensis, which contains a signal probe with the sequence shown as SEQ ID NO. 1.

In one embodiment, the detection kit further comprises a quenching probe with a sequence shown in SEQ ID NO. 2.

In one embodiment, the test kit further comprises any one or more of: heme, buffer solution, 2-azino-bis- (3-ethylbenzodihydropyrazoline-6-sulfonic acid) diammonium salt (ABTS), and H₂O₂. These reagents may not be contained, and an operator may prepare the reagent kit separately when the reagent kit is used.

In one embodiment, in the detection kit, the buffer solution can be Tris-HCl buffer solution, and also contains KCl and NH₄Any one or more of Cl and NaCl. Optionally, the buffer is Tris-HCl, KCl, pH 7.9.

In one embodiment, the test kit is an Aspergillus tubingensis absolute quantification kit comprising simultaneously four reagents (reagent 1, reagent 2, reagent 3, reagent 4) and a set of Aspergillus tubingensis quantification probes (signaling probe, quenching probe); the reagent 1 comprises heme; the reagent 2 comprises a buffer solution (Tris-HCl, KCl, pH 7.9; wherein KCl can be replaced by NH)₄Cl, NaCl); the reagent 3 comprises 2, 2-azino-bis- (3-ethylbenzodihydropyrazoline-6-sulfonic acid) diammonium salt (ABTS); the reagent 4 comprises H₂O₂。

In one embodiment, the reagent or probe in the test kit may be in a liquid state or a solid state, and may be adjusted to a suitable concentration by those skilled in the art in use.

The fourth purpose of the invention is to provide a using method of the kit.

In one embodiment, the method of use comprises: adding excessive signal probes into a sample to be detected after the DNA is unzipped, and reacting for a period of time to enable the signal probes to be combined with target fragments in the sample to be detected; then adding a sufficient amount of quenching probe to form a double strand with the unbound signaling probe; adding heme, reacting for a while, adding ABTS and H₂O₂And reacting for a period of time, detecting the absorbance of the reactant, and quantifying the Aspergillus tubingensis in the sample by combining the absorbance.

In one embodiment, the method comprises adjusting the reagents and probes to concentrations suitable for use.

(1) Carrying out DNA unzipping treatment on a sample to be detected; (2) adding a signal probe, and reacting at 55 ℃ for 30 min; (3) adding a quenching probe, and reacting at 55 ℃ for 30 min; (4) adding heme, and reacting at 37 deg.C for 30 min; (5) adding 2, 2-azino-bis- (3-ethylbenzodihydropyrazoline-6-sulfonic acid) diammonium salt (ABTS) and H₂O₂Reacting at 37 ℃ for 30 min; (6) detecting the light absorption value of the reactant at the wavelength of 420 nm; (7) the Aspergillus tubingensis in the sample is quantified in combination with the absorbance.

A fifth object of the invention is to provide the use of said kit for the quantification of Aspergillus tubingensis.

In one embodiment, the use is in the technical or environmental field of fermented food; optionally, the fermented food is any one or more of the following: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverages, alcoholic drinks, yogurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd, fermented rice and flour foods and the like; the environmental sample is selected from intestinal tract, soil, water body, etc.

In one embodiment, the sample to be tested may be a sample containing bacteria, genome, metagenome, or the like. Optionally, the sample to be detected is a finished fermented food product or a sample obtained in a fermented food fermentation process or an environmental sample; optionally, the sample to be tested is subjected to pretreatment such as centrifugation and collection of bacteria, and then subsequent measurement is performed. Preferably, the cells in the sample are collected and subjected to DNA melting directly without genome extraction.

Has the advantages that:

the invention combines the G quadruplex with a specific sequence to form a signal probe, the signal probe is combined with a target sequence to ensure that the G quadruplex is barely leaked outside the sequence, a sufficient amount of quenching probe is added to form a double chain with an unreacted signal probe, the structure of the G quadruplex is damaged, a G quadruplex/heme mimic enzyme is formed by reaction with heme, catalase activity is shown, and the biomass of microorganisms is represented by the catalase activity. The Aspergillus tubingensis quantitative probe can realize the total amount detection of Aspergillus tubingensis; further, the signaling probe was optimized with the sequence of the signaling probe GGGTGGGTGGGTGGGTGTCCGATCCTCGAGCGTATG (SEQ ID NO.1) and the quenching probe CATACGCTCGAGGATCGGACACCCA (SEQ ID NO. 2). Compared with the signal sequence of SEQ ID NO.3, the G quadruplex sequence in the signal probe of SEQ ID NO.1 does not generate an additional spatial structure with a specific sequence (FIG. 1), the detection accuracy is higher, and the minimum detection limit is improved.

The probe of the invention does not require expensive instrumentation for detection and quantitation of Aspergillus tubingensis. The kit for absolutely quantifying the microorganisms is also provided for the first time, and the quantification work can be completed within 2.5 hours. The invention aims to avoid using high-cost equipment such as a PCR instrument and realize the quantification of microorganisms by combining a signal probe and a quenching probe. The invention solves the problem that the prior microorganism quantitative means all depend on expensive instruments and are very limited in the practical application process.

Furthermore, the invention can realize rapid detection of Aspergillus tubingensis, and the sample does not need to be subjected to nucleic acid extraction, and only needs to elute the microorganism in the sample into the buffer solution for directly carrying out subsequent experiments. Meanwhile, compared with the fluorescent quantitative PCR quantitative result, the quantitative result obtained by the method has no significant difference.

In conclusion, the probe and the detection kit provided by the invention are used for the quantification of Aspergillus tubingensis, and have the characteristics of rapidness, cheapness and accuracy.

Drawings

FIG. 1: a dimeric structure of a signaling probe. (A) The G quadruplex sequence of SEQ ID No.1 does not form a loop with the specific sequence; (B) the reported G quadruplex sequence of SEQ ID NO.3 is used for microbial quantification.

FIG. 2: specificity of Aspergillus tubingenis probes.

FIG. 3: a standard curve of the Aspergillus tubingensis quantitative probe based on genome extraction.

FIG. 4: standard curves based on Aspergillus tubingensis quantitative probes without sample genome extraction.

FIG. 5: qPCR standard curve.

FIG. 6: comparing an Aspergillus tubingene probe quantification assay based on genome extraction, an Aspergillus tubingene probe quantification assay based on non-extracted sample genome and a qPCRASpergillus tubingene quantification assay; wherein, (A) is based on the Aspergillus tubingensis probe quantitative experiment of not extracting the sample genome, (B) is based on the Aspergillus tubingensis probe quantitative experiment of extracting the genome, (C) qPCRASPERGILLUS tubingensis quantitative experiment.

FIG. 7: the stability of the results of the detection based on the probe (A) of SEQ ID NO.1/SEQ ID NO.2 and the probe (B) of SEQ ID NO.3/SEQ ID NO.4 is compared.

The specific implementation mode is as follows:

example 1: aspergillus tubingenis quantitative probe combined reagent

A probe combination reagent; comprises a signaling probe reagent and a quenching probe reagent which are packaged separately; wherein, the sequence of the signal probe is shown as SEQ ID NO.1, and the sequence of the quenching probe is shown as SEQ ID NO. 2.

The signal probe reagent and the quenching probe reagent are in a dry powder or liquid state; in the case of dry powder, it may be diluted to an appropriate concentration prior to the experiment, for example, to a concentration of 20. mu.M using sterile water or buffer; in the case of liquid, the concentration may be 20 to 200. mu.M, and the reagent may be diluted before use or may be used as it is.

Example 2: aspergillus tubingensis quantitative kit and use thereof

An Aspergillus tubingensis quantification kit comprising separately packaged signaling probe reagent and quenching probe reagent; wherein, the sequence of the signal probe is shown as SEQ ID NO.1, and the sequence of the quenching probe is shown as SEQ ID NO. 2.

When the kit is used, the kit can be mixed with heme, buffer solution, 2-azino-bis- (3-ethylbenzodihydro-thiazoline-6-sulfonic acid) diammonium salt (ABTS), and H₂O₂Can be used in combination.

The using method comprises the following steps:

(1) and (4) solution preparation. Prepare 100nM heme solution (reagent 1); Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and a final pH of 7.9 (reagent 2); 7mM of 2, 2-azino-bis- (3-ethylbenzodithiazoline-6-sulfonic acid) diammonium salt (ABTS) (reagent 3) and 7mM of H₂O₂Solution (reagent 4); the solvent is sterile water.

(2) The signal probe forms a double strand with the sample DNA. To 2mL of

reagent

2, 4. mu.L of the sample genomic DNA was added, and the mixture was treated with a water bath at 90 ℃ for 10 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(3) The quenching probe forms a double strand with the unbound signaling probe. The quenching probe forms a double chain with the unbound signal probe, and the G quadruplex structure is damaged. To the system after the reaction in step (4), 8. mu.L of 20. mu.M quenching probe was added and the reaction was carried out at 55 ℃ for 30 min.

(4) Forming a heme/G quadruplex structure. To the system after the reaction in step (5), a reagent 1 was added to a final concentration of 100nM and treated at 37 ℃ for 30 min.

(5) And (4) color reaction. To the reaction-terminated system of (4), a reagent (ABTS) having a final concentration of 7mM and a reagent 4 having a final concentration of 7mM were added, and the mixture was treated at 37 ℃ for 30min to effect a revealing reaction (green).

Detecting the light absorption value of the reactant at the wavelength of 420 nm; the Aspergillus tubingensis in the sample is quantified in combination with the absorbance.

Of course, in absolute quantification, a standard curve of absorbance versus Aspergillus tubingensis biomass may be drawn by itself, or directly converted to Aspergillus tubingensis biomass according to the recommended method of use of the kit and the standard curve.

Example 3: aspergillus tubingenis quantitative kit

The kit further comprises 100nM heme solution (reagent 1), Tris-HCl buffer, 7mM 2, 2-azino-bis- (3-ethylbenzodihydrophthaloline-6-sulfonic acid) diammonium salt (ABTS), and 7mM H₂O₂And (3) solution.

Example 4: specificity of the Aspergillus tubingensis quantitation kit

(1) Aspergillus tubinensis derived from fermented cereals was selected as a positive control, 36 microorganisms of bacterial species and 6 microorganisms of fungal species widely present in fermented food samples were selected as negative controls, and the bacterial microorganisms were Lactobacillus buchneri, Lactobacillus diovorans, Lactobacillus brevis, Lactobacillus crusorus, Lactobacillus plantarum, Lactobacillus harbinensis, Lactobacillus acicularis, Pediococcus acidilactici, Pediococcus pectobacterium, Lactobacillus murinus, Lactobacillus curvatus, Lactobacillus casei, Lactobacillus reuteri, Lactobacillus reticulatus, Lactobacillus bucillus, Lactobacillus acidophilus, Lactobacillus lactis, Lactobacillus acidophilus, Bacillus lactis, Bacillus faecalis, Bacillus subtilis, Lactobacillus strain, Bacillus lactis, Bacillus subtilis, Bacillus mucilaginosus, Bacillus strain, Bacillus strain, Bacillus strain, Bacillus strain, Bacillus strain, Bacillus strain, Bacillus strain, Bacillus strain, strain. The fungal microorganisms are Saccharomyces cerevisiae, Mucor rouxianus, Schizosaccharomyces pombe, Zygosaccharomyces bailii, Pichia kudriavzevii, Saccharomyces fibuligera, respectively.

(2) The above microorganisms were cultured by selecting different media, wherein Lactobacillus buchneri, Lactobacillus dioillorans, Lactobacillus brevis, Lactobacillus crustorum, Lactobacillus plantarum, Lactobacillus harbinensis, Lactobacillus acidophilus, Pediococcus ethanolidus, Pediococcus acicillus, Pediococcus sporogenes, Lactobacillus murinus, Lactobacillus curvatus, Lactobacillus casei, Lactobacillus reuteri, Lactobacillus paniculatus, Lactobacillus fermentum, Lactobacillus plantarum, Lactobacillus johnsonii, Lactobacillus eckii, Lactobacillus plantarum, Lactobacillus acidophilus, Lactobacillus strain MRS, Lactobacillus acidophilus, Bacillus mucilage, Lactobacillus acidophilus, Lactobacillus strain L8₂HPO₄2.5 g/L, 6.0g/L of sodium acetate trihydrate, 2.0g/L of ammonium citrate tribasic, MgSO₄·7H₂O 0.3g/L，MnSO₄·4H₂O is 0.08 g/L. The culture conditions were 30 ℃ for 48 h. Enterococcus italicus, Enterococcus lactis, Enterococcus faecis, Bacillus coagulons, Bacillus licheniformis, Bacillus tequilensis, Bacillus subtilis, Bacillus velezensis, Acetobacter passaturinus, and Enterococcus faecium use LB culture medium, the culture medium formula is 10.0g/L of peptone, 5g/L of yeast powder, and 10g/L of sodium chloride. The culture conditions were 37 ℃ for 24 h. Aspergillus tubinensis, Mucor rouxianus, Schizosaccharomyces pombe, Zygosaccharomyces bailii, Pichia kudriavzevii, Saccharomyces fibuligera, Saccharomyces cerevisiae, YPD medium was used, and yeast extract was 10g/L, peptone was 20g/L, and glucose was 20 g/L. The culture conditions were: the mold is cultured for 5 days at 30 ℃, and the yeast is cultured for 2 days at 30 ℃.

(3) Extracting the genome of a single bacterium. The bacterial liquid is treated for 2min under the condition of 12000rpm, and precipitates are collected. The genomes of the pure cultures of 43 microorganisms were extracted using the DNeasy Tissue Kit.

(4) The probe was selected as Aspergillus tubingensis specific probe, the sequence of the signaling probe was GGGTGGGTGGGTGGGTGTCCGATCCTCGAGCGTATG (SEQ ID NO.1), and the sequence of the quenching probe was CATACGCTCGAGGATCGGACACCCA (SEQ ID NO. 2).

(4) The signal probe forms a double strand with the sample DNA. To 2mL of each of the reagents 2 (including Tris-HCl of 50mM final concentration, KCl of 50mM final concentration, final pH 7.9) was added 4. mu.L of genomic DNA of different microorganisms, and treated in a water bath at 90 ℃ for 10 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(5) The quenching probe forms a double chain with the unbound signal probe, and the G quadruplex structure is damaged. To the system after the reaction in step (4), 8. mu.L of 20. mu.M quenching probe was added and the reaction was carried out at 55 ℃ for 30 min.

(6) Forming a heme/G quadruplex structure. To the system after the reaction in step (5), reagent 1 (heme) was added to a final concentration of 100nM and treated at 37 ℃ for 30 min.

(7) And (4) color reaction. To the reaction-terminated system of (6), reagent 3(ABTS) was added at a final concentration of 7mM, and reagent 4 (H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. As shown in FIG. 2, the test group to which the Aspergillus tubingenis genome was added showed a color reaction, and the test group to which the non-Aspergillus tubingenis genome was added and the blank control group showed no color reaction, which confirmed that the specificity of the Aspergillus tubingenis was detected in the kit.

Example 5: quantitative method accuracy assessment

(1) Aspergillus tubingensis culture solution was obtained according to the culture method of example 4, the concentration of microorganisms was measured by plate counting method, and the genome was extracted as in example 4.

(2) Aspergillus tubingensis genomic DNA was diluted by a 10-fold gradient.

(3) The chromogenic reaction was performed with different concentrations of Aspergillus tubingensis genomic DNA using the probe of Aspergillus tubingensis. The sequence of the signaling probe is GGGTGGGTGGGTGGGTGTCCGATCCTCGAGCGTATG (SEQ ID NO.1), and the sequence of the quenching probe is CATACGCTCGAGGATCGGACACCCA (SEQ ID NO. 2).

(4) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, final pH 7.9) was added 4. mu.L of genomic DNA at different dilutions (blank control without sample DNA). Treating with water bath at 90 deg.C for 10 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(6) Forming a heme/G quadruplex structure. To the system after the reaction in step (5), reagent 1 (heme) was added at a final concentration of 100nM and treated at 37 ℃ for 30 min.

(7) And (4) color reaction. To the reaction-terminated system of (6), reagent 3(ABTS) was added at a final concentration of 7mM, and reagent 4 (H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance at a wavelength of 420nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank.

(8) A standard curve is constructed by calculating the linear relationship between the absorbance and the concentration of the bacteria liquid, as shown in FIG. 3, R²0.99(x is log10 CFU/mL, y is OD₄₂₀Linear range of 10³～10⁷). The accuracy of the quantitative method of the kit provided by the invention is proved.

Example 6: quantification of Aspergillus tubingensis in wine samples

(1) Reference is made to the Materials and methods of Gayevshiy, V., & Goddard, M. (2012), GeogrAN _ SNhic deletions of yeast communities and publications associated with the videos and with the in New Zealand ISME J,6(7),1281 and 1290, samples were collected from a known wine manufacturer at the Shandong tobacco station. The genome concentration was 658.39 ng/. mu.L. (2) The chromogenic reaction was carried out using the probe of Aspergillus tubingensis. The sequence of the signaling probe is GGGTGGGTGGGTGGGTGTCCGATCCTCGAGCGTATG (SEQ ID NO.1), and the sequence of the quenching probe is CATACGCTCGAGGATCGGACACCCA (SEQ ID NO. 2).

(4) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, final pH 7.9) was added 4. mu.L of sample metagenomic DNA (blank control without sample DNA). Treating with water bath at 90 deg.C for 10 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(7) And (4) color reaction. To the reaction-terminated system of (6), reagent 3(ABTS) was added at a final concentration of 7mM and reagent 4(7mM H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance at a wavelength of 420nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0 as a blank control using the test group without the sample DNA.

(8) According to the standard curve obtained in example 5, the total amount of Aspergillus tubingensis in the sample was calculated to be 0log₁₀CFU/mL。

(9) The amount of Aspergillus tubingene in the same sample was quantified by fluorescent quantitative PCR (the same procedure and materials as in example 11 and 6), and the total amount of Aspergillus tubingene was found to be 0log₁₀CFU/mL, consistent with the quantitative results determined by the methods described above.

Example 7: absolute quantification of Aspergillus tubingensis in fermented grain samples

(1) Reference is made to SongZW, DuH, Zhang Y, XuY. innovative core functional-state implementation by high-through pustupalindrons and microorganisms informatics sequencing. frontiologies 2017; 1294, extracting metagenome from fermented grains samples from Shandong province, wherein the genome concentration is 100.02 ng/mu L.

(2) A color reaction was performed using a probe of Aspergillus ubningensis. The sequence of the signaling probe is GGGTGGGTGGGTGGGTGTCCGATCCTCGAGCGTATG (SEQ ID NO.1), and the sequence of the quenching probe is CATACGCTCGAGGATCGGACACCCA (SEQ ID NO. 2).

(3) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (containing Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH 7.9), 4. mu.L of fermented grain metagenomic DNA was added (blank control without sample DNA). Treating with water bath at 90 deg.C for 10 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(4) The quenching probe forms a double chain with the unbound signal probe, and the G quadruplex structure is damaged. To the system after the reaction in step (3), 8. mu.L of 20. mu.M quenching probe was added and the reaction was carried out at 55 ℃ for 30 min.

(5) Forming a heme/G quadruplex structure. To the system after the reaction in step (4), reagent 1 (heme) was added to a final concentration of 100nM, and treated at 37 ℃ for 30 min.

(6) And (4) color reaction. To the reaction-terminated system of (5), reagent 3(ABTS) was added at a final concentration of 7mM, and reagent 4 (H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance at a wavelength of 420nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0.402 as a blank control with the test group without sample DNA added.

(7) The total amount of Aspergillus tubingensis microorganisms in the sample was calculated to be 5.44log according to the standard curve obtained in example 2₁₀CFU/mL。

(8) The amount of Aspergillus tubingene in the same fermented grain sample was quantified by the fluorometric method (the procedure and materials were the same as in example 11 and 6), and the results showed that the total microbial amount of Aspergillus tubingene was 5.42log₁₀CFU/mL substantially matches the quantitative results measured by the above-described method (coefficient of variation, CV ═ 0.002).

Example 8: aspergillus tubingensis absolute quantification method based on non-extracted sample genome

(1) Aspergillus tubingensis culture solution was obtained according to the culture method in example 4, and the microbial concentration was measured by plate counting method.

(2) The Aspergillus tubingensis solution of (1) was diluted by a 10-fold gradient

(3) The chromogenic reaction was carried out using the probe of Aspergillus tubingensis. The sequence of the signaling probe is GGGTGGGTGGGTGGGTGTCCGATCCTCGAGCGTATG (SEQ ID NO.1), and the sequence of the quenching probe is CATACGCTCGAGGATCGGACACCCA (SEQ ID NO. 2).

(4) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (containing 50mM Tris-HCl, 50mM KCl, and 7.9 final pH) was added 10. mu.L of each of the dilutions (blank samples without addition of the sample). Treating in boiling water bath for 20 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(8) A standard curve is constructed by calculating the linear relationship between the absorbance and the concentration of the bacteria liquid, as shown in FIG. 4, R²0.99(x is log10 CFU/mL, y is OD₄₂₀Linear range of 10³～10⁷). The accuracy of the quantitative method of the kit provided by the invention is proved

Example 9: method for determining content of Aspergillus tubingensis in wine sample based on absolute quantification method of microorganism without extracting sample genome

(1) The sample is collected from a certain famous grape wine manufacturer of Shandong tobacco Taiwan, and the sample treatment method comprises the following steps: 5mL of phosphate buffer was added to 1mL of the sample, and the mixture was centrifuged at 3000 Xg for 10min to collect the cells.

(2) And (6) washing. 5mL of phosphate buffer was added to the cells obtained in (1), and the cells were collected by centrifugation at 12000 Xg for 2min and repeated once.

(3) Resuspend the cells, add 1mL of reagent 2 (containing 50mM Tris-HCl, 50mM KCl, final pH 7.9) to the cells obtained in (2), aspirate and mix well.

(4) The chromogenic reaction was carried out using the probe of Aspergillus tubingensis. The sequence of the signal probe is GGGTGGGTGGGTGGGTGTCCGATCCTCGAGCGTATG (SEQ ID NO.1), and the sequence of the quenching probe is CATACGCTCGAGGATCGGACACCCA (SEQ ID NO. 2).

(5) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (containing 50mM Tris-HCl, 50mM KCl, and 7.9 final pH), 10. mu.L of the fermented grape liquid (blank control without addition of this liquid) was added. Treating in boiling water bath for 20 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(6) The quenching probe forms a double chain with the unbound signal probe, and the G quadruplex structure is damaged. To the system after the reaction in step (5), 8. mu.L of 20. mu.M quenching probe was added and the reaction was carried out at 55 ℃ for 30 min.

(7) Forming a heme/G quadruplex structure. To the system after the reaction in step (6), reagent 1 (heme) was added at a final concentration of 100nM and treated at 37 ℃ for 30 min.

(8) And (4) color reaction. To the reaction-terminated system of (7), reagent 3(ABTS) was added at a final concentration of 7mM, and reagent 4 (H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance at a wavelength of 420nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0 as a blank control using the test group without the sample DNA.

(9) According to the standard curve obtained in example 8, the total amount of Aspergillus ubningensis in the sample was calculated to be 0log₁₀CFU/mL。

(10) The amount of Aspergillus tubingensis in the same sample was quantified by fluorescent quantitative PCR (the procedure and materials were as in example 11(6)), and the results showed that the total amount of Aspergillus tubingensis was 0log₁₀CFU/mL, consistent with the quantitative results determined by the methods described above.

Example 10: method for determining content of Aspergillus tubingensis in fermented grain sample based on absolute quantification method without extracting sample genome

(1) The sample is from fermented grains of a certain brewery in Shandong, and the sample treatment method comprises the following steps: 5mL of phosphate buffer was added to 1g of the sample, and the mixture was centrifuged at 3000 Xg for 10min to collect the cells.

(4) A color reaction was performed using a probe of Aspergillus ubningensis. The sequence of the signaling probe is GGGTGGGTGGGTGGGTGTCCGATCCTCGAGCGTATG (SEQ ID NO.1), and the sequence of the quenching probe is CATACGCTCGAGGATCGGACACCCA (SEQ ID NO. 2).

(5) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (containing 50mM Tris-HCl, 50mM KCl, and 7.9 final pH), 10. mu.L of fermented grain suspension was added (blank control without addition of this suspension). Treating in boiling water bath for 20 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(8) And (4) color reaction. To the reaction-terminated system of (7), reagent 3(ABTS) was added at a final concentration of 7mM, and reagent 4 (H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance at a wavelength of 420nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0.412 as a blank control with the test group without sample DNA added.

(9) According to the standard curve obtained in example 8, the total amount of Aspergillus tubingensis in the sample was calculated to be 5.41log₁₀CFU/mL，

(10) The amount of Aspergillus tubingensis in the same sample was quantified by fluorescent quantitative PCR (the procedure and materials were as in example 11(6)), and the results showed that the total amount of Aspergillus tubingensis was 5.42log₁₀CFU/mL was substantially identical to the two sets of data measured by the above method (coefficient of variation, CV ═ 0.002).

Example 11: comparison of results of quantitative detection kit and fluorescent quantitative PCR (polymerase chain reaction) detection for microorganisms

(1) The sample is three fermented white spirit samples from the fermentation end point of a certain brewery in Shandong.

(2) Sample treatment:

(i) total genome concentrations of 369 ng/. mu.L, 590 ng/. mu.L and 321.89 ng/. mu.L were extracted from the three samples.

(ii) 5mL of phosphate buffer was added to 1g of the sample, and the mixture was centrifuged at 3000 Xg for 10min to collect the cells. To the obtained cells, 5mL of phosphate buffer was added, and the cells were collected by centrifugation at 12000 Xg for 2min and repeated once. Resuspend the cells, add 1mL of reagent 2 buffer to the obtained cells, aspirate and mix them well.

(4) The quantitative method is determined based on a kit without extracting genome.

(i) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (containing 50mM Tris-HCl, 50mM KCl, and 7.9 final pH), 10. mu.L of fermented grain suspension was added (blank control without addition of this suspension). Treating in boiling water bath for 20 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(ii) The quenching probe forms a double chain with the unbound signal probe, and the G quadruplex structure is damaged. To the system after the reaction in step (i), 8. mu.L of 20. mu.M quenching probe was added and the reaction was carried out at 55 ℃ for 30 min.

(iii) Forming a heme/G quadruplex structure. To the system after the reaction in step (ii), reagent 1 (heme) was added at a final concentration of 100mM, and the mixture was treated at 37 ℃ for 30 min.

(iv) And (4) color reaction. (iv) to the reaction-terminated system of (iii), reagent 3(ABTS) was added at a final concentration of 7mM, and reagent 4 (H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance values at a wavelength of 420nm were measured using an ultraviolet spectrophotometer, and the blank control was made with the test group without sample DNA, showing absorbance values of 0.436, 0.455, 0.423.

(v) According to the standard curve obtained in example 8, the total amount of Aspergillus tubingensis in the sample was calculated to be 5.67. + -. 0.16log₁₀CFU/mL。

(5) Kit quantitative method determination based on genome extraction

(i) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (containing Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH 7.9), 4. mu.L of fermented grain metagenomic DNA was added (blank control without sample DNA). Treating with water bath at 90 deg.C for 10 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(iii) Forming a heme/G quadruplex structure. To the system after the reaction in step (ii), reagent 1 (heme) was added at a final concentration of 100nM and treated at 37 ℃ for 30 min.

(iv) And (4) color reaction. To the reaction-terminated system of (5), reagent 3(ABTS) was added at a final concentration of 7mM, and reagent 4 (H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance values at a wavelength of 420nm were measured using an ultraviolet spectrophotometer, and the blank control was an experimental group without sample DNA, showing absorbance values of 0.435, 0.454, 0.423.

(v) According to the standard curve obtained in example 5, the total amount of Aspergillus tubingensis in the sample was calculated to be 5.77. + -. 0.15log₁₀CFU/mL。

(6) quantitative qPCR for Aspergillus tubingensis content in sample

(i) Aspergillus tubingensis culture solution was obtained according to the culture method of example 4, the concentration of microorganisms was measured by plate counting method, and the genome was extracted as in example 4.

(ii) Aspergillus tubingensis genomic DNA was diluted by a 10-fold gradient.

(iii) The qPCR system was SYBR Green 10. mu.L, upstream and downstream primers 20. mu.M, template DNA 0.5. mu.L, and sterile water supplemented 20. mu.L.

(iv) Reaction procedure for qPCR: pre-denaturation 95 ℃ for 5min, cycle phase: 5s at 95 ℃ and 20s at 60 ℃; the number of cycles was 40, the dissolution curve was raised from 65 ℃ to 95 ℃ by 0.5 ℃ every 5 s.

(v) The extracted genome was subjected to qPCR using Aspergillus tubingenis specific primers with a sequence downstream of GTCCGATCCTCGAGCGTATG (SEQ ID No.5) and a sequence downstream of AATGGTTGGAAAACGTCGGC (SEQ ID No. 6).

(vi) A standard curve of CT values versus Aspergillus tubingensis concentration was established by 10-fold gradient dilution of genomic DNA, as shown in FIG. 4, R²＝0.99。

(vii) The qPCR system and reaction conditions were as in (iii), (iv). From the CT value at the end of the reaction, the concentration of Aspergillus tubingensis in the sample was calculated to be 5.71. + -. 0.13log from the established standard curve₁₀ CFU/g。

(7) By significant difference analysis, the results are shown in FIG. 6, there is no significant difference between the three quantitative methods (P <0.05)

Example 12: detection limit for detection by using two different sequence signal probes

(1) Aspergillus tubingensis was obtained according to the cultivation method of example 4, and the concentration of microorganisms was measured by plate counting method, and the genome was extracted at a concentration of 7.49log10 CFU/mL as in example 4.

(2) Aspergillus tubingensis genomic DNA was diluted by a 10-fold gradient to give a 3log10 CFU/mL DNA template.

(3) The sequence of the Aspergillus tubingensis signaling probe provided by the invention is GGGTGGGTGGGTGGGTGTCCGATCCTCGAGCGTATG (SEQ ID NO.1), and the sequence of the quenching probe is CATACGCTCGAGGATCGGACACCCA (SEQ ID NO. 2). Adding the 3.2log obtained in (2)₁₀CFU/mL Aspergillus tubingensis genomic DNA was subjected to a color reaction.

(4) The sequence of the Aspergillus tubingensis signaling probe was used as GGGATTGGGATTGGGATTGGGGTCCGATCCTCGAGCGTATG (SEQ ID NO.3), and the sequence of the quenching probe was used as CATACGCTCGAGGATCGGACCCCAA (SEQ ID NO. 4). 3.2log10 CFU/mL Aspergillus tubingensis genomic DNA obtained in (2) was added to conduct a color development reaction.

(5) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, final pH 7.9) was added 4. mu.L of LAspergillus tubingensis genomic DNA (blank control without sample DNA). Treating with water bath at 90 deg.C for 10 min. After adding 4. mu.L of each 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(6) The quenching probe forms a double chain with the unbound signal probe, and the G quadruplex structure is damaged. To the system after the reaction in step (5), 8. mu.L of 20. mu.M quenching probes were added, and the reaction was carried out at 55 ℃ for 30 min.

(8) And (4) color reaction. To the reaction-terminated system of (7), reagent 3(ABTS) was added at a final concentration of 7mM and reagent 4 (H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance at a wavelength of 420nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank.

(9) Repeating the steps (5), (6), (7) and (8) 9 times, and comparing the stability of the detection results, as shown in fig. 7. The Coefficient of Variation (CV) based on the quantitative results of the signal sequence of SEQ ID NO.3 was 0.80; the coefficient of variation of the quantitative result based on the signal sequence of SEQ ID NO.1 is 0.039, and the detection effect is stable.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> Aspergillus tubingensis absolute quantitative probe and application thereof

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 36

<212> DNA

<213> Artificial Synthesis

<400> 1

gggtgggtgg gtgggtgtcc gatcctcgag cgtatg 36

<210> 2

<211> 25

<212> DNA

<213> Artificial Synthesis

<400> 2

catacgctcg aggatcggac accca 25

<210> 3

<211> 41

<212> DNA

<213> Artificial Synthesis

<400> 3

gggattggga ttgggattgg ggtccgatcc tcgagcgtat g 41

<210> 4

<211> 25

<212> DNA

<213> Artificial Synthesis

<400> 4

catacgctcg aggatcggac cccaa 25

Claims

1. A set of probes, comprising a signaling probe and a quenching probe; the sequence of the signal probe is a sequence shown in SEQ ID NO. 1; the sequence of the quenching probe is shown as SEQ ID NO. 2.

2. A detection kit comprising the signaling probe of claim 1 and a quenching probe.

3. The detection kit according to claim 2, further comprising any one or more of: heme, buffer solution, 2-azino-bis- (3-ethylbenzodihydropyrazoline-6-sulfonic acid) diammonium salt, and H₂O₂。

4. A kind ofAspergillus tubingensisA method of quantification, which comprises using the probe according to claim 1 or the detection kit according to any one of claims 2 to 3.

5. A quantification method according to claim 4, characterized in that the method comprises: melting DNA in a sample to be detected; adding an excessive signal probe, and combining with a target nucleotide fragment of a sample to be detected to form a double chain so that a G quadruplex is exposed outside a sequence; adding sufficient quenching probe to form double chains with the unbound signal probe, and destroying the G quadruplex structure; g quadruplex/heme mimic enzyme with catalase activity is formed by reacting naked leakage outside G quadruplex with heme, and activity characterization of catalase is combinedAspergillus tubingensisThe biomass of (a).

6. A quantification method according to claim 4, wherein the method is absolute quantification or relative quantification; when the method is absolute quantification, the method further comprises the following steps: establishing an index of catalase activity or a correlation with catalase activity, anAspergillus tubingensisA standard curve of biomass of (a); when detecting a sample to be detected, substituting the detected catalase activity or the index which is correlated with the catalase activity into the standard curve to obtain the catalase in the sample to be detectedAspergillus tubingensisThe biomass of (a).

7. The method according to claim 5 or 6, wherein the sample to be tested is a sample containing a microorganism, a genome or a metagenome.

8. The quantification method according to claim 7, wherein the sample to be tested is a fermented food or a sample obtained from a fermentation process of a fermented food or an environmental sample.

9. The method of claim 8, wherein the fermented food is any one or more of: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverages, alcoholic drinks, yogurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd and fermented rice-flour foods; the environmental sample is selected from intestinal tract, soil and water body.

10. A method of using the kit of any one of claims 2 to 3, wherein the method of use comprises: adding excessive signal probes into a sample to be detected after the DNA is unzipped, and reacting for a period of time to enable the signal probes to be combined with target fragments in the sample to be detected; then adding enough quenching probe to form double chains with the unbound signal probe; adding heme, reacting for a while, adding ABTS and H₂O₂Reacting for a period of time, detecting the absorbance of the reactant, and combining the absorbance with the absorbance in the sampleAspergillus tubingensisQuantification was performed.

11. In detecting fermented food or environmental sampleAspergillus tubingensisA method of assaying, comprising using the probe of claim 1, or the kit of claims 2-3; the fermented food is any one or more of the following: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverages, alcoholic drinks, yogurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd and fermented rice-flour foods; the environmental sample is selected from intestinal tract, soil and water body.