CN112899381B - Absolute quantification probe, method and application thereof - Google Patents
Absolute quantification probe, method and application thereof Download PDFInfo
- Publication number
- CN112899381B CN112899381B CN202110163271.9A CN202110163271A CN112899381B CN 112899381 B CN112899381 B CN 112899381B CN 202110163271 A CN202110163271 A CN 202110163271A CN 112899381 B CN112899381 B CN 112899381B
- Authority
- CN
- China
- Prior art keywords
- sample
- probe
- lactobacillus
- quantification
- reaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an absolute quantitative probe, a method and application thereof, and belongs to the fields of biology, fermentation and detection. The quantitative probe and the kit for the acid-resistant lactobacillus Lactobacillus acetotolerans can realize total amount detection of Lactobacillus acidophilus, and can rapidly complete quantitative work within 2.5 hours without using an expensive instrument when being used for detection and Lactobacillus acetotolerans quantification. Meanwhile, the sample used in the present invention does not have to be subjected to nucleic acid extraction. The probe and the detection kit based on the invention are used for Lactobacillus acetotolerans quantification and have the characteristics of rapidness, convenience, cheapness and accuracy.
Description
Technical Field
The invention relates to an absolute quantitative probe, a method and application thereof, belonging to the fields of biology, fermentation and detection.
Background
Acid-resistant lactobacillus (Lactobacillus acetotolerans) is a lactobacillus widely distributed in a traditional fermentation food fermentation system, researches show that Lactobacillus acetotolerans is an absolute dominant microorganism in the later period of the white wine fermentation process, and correlation analysis shows that Lactobacillus acetotolerans has correlation with the formation of various flavor compounds, the change of biomass is closely related to the quality of the final product, and the biomass and succession of the lactobacillus in the food fermentation process are important marker microorganisms for representing the normal fermentation of the food. Therefore, the real-time tracking of the biomass of Lactobacillus acetotolerans has important guiding significance for judging the stability of the fermentation batch and regulating and controlling the fermentation parameters. However, most of the traditional fermentation food systems are multi-strain co-fermentation systems at present, the content of Lactobacillus acetotolerans in a sample cannot be judged by a simple OD colorimetric method, and the fluorescent quantitative PCR method combined with a specific primer or probe can realize the quantification of Lactobacillus acetotolerans in a bacteria mixing system, but high-volume equipment and high-requirement operation environment are required. Therefore, in order to conveniently, rapidly and accurately track the growth trend of Lactobacillus acetotolerans in a sample, it is necessary to develop a corresponding Lactobacillus acetotolerans quantification method and kit.
The principle of the G quadruplex/heme mimic enzyme activity detection is that the G quadruplex can form DNA mimic enzyme with catalase activity with heme, can catalyze hydrogen peroxide to oxidize ABTS to generate ABTS+, presents green color reaction, and can detect characteristic absorbance at the wavelength of 420 nm. The stability of the G quadruplex structure is critical to the whole detection process, if the design is improper, when the G quadruplex sequence forms a dimer with other bases, the G quadruplex sequence can not form the G quadruplex, and a quantitative method based on the principle can cause underestimation of the content of a target gene in a sample in use, and reduces the sensitivity and accuracy of the detection method.
At present, the principle based on G quadruplex/heme simulated enzyme activity detection has been reported to be used for specific detection of microorganisms; for example, wangY, li X, xi D, wang X.visual detection of Fusarium proliferatumbased on asymmetric recombinase polymerase amplification and hemin/G-quad DNAzyme.Rsc Advances 2019;9:37144-37147, asymmetric specific primers are used (upstream primer added with reverse sequence modification of G quadruplex, downstream not modification), and the method is only applicable to detection of specific bacteria Fusarium proliferatum in a sample, and cannot realize total amount detection of Lactobacillus acetotolerans; in addition, in the case of detection using this asymmetric specific primer, different concentrations of the upstream primer and the downstream primer (the concentration of the upstream primer is low and the concentration of the downstream primer is high) are added to a PCR system, and a double-stranded product is formed by Recombinant Polymerase Amplification (RPA) amplification, and as the PCR reaction proceeds, the upstream primer is consumed and the downstream primer is amplified using newly synthesized double-stranded DNA as a template, thereby forming single-stranded DNA with a G quadruplex end, and Fusarium proliferatum in a sample is detected using G quadruplex/heme-mimetic enzyme activity detection. However, this quantitative method still requires a PCR step to generate G quadruplexes, and the PCR process still requires high-volume PCR equipment and a strict operating environment.
Disclosure of Invention
The invention discloses a probe, a kit and application for absolute quantification of Lactobacillus acetotolerans, which solve at least one of the following technical problems: (1) The existing method cannot realize the total detection of all Lactobacillus acetotolerans; (2) The existing quantitative method has low species resolution and/or insufficient detection accuracy; (3) The existing quantitative method needs high-volume instruments and/or strict operation environment, and is not suitable for timely detection after production and sampling; (4) the existing quantitative method has complicated operation and the like.
It is a first object of the present invention to provide a set of probes, including signaling probes and quenching probes; the signal probe sequence is shown in SEQ ID NO.1 (GGGTGGGTGGGTGGGTAAAAAGCAGAGTGGAGAAAATACT).
In one embodiment, the quenching probe sequence is shown in SEQ ID NO.2 (AGTATTTTCTCCACTCTGCTTTTTACCCA).
It is a second object of the invention to provide a Lactobacillus acetotolerans quantification method comprising the use of the probe of the invention.
The method comprises the following steps: melting DNA in the sample to be detected; adding excessive signal probes (with the sequence shown as SEQ ID NO. 1), and combining with a target nucleotide fragment of a sample to be detected to form double chains, so that G quadruplex is exposed outside the sequence; adding enough quenching probes (with the sequence shown as SEQ ID NO. 2) to form double chains with unbound signaling probes, and destroying the structure of the G quadruplex; the bare drain was used to react with heme to form a G quadruplex/heme mimetic enzyme with catalase activity, which was combined with the catalase activity to characterize Lactobacillus acetotolerans biomass.
In one embodiment, the method is an absolute quantification method, further comprising: establishing a standard curve of catalase activity (or an index related to catalase activity, such as absorption value of a solution at a wavelength of 420nm after catalyzing oxidation of ABTS by hydrogen peroxide to generate ABTS+) and Lactobacillus acetotolerans biomass; when the sample to be detected is detected, the detected catalase activity is substituted into a standard curve, and the biomass of Lactobacillus acetotolerans in the sample to be detected is obtained.
In one embodiment, the method is a relative quantification method, further comprising: a plurality of samples were tested and the relative values of the biomass of Lactobacillus acetotolerans in the plurality of different samples were determined from the relative ratios of the catalase activities detected for the different samples.
In one embodiment, the sample to be tested is a sample containing a cell, genome, metagenome, or the like. Optionally, the sample to be detected is a finished fermented food or a sample obtained from the fermentation process of the fermented food; optionally, the sample to be measured is subjected to pretreatment such as centrifugation and bacterial cell collection, and then subjected to subsequent measurement. Preferably, the cells in the sample are collected and then subjected to DNA melting treatment directly without genome extraction.
In one embodiment, the sample is a fermented food product or a sample or environmental sample taken during fermentation of a fermented food product.
In one embodiment, the fermented food is any one or more of the following: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverage, alcoholic beverage, yoghurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd, fermented rice flour food and the like; the environmental sample is an environmental sample selected from intestinal tracts, soil, water bodies and the like.
In one embodiment, the melting of the DNA in the sample to be tested is performed at an elevated temperature. Alternatively, the sample to be tested is treated at a temperature above 90 ℃. Can be any one of metal bath, water bath, oven, thermal insulation instrument and the like which can provide environment with corresponding temperature.
In one embodiment, the melting is performed in a buffer. Alternatively, the buffer may be Tris-HCl buffer, further containing KCl, NH 4 Cl, naCl, or any one or more thereof. Alternatively, the buffer is Tris-HCl, KCl, ph=7.9.
In one embodiment, the excess is an amount of signaling probe added above that required to fully bind to the target nucleotide fragment of the test sample to form a duplex. The specific amounts used may be determined by one of ordinary skill in the art, in combination with one or more specific samples to be tested, or by pre-experimentation.
In one embodiment, the excess is in excess of 10 10 And copies of the signaling probe.
In one embodiment, the binding of the signaling probe to the target nucleotide fragment of the test sample to form a double strand is performed at a temperature in the range of 50-60 ℃.
In one embodiment, the sufficient amount is an amount of quenching probe that is added in an amount sufficient to form a double strand with all unbound signaling probes. The specific amounts used may be determined by one of ordinary skill in the art in combination with the general knowledge in the art, or by specific samples to be tested, or by pre-experiments.
In one embodiment, the sufficient amount refers to a double amount of signaling probe.
In one embodiment, the adding a sufficient amount of the quenching probe to form a double strand with the unbound signaling probe is performed at a temperature that causes the quenching probe to form a double strand with the unbound signaling probe; the determination of a specific sample to be tested may be determined by a person skilled in the art in combination with the general knowledge in the art.
In one embodiment, the reaction of the G quadruplex with heme to form G quadruplex/heme mimic enzyme with catalase activity by using naked leakage and the combination of the activity of catalase to characterize Lactobacillus acetotolerans biomass means that after heme reaction is added into the system, ABTS and H are added 2 O 2 The catalase activity was then characterized by the absorbance of the reactant.
In one embodiment, the absorbance is at a wavelength of 420 nm.
In one embodiment, the quantification method specifically comprises:
(1) Carrying out DNA melting treatment on a sample to be detected;
(2) Adding a signal probe, and reacting for 30min at 55 ℃;
(3) Adding a quenching probe, and reacting for 30min at 55 ℃;
(4) Adding heme, and reacting at 37 ℃ for 30min;
(5) Adding 2, 2-azino-bis- (3-ethylbenzodihydrothiazoline-6-sulphonic acid) diammonium salt (ABTS) and H 2 O 2 Reacting at 37 ℃ for 30min;
(6) Detecting the absorbance value of the reactant at the wavelength of 420 nm;
(7) The Lactobacillus acetotolerans in the sample was quantified in combination with absorbance.
In one embodiment, the quantification method further comprises: preparing samples with different known Lactobacillus acetotolerans contents, and measuring absorbance values obtained by processing different samples by the method; drawing a standard curve of light absorption values and different Lactobacillus acetotolerans contents; substituting the absorbance value obtained by the sample to be measured after the sample to be measured is processed by the method into a standard curve to obtain the Lactobacillus acetotolerans content in the sample to be measured.
The third object of the invention is to provide a detection kit for absolute quantification of Lactobacillus acetotolerans, which contains the signaling probe with the sequence shown as SEQ ID NO. 1.
In one embodiment, the detection kit further comprises a quenching probe having the sequence shown in SEQ ID NO. 2.
In one embodiment, the detection kit further comprises any one or more of the following: heme, buffer, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS), H 2 O 2 . These reagents may not be contained, and an operator may prepare the kit separately when using the kit.
In one embodiment, the detection kit may comprise a buffer solution of Tris-HCl, KCl, and NH 4 Cl, naCl, or any one or more thereof. Alternatively, the buffer is Tris-HCl, KCl, ph=7.9.
In one embodiment, the detection kit is a Lactobacillus acetotolerans absolute quantification kit comprising simultaneously four reagents (reagent 1, reagent 2, reagent 3, reagent 4) and a set of Lactobacillus acetotolerans quantification probes (signaling probes, quenching probes);the reagent 1 comprises heme; the reagent 2 comprises buffer (Tris-HCl, KCl, pH=7.9; wherein KCl can be replaced by NH) 4 Cl, naCl); the reagent 3 comprises 2, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS); the reagent 4 comprises H 2 O 2 。
In one embodiment, the reagents or probes in the assay kit may be in a liquid or solid state, and may be routinely adjusted to appropriate concentrations by those skilled in the art when in use.
A fourth object of the invention is to provide a method of using the kit.
In one embodiment, the method of use comprises: adding excessive signal probes into a sample to be detected of DNA melting for reacting for a period of time, so that the signal probes are combined with target fragments in the sample to be detected; then adding a sufficient amount of quenching probe to form double chains with the unbound signaling probe; adding heme, reacting for a period of time, adding ABTS and H 2 O 2 After a period of reaction, the absorbance of the reactant is measured, and the Lactobacillus acetotolerans in the sample is quantified by combining the absorbance.
In one embodiment, the method includes adjusting the reagents and probes to a concentration suitable for use.
(1) Carrying out DNA melting treatment on a sample to be detected; (2) adding a signal probe, and reacting for 30min at 55 ℃; (3) adding a quenching probe, and reacting for 30min at 55 ℃; (4) adding heme, and reacting for 30min at 37 ℃; (5) Adding 2, 2-azino-bis- (3-ethylbenzodihydrothiazoline-6-sulphonic acid) diammonium salt (ABTS) and H 2 O 2 Reacting at 37 ℃ for 30min; (6) detecting the absorbance of the reactant at a wavelength of 420 nm; (7) The Lactobacillus acetotolerans in the sample was quantified in combination with absorbance.
It is a fifth object of the present invention to provide the use of the kit in Lactobacillus acetotolerans quantification.
In one embodiment, the application is for use in the field of fermented food technology or the field of the environment; optionally, the fermented food is any one or more of the following: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverage, alcoholic beverage, yoghurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd, fermented rice flour food and the like; the environmental sample is an environmental sample selected from intestinal tracts, soil, water bodies and the like.
In one embodiment, the sample to be tested may be a sample containing a cell, genome, metagenome or the like. Optionally, the sample to be detected is a finished fermented food or a sample obtained from the fermentation process of the fermented food; optionally, the sample to be measured is subjected to pretreatment such as centrifugation and bacterial cell collection, and then subjected to subsequent measurement. Preferably, the cells in the sample are collected and then subjected to DNA melting treatment directly without genome extraction.
The beneficial effects are that:
the invention combines the G quadruplex with the specificity sequence to form a signal probe, the signal probe is combined with the target sequence to enable the G quadruplex to be exposed outside the sequence, a sufficient amount of quenching probe and unreacted signal probe are added to form double chains, the structure of the G quadruplex is destroyed, the G quadruplex/heme mimic enzyme is formed by reacting with heme, the catalase activity is shown, and the catalase activity is used for representing the biomass of microorganisms. The Lactobacillus acetotolerans quantitative probe can realize the total detection of Lactobacillus acetotolerans; further, a signaling probe was optimized with a sequence of GGGTGGGTGGGTGGGTAAAAAGCAGAGTGGAGAAAATACT (SEQ ID NO. 1) and a quenching probe of AGTATTTTCTCCACTCTGCTTTTTACCCA (SEQ ID NO. 2). Compared with the signal sequence of SEQ ID NO.3, the G quadruplex sequence in the signal probe of SEQ ID NO.1 does not generate additional space structure with the specific sequence (figure 1), and the detection accuracy is higher and the minimum detection limit is improved.
The probe of the invention is used for detection and Lactobacillus acetotolerans quantification without the need for expensive instrument detection procedures. The absolute quantitative kit for the microorganisms is also provided for the first time, and can finish quantitative work within 2.5 hours. The invention realizes microorganism quantification by combining a signal probe and a quenching probe in order to avoid using high-volume equipment such as a PCR instrument. The invention solves the problem that the existing microorganism quantitative means depend on expensive instruments and are very limited in practical use.
Furthermore, the invention can realize rapid Lactobacillus acetotolerans detection, the sample does not need to be subjected to nucleic acid extraction, and only the microorganisms in the sample need to be eluted in the buffer solution to directly carry out subsequent experiments. Meanwhile, compared with the quantitative result of fluorescent quantitative PCR, the quantitative result obtained by the method has no significant difference.
In conclusion, the probe and the detection kit provided by the invention are used for Lactobacillus acetotolerans quantification and have the characteristics of rapidness, cheapness and accuracy.
Drawings
Fig. 1: signal probe dimer structure. (A) The G quadruplex sequence of SEQ ID NO.1 is not self-loop with the specific sequence; (B) SEQ ID NO.3 has been reported to self-loop G quadruplex sequences with specific sequences for microbial quantification.
Fig. 2: specificity of Lactobacillus acetotolerans probe.
Fig. 3: a standard curve for Lactobacillus acetotolerans quantitative probes based on genome extraction.
Fig. 4: a standard curve based on Lactobacillus acetotolerans quantitative probes that did not extract the sample genome.
Fig. 5: qPCR standard curve.
Fig. 6: comparing the Lactobacillus acetotolerans probe quantification assay based on genome extraction, the Lactobacillus acetotolerans probe quantification assay based on no sample genome extraction, and the qPCRLactobacillus acetotolerans quantification assay; wherein, (a) is based on Lactobacillus acetotolerans probe quantification experiments without extracting sample genome, (B) is based on Lactobacillus acetotolerans probe quantification experiments with genome extraction, (C) qPCRLactobacillus acetotolerans quantification experiments.
Fig. 7: the stability of the detection results of the probe (A) based on SEQ ID NO.1/SEQ ID NO.2 and the probe (B) based on SEQ ID NO.3/SEQ ID NO.4 were compared.
The specific embodiment is as follows:
example 1: lactobacillus acetotolerans quantitative probe combination reagent
A probe combination reagent; containing separately packaged signaling probe reagents and quenching probe reagents; wherein the sequence of the signal probe is shown as SEQ ID NO.1, and the sequence of the quenching probe is shown as SEQ ID NO. 2.
The signal probe reagent and the quenching probe reagent are dry powder or liquid; in the case of dry powders, the solution may be diluted to a suitable concentration prior to the experiment, for example, 20. Mu.M using sterile water or buffer; in the case of liquid form, the concentration may be 20 to 200. Mu.M, and the reagent may be diluted before use or used directly.
Example 2: lactobacillus acetotolerans quantitative kit and use thereof
Lactobacillus acetotolerans quantitative kit containing separately packaged signaling probe reagent and quenching probe reagent; wherein the sequence of the signal probe is shown as SEQ ID NO.1, and the sequence of the quenching probe is shown as SEQ ID NO. 2.
The kit can be used together with heme, buffer solution, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS), H 2 O 2 Is matched with the components.
The using method is as follows:
(1) And (5) solution preparation. Preparing a 100nM heme solution (reagent 1); preparing Tris-HCl with a final concentration of 50mM, KCl with a final concentration of 50mM and final pH of 7.9 (reagent 2); 7mM 2, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS) (reagent 3) and 7mM H 2 O 2 Solution (reagent 4); the solvents were all sterile water.
(2) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 was added 4. Mu.L of the sample genomic DNA, and the mixture was treated in a water bath at 90℃for 10 minutes. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.
(3) The quenching probe forms a double strand with the unbound signaling probe. The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (4), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(4) Forming heme/G quadruplex structure. Reagent 1 was added to the system after the reaction in the step (5) to a final concentration of 100nM, and the reaction was carried out at 37℃for 30min.
(5) And (5) color reaction. To the system at the end of the reaction of (4), a reagent (ABTS) having a final concentration of 7mM and a reagent 4 having a final concentration of 7mM were added, and the reaction was carried out at 37℃for 30 minutes to carry out the reaction (green).
Detecting the absorbance value of the reactant at the wavelength of 420 nm; the Lactobacillus acetotolerans in the sample was quantified in combination with absorbance.
Of course, in absolute quantification, a standard curve of absorbance and Lactobacillus acetotolerans biomass can be drawn by itself, or Lactobacillus acetotolerans biomass can be directly converted according to the recommended use method of the kit and the standard curve.
Example 3: lactobacillus acetotolerans quantitative kit
Lactobacillus acetotolerans quantitative kit containing separately packaged signaling probe reagent and quenching probe reagent; wherein the sequence of the signal probe is shown as SEQ ID NO.1, and the sequence of the quenching probe is shown as SEQ ID NO. 2.
The kit also contains 100nM heme solution (reagent 1), tris-HCl buffer, 7mM 2, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS), 7mM H 2 O 2 A solution.
Example 4: specificity of Lactobacillus acetotolerans quantitative kit
(1) Lactobacillus acetotolerans from fermented cereal was selected as positive control and 36 bacterial species microorganisms and 7 fungal species microorganisms, which were widely present in the fermented food sample, were selected as negative controls, bacterial microorganisms Lactobacillus buchneri, lactobacillus dioilvorans, lactobacillus brevis, lactobacillus crustorum, lactobacilli plantarum, lactobacillus harbinensis, lactobacillus acidiliscis, pediococcus ethanolidurans, pediococcus acidilactici, pediococcus pentosaceus, lactobacillus murinus, lactobacillus curvatus, lactobacillus casei, lactobacillus reuteri, lactobacillus panis, lactobacillus fermentum, lactobacillus johnsonii, lactobacillus delbrueckii, lactococcus lactis, weissella confusa, weissella paramesenteroides, weissella viridescens, leuconostoc citreum, leuconostoc lactis, leuconostoc mesenteroides, leuconostoc pseudomesenteroides, enterococcus italicus, enterococcus lactis, enterococcus faecalis, bacillus coagulans, bacillus licheniformis, bacillus tequilensis, bacillus subtilis, bacillus velezensis, acetobacter pasteurianus, enterococcus faecium, respectively. The fungal microorganisms are Aspergillus tubingensis, mucor rouxianius, schizosaccharomyces pombe, zygosaccharomyces bailii, pichia kudriavzevii, saccharomycopsis fibuligera, saccharomyces cerevisiae, respectively.
(2) The above microorganisms were cultured in different culture media, wherein MRS culture media were used for Lactobacillus acetotolerans, lactobacillus buchneri, lactobacillus dioilvorans, lactobacillus brevis, lactobacillus crustorum, lactobacillus plantarum, lactobacillus harbinensis, lactobacillus acidiliscis, pediococcus ethanolidurans, pediococcus acidilactici, pediococcus pentosaceus, lactobacillus murinus, lactobacillus curvatus, lactobacillus casei, lactobacillus reuteri, lactobacillus panis, lactobacillus fermentum, lactobacillus johnsonii, lactobacillus delbrueckii, lactococcus lactis, weissella confusa, weissella paramesenteroides, weissella viridescens, leuconostoc citreum, leuconostoc lactis, leuconostoc mesenteroides, leuconostoc pseudomesenteroides, and the culture media were prepared from tryptone 10.0g/L, beef extract 8.0g/L, yeast extract 4.0g/L, glucose 18.0g/L, and sorbitan oleate 0.8mL/L, K 2 HPO 4 2.5 g/L, sodium acetate trihydrate 6.0g/L, triammonium citrate 2.0g/L, mgSO 4 ·7H 2 O 0.3g/L，MnSO 4 ·4H 2 O0.08 g/L. The culture conditions were 30℃for 48 hours. Enterococcus italicus, enterococcus lactis, enterococcus faecalis, bacillus coagulans, bacillus licheniformis, bacillus tequilensis, bacillus subtilis, bacillus velezensis, acetobacter pasteurianus, enterococcus faecium using LB medium of 10.0g/L peptone and yeast 5g/L of powder and 10g/L of sodium chloride. The culture conditions were 37℃for 24 hours. Aspergillus tubingensis Mucor rouxianus, schizosaccharomyces pombe, zygosaccharomyces bailii, pichia kudriavzevii, saccharomycopsis fibuligera, saccharomyces cerevisiae YPD medium was used, the medium formulation being 10g/L yeast extract, 20g/L peptone, 20g/L glucose. The culture conditions are as follows: the mold is cultured at 30 ℃ for 5 days, and the yeast is cultured at 30 ℃ for 2 days.
(3) And (5) extracting a single bacterial genome. The bacterial liquid was treated at 12000rpm for 2min, and the precipitate was collected. The genome of the 43 pure cultures of microorganisms was extracted using the gene extraction kit DNeasy Tissue Kit.
(4) The probe was selected as Lactobacillus acetotolerans specific probe, the sequence of the signaling probe was GGGTGGGTGGGTGGGTAAAAAGCAGAGTGGAGAAAATACT (SEQ ID NO. 1), and the sequence of the quenching probe was AGTATTTTCTCCACTCTGCTTTTTACCCA (SEQ ID NO. 2).
(4) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9), 4. Mu.L of genomic DNA of different microorganisms was added, and the mixture was treated in a water bath at 90℃for 10 minutes. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.
(5) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (4), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(6) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (5) at a final concentration of 100nM and the reaction was treated at 37℃for 30min.
(7) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (6) 2 O 2 ) The treatment is carried out at 37 ℃ for 30min. As shown in FIG. 2, the test group added with Lactobacillus acetotolerans genome showed no color reaction, and the test group added with non-Lactobacillus acetotolerans and the blank group showed no color reaction, thus demonstrating the specificity of detection Lactobacillus acetotolerans in the present kit.
Example 5: quantitative method accuracy assessment
(1) Lactobacillus acetotolerans the microbial inoculum was obtained by the culture method in example 4, and the microbial concentration was measured by plate count method, and the genome extraction was the same as in example 4.
(2) Lactobacillus acetotolerans genomic DNA was diluted by 10-fold gradient.
(3) The color reaction was performed with Lactobacillus acetotolerans genomic DNA at different concentrations using the probe of Lactobacillus acetotolerans. The sequence of the signal probe is
GGGTGGGTGGGTGGGTAAAAAGCAGAGTGGAGAAAATACT (SEQ ID NO. 1), the sequence of the quenching probe is AGTATTTTCTCCACTCTGCTTTTTACCCA (SEQ ID NO. 2).
(4) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, final pH of 7.9) was added 4. Mu.L of genomic DNA at different dilutions (no sample DNA added as a blank). Treating in water bath at 90deg.C for 10min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.
(5) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (4), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(6) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (5) to a final concentration of 100nM, and the reaction was treated at 37℃for 30min.
(7) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (6) 2 O 2 ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank.
(8) Constructing a standard curve by calculating the linear relation between the absorbance and the concentration of the bacterial liquid, as shown in figure 3, R 2 =0.99 (x is log10 CFU/mL, y is OD 420 A linear range of 10 3 ～10 7 ). Proved by the accuracy of the quantitative method of the kitSex.
Example 6: quantitative experiments of Lactobacillus acetotolerans in wine samples
(1) Samples were collected from Shandong tobacco stand, a well known wine manufacturer, by the Materials andmethods method of Gayevskiy, V., & Goddard, M. (2012) Geographic delineations of yeast communities and populations associated with vines and wines in New Zealand. ISME J,6 (7), 1281-1290. The genomic concentration was 658.39 ng/. Mu.L.
(2) The color reaction was performed using a probe of Lactobacillus acetotolerans. The sequence of the signaling probe was GGGTGGGTGGGTGGGTAAAAAGCAGAGTGGAGAAAATACT (SEQ ID NO. 1) and the sequence of the quenching probe was AGTATTTTCTCCACTCTGCTTTTTACCCA (SEQ ID NO. 2).
(4) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9), 4. Mu.L of sample metagenomic DNA (no sample DNA added as a blank) was added. Treating in water bath at 90deg.C for 10min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.
(5) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (4), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(6) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (5) at a final concentration of 100nM and the reaction was treated at 37℃for 30min.
(7) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (7 mM H) at a final concentration of 7mM to the system at the end of the reaction of (6) 2 O 2 ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured by an ultraviolet spectrophotometer, and the experimental group without adding sample DNA was used as a blank, showing that the absorbance was 0.
(8) Based on the standard curve obtained in example 5, the total Lactobacillus acetotolerans content in the sample was calculated to be 0log 10 CFU/mL。
(9) The Lactob in the same sample was subjected to fluorescent quantitative PCR (quantitative procedure and materials are the same as in example 11 (6))acillus acetotolerans and shows a total of Lactobacillus acetotolerans of 0log 10 CFU/mL, consistent with the quantitative results determined by the method described above.
Example 7: absolute quantification of Lactobacillus acetotolerans in a sample of fermented grains
(1) Reference is made to Song Z W, du H, zhang Y, xu Y. Unraveling core functional microbiota in traditional solid-state fermentation by high-throughput amplicons and metatranscriptomics sequencing. Front in microbiology 2017; the method in MATERIALS AND METHODS of 8:1294, extracting metagenome from fermented grains sample of Shandong province, and the genome concentration is 100.02 ng/. Mu.L.
(2) The color reaction was performed using a probe of Lactobacillus acetotolerans. The sequence of the signaling probe was GGGTGGGTGGGTGGGTAAAAAGCAGAGTGGAGAAAATACT (SEQ ID NO. 1) and the sequence of the quenching probe was AGTATTTTCTCCACTCTGCTTTTTACCCA (SEQ ID NO. 2).
(3) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9), 4. Mu.L of fermented grain metagenomic DNA (no sample DNA added as a blank) was added. Treating in water bath at 90deg.C for 10min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.
(4) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (3), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(5) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (4) at a final concentration of 100nM and the reaction was treated at 37℃for 30min.
(6) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (5) 2 O 2 ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured by an ultraviolet spectrophotometer, and the experimental group without adding sample DNA was used as a blank, showing that the absorbance was 0.723.
(7) Based on the standard curve obtained in example 2, la in the sample was calculatedctobacillus acetotolerans the total microorganism content is 8.58log 10 CFU/mL。
(8) Lactobacillus acetotolerans in the same fermented grain sample was quantified by a fluorescent quantitation method (quantitation step and material same as in example 11 (6)), and the result showed that Lactobacillus acetotolerans had a total microorganism amount of 8.56log 10 CFU/mL was substantially identical to the quantitative results measured by the method described above (coefficient of variation, cv=0.002).
Example 8: lactobacillus acetotolerans absolute quantification method based on non-extracted sample genome
(1) Lactobacillus acetotolerans the microbial inoculum was obtained according to the cultivation method in example 4, and the microbial concentration was determined by plate counting.
(2) Diluting Lactobacillus acetotolerans bacterial liquid in (1) by 10-time gradient
(3) The color reaction was performed using a probe of Lactobacillus acetotolerans. The sequence of the signaling probe was GGGTGGGTGGGTGGGTAAAAAGCAGAGTGGAGAAAATACT (SEQ ID NO. 1) and the sequence of the quenching probe was AGTATTTTCTCCACTCTGCTTTTTACCCA (SEQ ID NO. 2).
(4) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9) was added 10. Mu.L of different dilutions of bacterial solution (no sample bacterial solution was added as a blank). Treating in boiling water bath for 20min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min. (5) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (4), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(6) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (5) to a final concentration of 100nM, and the reaction was treated at 37℃for 30min.
(7) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (6) 2 O 2 ) The treatment is carried out at 37 ℃ for 30min. Measuring absorbance at 420nm by ultraviolet spectrophotometer, taking experimental group without sample DNA as emptyWhite control.
(8) Constructing a standard curve by calculating the linear relation between the absorbance and the concentration of the bacterial liquid, as shown in figure 4, R 2 =0.99 (x is log10 CFU/mL, y is OD 420 A linear range of 10 3 ～10 7 ). Proved by the accuracy of the quantitative method of the kit
Example 9: determination of Lactobacillus acetotolerans content in wine samples based on absolute quantification method of microorganisms without extracting sample genome
(1) The sample is collected in some known grape wine manufacturer of Shandong Jiedu, and the sample processing method is as follows: to 1mL of the sample, 5mL of phosphate buffer was added, and the cells were collected by centrifugation at 3000 Xg for 10 min.
(2) And (5) washing. To the cells obtained in (1), 5mL of phosphate buffer was added, and the cells were collected by centrifugation at 12000 Xg for 2min and repeated.
(3) The cells were resuspended, and 1mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and pH 7.9) was added to the cells obtained in (2), followed by air-aspiration and mixing.
(4) The color reaction was performed using a probe of Lactobacillus acetotolerans. The sequence of the signaling probe was GGGTGGGTGGGTGGGTAAAAAGCAGAGTGGAGAAAATACT (SEQ ID NO. 1) and the sequence of the quenching probe was AGTATTTTCTCCACTCTGCTTTTTACCCA (SEQ ID NO. 2).
(5) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9) was added 10. Mu.L of a grape fermentation broth (no sample broth was added as a blank). Treating in boiling water bath for 20min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.
(6) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (5), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(7) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (6) at a final concentration of 100nM, and the reaction was carried out at 37℃for 30min.
(8) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (7) 2 O 2 ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured by an ultraviolet spectrophotometer, and the experimental group without adding sample DNA was used as a blank, showing that the absorbance was 0.
(9) Based on the standard curve obtained in example 8, the total Lactobacillus acetotolerans content in the sample was calculated to be 0log 10 CFU/mL。
(10) Quantification of Lactobacillus acetotolerans in the same sample described above was performed by fluorescent quantitative PCR (quantitative procedure and materials same as in example 11 (6)), which showed Lactobacillus acetotolerans total amount to be 0log 10 CFU/mL, consistent with the quantitative results determined by the method described above.
Example 10: determination of Lactobacillus acetotolerans content in fermented grain sample based on absolute quantification method without extracting sample genome
(1) The sample is derived from fermented grains of certain winery in Shandong, and the sample treatment method comprises the following steps: to 1g of the sample, 5mL of phosphate buffer was added, and the cells were collected by centrifugation at 3000 Xg for 10 min.
(2) And (5) washing. To the cells obtained in (1), 5mL of phosphate buffer was added, and the cells were collected by centrifugation at 12000 Xg for 2min and repeated.
(3) The cells were resuspended, and 1mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and pH 7.9) was added to the cells obtained in (2), followed by air-aspiration and mixing.
(4) The color reaction was performed using a probe of Lactobacillus acetotolerans. The sequence of the signaling probe was GGGTGGGTGGGTGGGTAAAAAGCAGAGTGGAGAAAATACT (SEQ ID NO. 1) and the sequence of the quenching probe was AGTATTTTCTCCACTCTGCTTTTTACCCA (SEQ ID NO. 2).
(5) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9), 10. Mu.L of fermented grain bacterial liquid (no sample bacterial liquid was added as a blank) was added. Treating in boiling water bath for 20min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.
(6) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (5), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(7) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (6) at a final concentration of 100nM, and the reaction was carried out at 37℃for 30min.
(8) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (7) 2 O 2 ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured by an ultraviolet spectrophotometer, and the experimental group without adding sample DNA was used as a blank, showing that the absorbance was 0.672.
(9) Based on the standard curve obtained in example 8, the total Lactobacillus acetotolerans in the sample was calculated to be 8.47log 10 CFU/mL，
(10) Quantification of Lactobacillus acetotolerans in the same sample described above was performed by fluorescent quantitative PCR (quantitative procedure and materials same as in example 11 (6)), which showed Lactobacillus acetotolerans in total to be 8.56log 10 CFU/mL was substantially identical to the two sets of data measured by the method described above (coefficient of variation, cv=0.007).
Example 11: comparison of microorganism quantitative detection kit and fluorescent quantitative PCR detection result
(1) The samples were selected from three samples of fermented grains of white spirit from the end point of the fermentation in some winery in Shandong province.
(2) Sample processing:
(i) Total genomes in three samples were extracted at genome concentrations of 369 ng/. Mu.L, 590 ng/. Mu.L, 321.89 ng/. Mu.L, respectively.
(ii) To 1g of the sample, 5mL of phosphate buffer was added, and the cells were collected by centrifugation at 3000 Xg for 10 min. To the obtained cells, 5mL of phosphate buffer was added, and the cells were collected by centrifugation at 12000 Xg for 2min and repeated. The cells were resuspended, and 1mL of the buffer solution of reagent 2 was added to the obtained cells, followed by air-aspiration and mixing.
(3) The color reaction was performed using a probe of Lactobacillus acetotolerans. The sequence of the signaling probe was GGGTGGGTGGGTGGGTAAAAAGCAGAGTGGAGAAAATACT (SEQ ID NO. 1) and the sequence of the quenching probe was AGTATTTTCTCCACTCTGCTTTTTACCCA (SEQ ID NO. 2).
(4) Assay based on kit quantification method without genome extraction.
(i) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9), 10. Mu.L of fermented grain bacterial liquid (no sample bacterial liquid was added as a blank) was added. Treating in boiling water bath for 20min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.
(ii) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (i), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(iii) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (ii) to a final concentration of 100mM, and the reaction was treated at 37℃for 30 minutes.
(iv) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (iii) 2 O 2 ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank, showing that the absorbance was 0.678,0.695,0.70.
(v) Based on the standard curve obtained in example 8, the total Lactobacillus acetotolerans in the sample was calculated to be 8.68.+ -. 0.12log 10 CFU/mL。
(5) Kit quantitative method determination based on genome extraction
(i) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9), 4. Mu.L of fermented grain metagenomic DNA (no sample DNA added as a blank) was added. Treating in water bath at 90deg.C for 10min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.
(ii) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (i), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(iii) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (ii) at a final concentration of 100nM and treated at 37℃for 30min.
(iv) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (5) 2 O 2 ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank, showing that the absorbance was 0.753,0.745,0.732.
(v) Based on the standard curve obtained in example 5, the total Lactobacillus acetotolerans in the sample was calculated to be 8.77.+ -. 0.10log 10 CFU/mL。
(6) Lactobacillus acetotolerans content in qPCR quantitative sample
(i) Lactobacillus acetotolerans the microbial inoculum was obtained by the culture method in example 4, and the microbial concentration was measured by plate count method, and the genome extraction was the same as in example 4.
(ii) Lactobacillus acetotolerans genomic DNA was diluted by 10-fold gradient.
(iii) The qPCR system was SYBR Green 10. Mu.L, upstream and downstream primers 20. Mu.M, template DNA 0.5. Mu.L, and sterile water supplemented 20. Mu.L.
(iv) Reaction procedure for qPCR: pre-denaturation at 95 ℃ for 5min, cyclic stage: 95 ℃ for 5s and 60 ℃ for 20s; the cycle number was 40, and the dissolution profile was raised from 65℃to 95℃by 0.5℃every 5 seconds.
(v) qPCR was performed on the extracted genome using Lactobacillus acetotolerans specific primers with a downstream sequence of AAAAAGCAGAGTGGAGAAAATACT (SEQ ID NO. 5) and a downstream sequence of CCAATAAAAAGAGCAACAGCA (SEQ ID NO. 6).
(vi) The genomic DNA was diluted 10-fold, and a standard curve of CT values and Lactobacillus acetotolerans strain concentration was established, as shown in FIG. 4, R 2 ＝0.99。
(vii) qPCR system and reaction conditions are the same as (iii), (iv). Based on CT value of end of reaction, lactobacillus is calculated by established standard curveThe concentration of acetoolerants in the sample was 8.71.+ -. 0.12log 10 CFU/g。
(7) By significance difference analysis, the results are shown in FIG. 6, with no significance difference (P < 0.05) between the three quantification methods
Example 12: detection limit for detection by using two different sequence signal probes
(1) Lactobacillus acetotolerans the microbial inoculum was obtained according to the cultivation method in example 4, and the microbial concentration was determined by plate count method, and the genome was extracted at a concentration of 7.49log10 CFU/mL as in example 4.
(2) The Lactobacillus acetotolerans genomic DNA was diluted by a 10-fold gradient to give a DNA template of 3.62log10 CFU/mL.
(3) The Lactobacillus acetotolerans signal probe provided by the invention has the sequence of
GGGTGGGTGGGTGGGTAAAAAGCAGAGTGGAGAAAATACT (SEQ ID NO. 1), the sequence of the quenching probe is AGTATTTTCTCCACTCTGCTTTTTACCCA (SEQ ID NO. 2). Adding 3.2log of the product obtained in (2) 10 CFU/mL Lactobacillus acetotolerans genomic DNA was subjected to a chromogenic reaction.
(4) Using the Lactobacillus acetotolerans signaling probe sequence (SEQ ID NO. 3)
GGGATTGGGATTGGGATTGGGAAAAAGCAGAGTGGAGAAAATACT, the quenching probe sequence is AGTATTTTCTCCACTCTGCTTTTTCCCAA (SEQ ID NO. 4). The 3.2log10CFU/mL Lactobacillus acetotolerans genomic DNA obtained in (2) was added to carry out a color reaction.
(5) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, final pH of 7.9) was added 4. Mu. L Lactobacillus acetotolerans genomic DNA (no sample DNA was added as a blank). Treating in water bath at 90deg.C for 10min. After adding 4. Mu.L of 20. Mu.M of different signaling probes, respectively, the reaction was carried out at 55℃for 30min.
(6) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (5), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(7) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (6) at a final concentration of 100nM, and the reaction was carried out at 37℃for 30min.
(8) And (5) color reaction. To the system at the end of the reaction of (7), reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM were added, respectively 2 O 2 ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank.
(9) The steps (5), (6), (7) and (8) were repeated 9 times, and the stability of the detection results was compared as shown in fig. 7. A Coefficient of Variation (CV) of the quantitative result based on the signal sequence of SEQ ID NO.3 was 0.83; the quantitative result variation coefficient based on the signal sequence of SEQ ID NO.1 is 0.03, and the detection effect is stable.
While the invention has been described with reference to the preferred embodiments, it is not limited thereto, and various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
SEQUENCE LISTING
<110> university of Jiangnan
<120> absolute quantitative probes, methods and uses thereof
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 40
<212> DNA
<213> Synthesis
<400> 1
gggtgggtgg gtgggtaaaa agcagagtgg agaaaatact 40
<210> 2
<211> 29
<212> DNA
<213> Synthesis
<400> 2
agtattttct ccactctgct ttttaccca 29
<210> 3
<211> 45
<212> DNA
<213> Synthesis
<400> 3
gggattggga ttgggattgg gaaaaagcag agtggagaaa atact 45
<210> 4
<211> 29
<212> DNA
<213> Synthesis
<400> 4
agtattttct ccactctgct ttttcccaa 29
Claims (14)
1. A set of probes, comprising a signaling probe and a quenching probe; the sequence of the signal probe is shown as SEQ ID NO. 1; the sequence of the quenching probe is shown as SEQ ID NO. 2.
2. A detection kit comprising the signaling probe and the quenching probe according to claim 1.
3. The test kit of claim 2, further comprising any one or more of the following: heme, buffer, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt, H 2 O 2 。
4. The method comprises the following steps ofLactobacillus acetotoleransA method for quantification, characterized in that the method uses the probe according to claim 1 or the detection kit according to any one of claims 2-3.
5. The method of quantification of claim 4, wherein the method comprises: melting DNA in the sample to be detected; adding excessive signal probes, and combining with target nucleotide fragments of a sample to be detected to form double chains, so that G quadruplex naked leakage is outside the sequence; adding enough quenching probes and unbound signaling probes to form double chains so as to destroy the G quadruplex structure; reaction form of G quadruplex and heme outside by naked leakageG quadruplex/heme mimetic enzyme with catalase activity, activity characterization in combination with catalaseLactobacillus acetotoleransIs a biomass of (a) and (b).
6. The method of quantification of claim 4, wherein the method is absolute quantification or relative quantification.
7. The method of quantification according to claim 6, wherein when the method is absolute quantification, further comprising: establishing the catalase activity or the index related to the catalase activity andLactobacillus acetotoleransa standard curve of biomass of (2); when the sample to be detected is detected, substituting the detected catalase activity or an index which is related to the catalase activity into a standard curve to obtain the sample to be detectedLactobacillus acetotoleransIs a biomass of (a) and (b).
8. The method according to claim 5 or 6, wherein the sample to be measured is a sample containing a bacterial cell or a genome.
9. The method of claim 5 or 6, wherein the sample to be assayed is a metagenomic sample.
10. The method of claim 8, wherein the sample is a fermented food product or a sample taken from a fermentation process of a fermented food product or an environmental sample.
11. The method of claim 9, wherein the sample is a fermented food product or a sample taken from a fermentation process of a fermented food product or an environmental sample.
12. The method of claim 10 or 11, wherein the fermented food is any one or more of the following: traditional fermented vegetables, fermented beverages, fermented rice and flour foods; the environmental sample is an environmental sample selected from intestinal tracts, soil and water bodies.
13. A method of using the kit of any one of claims 2-3, comprising: adding excessive signal probes into a sample to be detected of DNA melting for reacting for a period of time, so that the signal probes are combined with target fragments in the sample to be detected; then adding a sufficient amount of quenching probe to form double chains with the unbound signaling probe; adding heme, reacting for a period of time, adding ABTS and H 2 O 2 Reacting for a period of time, detecting the absorbance of the reactant, and combining the absorbance with the absorbance of the sampleLactobacillus acetotoleransQuantification was performed.
14. Detecting fermented food or environmental sampleLactobacillus acetotoleransA method of content comprising using the probe of claim 1, or the kit of claims 2-3; the fermented food is any one or more of the following: traditional fermented vegetables, fermented beverages, fermented rice and flour foods; the environmental sample is an environmental sample selected from intestinal tracts, soil and water bodies.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110163271.9A CN112899381B (en) | 2021-02-05 | 2021-02-05 | Absolute quantification probe, method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110163271.9A CN112899381B (en) | 2021-02-05 | 2021-02-05 | Absolute quantification probe, method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112899381A CN112899381A (en) | 2021-06-04 |
| CN112899381B true CN112899381B (en) | 2023-08-25 |
Family
ID=76123031
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110163271.9A Active CN112899381B (en) | 2021-02-05 | 2021-02-05 | Absolute quantification probe, method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112899381B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114292929B (en) * | 2021-11-30 | 2024-01-02 | 绍兴文理学院 | Molecular marker for quantifying lactobacillus-resistant bacteria and method for absolutely quantifying bacterial colony composition in yellow wine fermentation process |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105758922A (en) * | 2016-02-29 | 2016-07-13 | 北京农业质量标准与检测技术研究中心 | Photo-electrochemical DNA biosensor based lead ion determination method |
| CN109680082A (en) * | 2019-01-07 | 2019-04-26 | 江南大学 | A kind of lactobacillus specific data library and its application |
| CN112226523A (en) * | 2020-06-01 | 2021-01-15 | 广州南沙珠江啤酒有限公司 | Specific detection probe and kit for acetic acid-resistant lactobacillus and application of specific detection probe and kit |
-
2021
- 2021-02-05 CN CN202110163271.9A patent/CN112899381B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105758922A (en) * | 2016-02-29 | 2016-07-13 | 北京农业质量标准与检测技术研究中心 | Photo-electrochemical DNA biosensor based lead ion determination method |
| CN109680082A (en) * | 2019-01-07 | 2019-04-26 | 江南大学 | A kind of lactobacillus specific data library and its application |
| CN112226523A (en) * | 2020-06-01 | 2021-01-15 | 广州南沙珠江啤酒有限公司 | Specific detection probe and kit for acetic acid-resistant lactobacillus and application of specific detection probe and kit |
Non-Patent Citations (1)
| Title |
|---|
| A G-quadruplex DNAzyme-based colorimetric method for facile detection of Alicyclobacillus acidoterrestris;Tao Liu，et al;poyal society of chemistry;第139卷;第4315-4321页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112899381A (en) | 2021-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chen et al. | Metagenomic analysis reveals the impact of JIUYAO microbial diversity on fermentation and the volatile profile of Shaoxing-jiu | |
| Fang et al. | Deciphering the succession patterns of bacterial community and their correlations with environmental factors and flavor compounds during the fermentation of Zhejiang rosy vinegar | |
| Lv et al. | Microbial diversity of traditional fermentation starters for Hong Qu glutinous rice wine as determined by PCR-mediated DGGE | |
| Cocolin et al. | Direct profiling of the yeast dynamics in wine fermentations | |
| Kern et al. | Optimization of Matrix-assisted-laser-Desorption–Ionization-Time-Of-Flight Mass Spectrometry for the identification of bacterial contaminants in beverages | |
| CN112779349B (en) | Probe for absolute quantification of schizosaccharomyces pombe, kit and application | |
| CN112553362B (en) | Absolute quantitative probe for saccharomyces cerevisiae and application thereof | |
| CN112782145B (en) | Aspergillus tubingensis absolute quantitative probe and application thereof | |
| Nejati et al. | Quantification of major bacteria and yeast species in kefir consortia by multiplex TaqMan qPCR | |
| Shayevitz et al. | Barrel-induced variation in the microbiome and mycobiome of aged sour ale and imperial porter beer | |
| CN112899381B (en) | Absolute quantification probe, method and application thereof | |
| Riedl et al. | Bavarian wheat beer, an example of a special microbe habitat–cultivation, detection, biofilm formation, characterization of selected lactic acid bacteria hygiene indicators and spoilers | |
| Garcia-Garcia et al. | Distribution of lactobacillus and pediococcus in a brewery environment | |
| CN112458197B (en) | Kit for absolute quantification of fungi and application thereof | |
| CN112877459B (en) | Probe for absolute quantification of pichia kudriavzevii | |
| CN112501326B (en) | Probe, method and kit for absolute quantification of bacillus and application of probe and method and kit | |
| CN112924428B (en) | Probe, method and application for absolute quantification of zygosaccharomyces bailii | |
| CN112553353B (en) | Probes, methods and kits for absolute quantification of lactobacillus and application of probes, methods and kits | |
| CN112924429B (en) | Absolute quantitative probe and kit for Lactobacillus jin Shini | |
| CN112553352B (en) | Probe, method and kit for absolute quantification of bacterial microorganisms and application of probe, method and kit | |
| CN112538520B (en) | Absolute quantification method for microorganisms and application thereof | |
| CN112646923A (en) | Primer, kit and method for rapidly identifying and quantifying saccharomyces cerevisiae | |
| CN112695120A (en) | Primer, kit and method for rapid identification and quantification of saccharomyces cerevisiae | |
| CN113215152A (en) | Primer, probe and kit for absolute quantification of Rhizopus oryzae | |
| CN112608985A (en) | Primer and method for quickly identifying and quantifying schizosaccharomyces pombe |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |