CN112501326B

CN112501326B - Probe, method and kit for absolute quantification of bacillus and application of probe and method and kit

Info

Publication number: CN112501326B
Application number: CN202011459493.7A
Authority: CN
Inventors: 吴群; 徐岩; 杜如冰
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2020-12-11
Filing date: 2020-12-11
Publication date: 2023-07-25
Anticipated expiration: 2040-12-11
Also published as: CN112501326A

Abstract

The invention discloses a probe, a method and a kit for absolute quantification of bacillus and application thereof, belonging to the fields of biology, fermentation and detection. The bacillus microorganism quantitative probe and the kit can realize the total detection of all bacillus microorganisms, do not need expensive instruments when being used for detecting and quantifying the bacillus microorganisms, and can rapidly complete the quantitative work within 2.5 hours. Meanwhile, the sample used in the present invention does not have to be subjected to nucleic acid extraction. The probe and the detection kit based on the invention are used for the microbial quantification of bacillus and have the characteristics of rapidness, convenience, cheapness and accuracy.

Description

Probe, method and kit for absolute quantification of bacillus and application of probe and method and kit

Technical Field

The invention relates to an absolute quantification method of bacillus microorganisms, a kit and application thereof, belonging to the fields of biology, fermentation and detection.

Background

Bacillus is widely distributed in traditional fermented food brewing systems and participates in the metabolism and synthesis of various substrates in the fermentation process, such as degradation of macromolecular proteins, degradation of polysaccharides, synthesis of pyrazines, etc. Thus, regular succession of bacillus microorganisms is a fundamental guarantee for stable food quality. At present, the quantification of bacillus is mainly a fluorescent quantitative PCR method, and depends on a fluorescent quantitative PCR instrument, but the price is high, and the operation process is complex. In order to track the dynamic change rule in the bacillus re-fermentation process in real time and promote the stability and upgrading of products, it is very necessary to provide a simple, rapid and accurate quantitative method.

The principle of the G quadruplex/heme mimic enzyme activity detection is that the G quadruplex can form DNA mimic enzyme with catalase activity with heme, can catalyze hydrogen peroxide to oxidize ABTS to generate ABTS+, presents green color reaction, and can detect characteristic absorbance at the wavelength of 420 nm. The stability of the G quadruplex structure is critical to the whole detection process, if the design is improper, when the G quadruplex sequence forms a dimer with other bases, the G quadruplex sequence can not form the G quadruplex, and a quantitative method based on the principle can cause underestimation of the content of a target gene in a sample in use, and reduces the sensitivity and accuracy of the detection method.

At present, the principle based on G quadruplex/heme simulated enzyme activity detection has been reported to be used for specific detection of microorganisms; for example, literature Wang Y, li X, xi D, wang X.visual detection of Fusarium proliferatum based on asymmetric recombinase polymerase amplification and hemin/G-quad DNAzyme.Rsc Advances 2019;9:37144-37147, asymmetric specific primers are used (upstream primer added with reverse sequence modification of G quadruplex, downstream not modification), and the method is only applicable to detection of specific bacteria Fusarium proliferatum in a sample, and cannot realize total detection of all bacillus microorganisms; in addition, in the case of detection using this asymmetric specific primer, different concentrations of the upstream primer and the downstream primer (the concentration of the upstream primer is low and the concentration of the downstream primer is high) are added to a PCR system, and a double-stranded product is formed by Recombinant Polymerase Amplification (RPA) amplification, and as the PCR reaction proceeds, the upstream primer is consumed and the downstream primer is amplified using newly synthesized double-stranded DNA as a template, thereby forming single-stranded DNA with a G quadruplex end, and Fusarium proliferatum in a sample is detected using G quadruplex/heme-mimetic enzyme activity detection. However, this quantitative method still requires a PCR step to generate G quadruplexes, and the PCR process still requires high-volume PCR equipment and a strict operating environment.

Disclosure of Invention

The invention discloses a method, a kit and application for absolute quantification of bacillus microorganisms, which solve at least one of the following technical problems: (1) The existing method can not realize the total detection of all bacillus microorganisms; (2) The existing quantitative method has low species resolution and/or insufficient detection accuracy; (3) The existing quantitative method needs high-volume instruments and/or strict operation environment, and is not suitable for timely detection after production and sampling; (4) the existing quantitative method has complicated operation and the like.

It is a first object of the present invention to provide a set of probes, including signaling probes and quenching probes; the sequence of the signal probe is shown as SEQ ID NO.1 (GGGTGGGTGGGTGGGTAAAGCTGATTTGAAAGTCATTGGAGAT) or SEQ ID NO.3 (GGGATTGGGATTGGGATTGGGAAAGCTGATTTGAAAGTCATTGGAGAT).

In one embodiment, the quenching probe sequence is shown in SEQ ID NO.2 (ATCTCCAATGACTTTCAAATCAGCTTTACCCA) or SEQ ID NO.4 (ATCTCCAATGACTTTCAAATCAGCTTTCCCAA).

In one embodiment, the signaling probe sequence is shown as SEQ ID NO.1 and the quenching probe sequence is shown as SEQ ID NO. 2. Or SEQ ID NO.3, and the quenching probe sequence is shown as SEQ ID NO. 4.

It is a second object of the present invention to provide a method for quantifying bacillus microorganisms, said method comprising the use of the probe of the present invention.

The method comprises the following steps: melting DNA in the sample to be detected; adding excessive signal probes (with the sequence shown as SEQ ID NO.1 or SEQ ID NO. 3), and combining with a target nucleotide fragment of a sample to be detected to form double chains, so that the G quadruplex is exposed outside the sequence; adding enough quenching probes (with the sequence shown as SEQ ID NO.2 or SEQ ID NO. 4) to form double chains with unbound signaling probes, and destroying the G quadruplex structure; the naked leakage is utilized to react with heme to form G quadruplex/heme mimic enzyme with catalase activity, and the activity of the mimic enzyme is combined to characterize the biomass of bacillus microorganisms.

In one embodiment, the method is an absolute quantification method, further comprising: establishing a standard curve of catalase activity (or an index related to catalase activity, such as a light absorption value of a solution at a wavelength of 420nm after catalyzing oxidation of ABTS by hydrogen peroxide to generate ABTS+) and biomass of bacillus microorganisms; when a sample to be detected is detected, substituting the detected catalase activity into a standard curve to obtain the biomass of bacillus microorganisms in the sample to be detected.

In one embodiment, the method is a relative quantification method, further comprising: detecting a plurality of samples, and determining the relative value of the biomass of bacillus microorganisms in the different samples according to the relative ratio of the catalase activities detected by the different samples.

In one embodiment, the sample to be tested is a sample containing a cell, genome, metagenome, or the like. Optionally, the sample to be detected is a finished fermented food or a sample obtained in the fermentation process of the fermented food, or an environmental sample such as intestinal tract, soil, water body and the like; optionally, the sample to be measured is subjected to pretreatment such as centrifugation and bacterial cell collection, and then subjected to subsequent measurement. Preferably, the cells in the sample are collected and then subjected to DNA melting treatment directly without genome extraction.

In one embodiment, the sample is a fermented food product or a sample taken from the fermentation process of a fermented food product.

In one embodiment, the fermented food is any one or more of the following: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverage, alcoholic beverage, yoghurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd, fermented rice flour food and the like.

In one embodiment, the melting of the DNA in the sample to be tested is performed at an elevated temperature. Alternatively, the sample to be tested is treated at a temperature above 90 ℃. Can be any one of metal bath, water bath, oven, thermal insulation instrument and the like which can provide environment with corresponding temperature.

In one embodiment, the melting is performed in a buffer. Alternatively, the buffer may be Tris-HCl buffer, further containing KCl, NH ₄ Cl, naCl, or any one or more thereof. Alternatively, the buffer is Tris-HCl, KCl, ph=7.9.

In one embodiment, the excess is an amount of signaling probe added above that required to fully bind to the target nucleotide fragment of the test sample to form a duplex. The specific amounts used may be determined by one of ordinary skill in the art, in combination with one or more specific samples to be tested, or by pre-experimentation.

In one embodiment, the excess is in excess of 10 ¹⁰ And copies of the signaling probe.

In one embodiment, the binding of the signaling probe to the target nucleotide fragment of the test sample to form a double strand is performed at a temperature in the range of 50-60 ℃.

In one embodiment, the sufficient amount is an amount of quenching probe that is added in an amount sufficient to form a double strand with all unbound signaling probes. The specific amounts used may be determined by one of ordinary skill in the art in combination with the general knowledge in the art, or by specific samples to be tested, or by pre-experiments.

In one embodiment, the sufficient amount refers to a double amount of signaling probe.

In one embodiment, the adding a sufficient amount of the quenching probe to form a double strand with the unbound signaling probe is performed at a temperature that causes the quenching probe to form a double strand with the unbound signaling probe; the determination of a specific sample to be tested may be determined by a person skilled in the art in combination with the general knowledge in the art.

In one embodiment, the reaction of the G quadruplex with heme to form G quadruplex/heme mimic enzyme with catalase activity and the combination of catalase activity to characterize the biomass of bacillus microorganism means that after heme reaction is added into the system, ABTS and H are added ₂ O ₂ The catalase activity was then characterized by the absorbance of the reactant.

In one embodiment, the absorbance is at a wavelength of 420 nm.

In one embodiment, the quantification method specifically comprises:

(1) Carrying out DNA melting treatment on a sample to be detected;

(2) Adding a signal probe, and reacting for 30min at 55 ℃;

(3) Adding a quenching probe, and reacting for 30min at 55 ℃;

(4) Adding heme, and reacting at 37 ℃ for 30min;

(5) Adding in2, 2-azino-bis- (3-ethylbenzodihydrothiazoline-6-sulphonic acid) diammonium salt (ABTS) and H ₂ O ₂ Reacting at 37 ℃ for 30min;

(6) Detecting the absorbance value of the reactant at the wavelength of 420 nm;

(7) The bacillus microorganisms in the sample were quantified in combination with absorbance values.

In one embodiment, the quantification method further comprises: preparing samples with different known bacillus microorganism contents, and measuring absorbance values obtained by processing different samples by the method; drawing a standard curve of absorbance values and different bacillus microorganism contents; substituting the absorbance value obtained by the sample to be tested after the sample to be tested is processed by the method into a standard curve to obtain the bacillus microorganism content in the sample to be tested.

The third object of the invention is to provide a detection kit for absolute quantification of bacillus microorganisms, which contains the signaling probe with the sequence shown as SEQ ID NO.1 or SEQ ID NO. 3.

In one embodiment, the detection kit further comprises a quenching probe having a sequence as set forth in SEQ ID NO.2 or SEQ ID NO. 4.

In one embodiment, the detection kit further comprises any one or more of the following: heme, buffer, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS), H ₂ O ₂ . These reagents may not be contained, and an operator may prepare the kit separately when using the kit.

In one embodiment, the detection kit may comprise a buffer solution of Tris-HCl, KCl, and NH ₄ Cl, naCl, or any one or more thereof. Alternatively, the buffer is Tris-HCl, KCl, ph=7.9.

In one embodiment, the detection kit is a bacillus microorganism absolute quantification kit comprising simultaneously four reagents (reagent 1, reagent 2, reagent 3, reagent 4) and a set of bacillus microorganism quantification probes (signaling probes, quenching probes); the reagent 1 comprises heme; the reagent 2 comprises buffer (Tris-HCl)KCl, ph=7.9; wherein KCl may be replaced by NH ₄ Cl, naCl); the reagent 3 comprises 2, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS); the reagent 4 comprises H ₂ O ₂ 。

In one embodiment, the reagents or probes in the assay kit may be in a liquid or solid state, and may be routinely adjusted to appropriate concentrations by those skilled in the art when in use.

A fourth object of the invention is to provide a method of using the kit.

In one embodiment, the method of use comprises: adding excessive signal probes into a sample to be detected of DNA melting for reacting for a period of time, so that the signal probes are combined with target fragments in the sample to be detected; then adding a sufficient amount of quenching probe to form double chains with the unbound signaling probe; adding heme, reacting for a period of time, adding ABTS and H ₂ O ₂ And (3) reacting for a period of time, detecting the absorbance value of the reactant, and quantifying bacillus microorganisms in the sample by combining the absorbance value.

In one embodiment, the method includes adjusting the reagents and probes to a concentration suitable for use.

(1) Carrying out DNA melting treatment on a sample to be detected; (2) adding a signal probe, and reacting for 30min at 55 ℃; (3) adding a quenching probe, and reacting for 30min at 55 ℃; (4) adding heme, and reacting for 30min at 37 ℃; (5) Adding 2, 2-azino-bis- (3-ethylbenzodihydrothiazoline-6-sulphonic acid) diammonium salt (ABTS) and H ₂ O ₂ Reacting at 37 ℃ for 30min; (6) detecting the absorbance of the reactant at a wavelength of 420 nm; (7) The bacillus microorganisms in the sample were quantified in combination with absorbance values.

A fifth object of the invention is to provide the use of said kit in the quantification of bacillus microorganisms.

In one embodiment, the application is in the technical field of fermented foods or the technical field of detection of environmental microorganisms such as intestinal tracts, soil, water bodies and the like; optionally, the fermented food is any one or more of the following: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverage, alcoholic beverage, yoghurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd, fermented rice flour food and the like.

In one embodiment, the sample to be tested may be a sample containing a cell, genome, metagenome or the like. Optionally, the sample to be detected is a finished fermented food or a sample obtained from the fermentation process of the fermented food; optionally, the sample to be measured is subjected to pretreatment such as centrifugation and bacterial cell collection, and then subjected to subsequent measurement. Preferably, the cells in the sample are collected and then subjected to DNA melting treatment directly without genome extraction.

The beneficial effects are that:

the invention combines the G quadruplex with the specificity sequence to form a signal probe, the signal probe is combined with the target sequence to enable the G quadruplex to be exposed outside the sequence, a sufficient amount of quenching probe and unreacted signal probe are added to form double chains, the structure of the G quadruplex is destroyed, the G quadruplex/heme mimic enzyme is formed by reacting with heme, the catalase activity is shown, and the catalase activity is used for representing the biomass of microorganisms. The bacillus microorganism quantitative probe can realize the total detection of all bacillus microorganisms; further, a signaling probe was optimized with a sequence of GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO. 1) and a quenching probe of CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO. 2). Compared with the signal sequence of SEQ ID NO.3, the G quadruplex sequence in the signal probe of SEQ ID NO.1 does not generate additional space structure with the specific sequence (figure 1), and the detection accuracy is higher and the minimum detection limit is improved.

The probe of the invention is used for detecting and quantifying bacillus microorganisms without expensive instrument detection flow. The absolute quantitative kit for the microorganisms is also provided for the first time, and can finish quantitative work within 2.5 hours. The invention realizes microorganism quantification by combining a signal probe and a quenching probe in order to avoid using high-volume equipment such as a PCR instrument. The invention solves the problem that the existing microorganism quantitative means depend on expensive instruments and are very limited in practical use.

Furthermore, the invention can realize rapid bacillus microorganism detection, the sample does not need to be subjected to nucleic acid extraction, and only the microorganisms in the sample need to be eluted in the buffer solution to directly carry out subsequent experiments. Meanwhile, compared with the quantitative result of fluorescent quantitative PCR, the quantitative result obtained by the method has no significant difference.

In conclusion, the probe and the detection kit provided by the invention are used for the microbial quantification of bacillus and have the characteristics of rapidness, cheapness and accuracy.

Drawings

Fig. 1: signal probe dimer structure. (A) The G quadruplex sequence of SEQ ID NO.1 is not self-loop with the specific sequence; (B) The G quadruplex sequence of SEQ ID NO.3 is self-loop with the specific sequence.

Fig. 2: bacillus probe specificity

Fig. 3: based on a standard curve of the genome-extracted bacillus microorganism probe. (A) Taking Bacillus coagulans genome as a gradient dilution standard; (B) Gradient dilution standard with Bacillus licheniformis genome

Fig. 4: based on standard curves of bacillus microbial probes that do not extract the sample genome. (A) Taking Bacillus coagulans genome as a gradient dilution standard; (B) Gradient dilution standard with Bacillus licheniformis genome

Fig. 5: qPCR standard curve.

Fig. 6: comparing the bacillus microorganism probe quantification experiment based on genome extraction, the bacillus microorganism probe quantification experiment based on no sample genome extraction and the qPCR bacillus microorganism quantification experiment; wherein, (A) a Bacillus microorganism probe quantification experiment based on genome extraction, (B) a Bacillus microorganism probe quantification experiment based on no sample genome extraction, and (C) a qPCR Bacillus microorganism quantification experiment.

Fig. 7: the stability of the detection results of the probe (A) based on SEQ ID NO.1/SEQ ID NO.2 and the probe (B) based on SEQ ID NO.3/SEQ ID NO.4 were compared.

The specific embodiment is as follows:

example 1: bacillus microorganism quantitative probe combined reagent

A probe combination reagent; containing separately packaged signaling probe reagents and quenching probe reagents; wherein the sequence of the signal probe is shown as SEQ ID NO.1 or SEQ ID NO.3, and the sequence of the quenching probe is shown as SEQ ID NO.2 or SEQ ID NO. 4.

The signal probe reagent and the quenching probe reagent are dry powder or liquid; in the case of dry powders, the solution may be diluted to a suitable concentration prior to the experiment, for example, 20. Mu.M using sterile water or buffer; in the case of liquid form, the concentration may be 20 to 200. Mu.M, and the reagent may be diluted before use or used directly.

Example 2: bacillus microorganism quantitative kit and use thereof

The bacillus microorganism quantitative kit comprises a signal probe reagent and a quenching probe reagent which are independently packaged; wherein the sequence of the signal probe is shown as SEQ ID NO.1 or SEQ ID NO.3, and the sequence of the quenching probe is shown as SEQ ID NO.2 or SEQ ID NO. 4.

The kit can be used together with heme, buffer solution, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS), H ₂ O ₂ Is matched with the components.

The using method is as follows:

(1) And (5) solution preparation. Preparing a 100nM heme solution (reagent 1); preparing Tris-HCl with a final concentration of 50mM, KCl with a final concentration of 50mM and final pH of 7.9 (reagent 2); 7mM 2, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS) (reagent 3) and 7mM H ₂ O ₂ Solution (reagent 4); the solvents were all sterile water.

(2) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 was added 4. Mu.L of the sample genomic DNA, and the mixture was treated in a water bath at 90℃for 10 minutes. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.

(3) The quenching probe forms a double strand with the unbound signaling probe. The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (4), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.

(4) Forming heme/G quadruplex structure. Reagent 1 was added to the system after the reaction in the step (5) to a final concentration of 100nM, and the reaction was carried out at 37℃for 30min.

(5) And (5) color reaction. To the system at the end of the reaction of (4), a reagent (ABTS) having a final concentration of 7mM and a reagent 4 having a final concentration of 7mM were added, and the reaction was carried out at 37℃for 30 minutes to carry out the reaction (green).

Detecting the absorbance value of the reactant at the wavelength of 420 nm; the bacillus microorganisms in the sample were quantified in combination with absorbance values.

Of course, when absolute quantification is carried out, a standard curve of the absorbance value and the bacillus microorganism biomass can be drawn by itself, or the bacillus microorganism biomass can be obtained by directly converting the standard curve according to the recommended use method of the kit.

Example 3: bacillus microorganism quantitative kit

The kit also contains 100nM heme solution (reagent 1), tris-HCl buffer, 7mM 2, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS), 7mM H ₂ O ₂ A solution.

Example 4: specificity of the Bacillus microorganism quantification kit

(1) As positive controls, 5 bacillus microorganisms widely present in the fermented food samples were selected as Bacillus coagulans, bacillus licheniformis, bacillus tequilensis, bacillus subtilis, bacillus velezensis, respectively. 31 non-bacillus bacterial microorganisms and 7 fungal microorganisms that were widely present in the fermented samples were selected as negative controls, wherein 31 non-bacillus bacterial microorganisms included Lactobacillus buchneri, lactobacillus dioilvorans, lactobacillus brevis, lactobacillus crustorum, lactobacillus plantarum, lactobacillus harbinensis, lactobacillus acidiliscis, pediococcus ethanolidurans, pediococcus acidilactici, pediococcus pentosaceus, lactobacillus murinus, lactobacillus curvatus, lactobacillus casei, lactobacillus reuteri, lactobacillus panis, lactobacillus fermentum, lactobacillus johnsonii, lactobacillus delbrueckii, lactococcus lactis, weissella confusa, weissella paramesenteroides, weissella viridescens, leuconostoc citreum, leuconostoc lactis, leuconostoc mesenteroides, leuconostoc pseudomesenteroides, enterococcus italicus, enterococcus lactis, enterococcus faecalis, acetobacter pasteurianus, enterococcus faecium. The 7 fungal microorganisms include Aspergillus tubingensis, mucor rouxianius, schizosaccharomyces pombe, zygosaccharomyces bailii, pichia kudriavzevii, saccharomycopsis fibuligera, saccharomyces cerevisiae.

(2) The microorganisms are cultured by selecting different culture media according to habit, wherein Lactobacillus buchneri, lactobacillus dioilvorans, lactobacillus brevis, lactobacillus crustorum, lactobacillus plantarum, lactobacillus harbinensis, lactobacillus acidiliscis, pediococcus ethanolidurans, pediococcus acidilactici, pediococcus pentosaceus, lactobacillus murinus, lactobacillus curvatus, lactobacillus casei, lactobacillus reuteri, lactobacillus panis, lactobacillus fermentum, lactobacillus johnsonii, lactobacillus delbrueckii, lactococcus lactis, weissella confusa, weissella paramesenteroides, weissella viridescens, leuconostoc citreum, leuconostoc lactis, leuconostoc mesenteroides, leuconostoc pseudomesenteroides are prepared from MRS culture medium with tryptone 10.0g/L, beef extract 8.0g/L, yeast extract 4.0g/L, glucose 18.0g/L, anhydrous sorbitol oleate 0.8mL/L, K ₂ HPO ₄ 2.5g/L, sodium acetate trihydrate 6.0g/L, triammonium citrate 2.0g/L, mgSO ₄ ·7H ₂ O 0.3g/L，MnSO ₄ ·4H ₂ O0.08 g/L. The culture conditions were 30℃for 48 hours. Enterococcus italicus, enterococcus lactis, enterococcus faecalis, bacillus coagulans, bacillus licheniformis, bacillus tequilensis, bacillus subtilis, bacillus The Escherichia coli uses LB culture medium, wherein the formula of the culture medium is 10.0g/L peptone, 5g/L yeast powder and 10g/L sodium chloride. The culture conditions were 37℃for 24 hours. Aspergillus tubingensis Mucor rouxianus, schizosaccharomyces pombe, zygosaccharomyces bailii, pichia kudriavzevii, saccharomycopsis fibuligera, saccharomyces cerevisiae YPD medium was used, the medium formulation being 10g/L yeast extract, 20g/L peptone, 20g/L glucose. The culture conditions are as follows: the mold is cultured at 30 ℃ for 5 days, and the yeast is cultured at 30 ℃ for 2 days.

(3) Extraction of genomic DNA from a pure culture of a microorganism. Centrifuging the bacterial liquid at 12000rpm for 2min, and collecting precipitate. The genome of the pure cultures of 43 microorganisms was extracted according to the instructions of the gene extraction kit DNeasy Tissue Kit. (4) The probe was selected as a Bacillus probe, the signal probe sequence was GGGTGGGTGGGTGGGTAAAGCTGATTTGAAAGTCATTGGAGAT (SEQ ID NO. 1), and the quenching probe sequence was TCTCCAATGACTTTCAAATCAGCTTTACCCA (SEQ ID NO. 2).

(4) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9), 4. Mu.L of genomic DNA of different microorganisms was added, and the mixture was treated in a water bath at 90℃for 10 minutes. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.

(5) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (4), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.

(6) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (5) at a final concentration of 100nM and the reaction was treated at 37℃for 30min.

(7) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (6) ₂ O ₂ ) The treatment is carried out at 37 ℃ for 30min. As shown in FIG. 2, the test group to which the genome of Bacillus species was added showed a color development reaction, and the test group to which the genome DNA of non-Bacillus microorganism was added and the blank group showed no color developmentThe color reaction proves the specificity of the detection of bacillus microorganism in the kit.

Example 5: quantitative method accuracy assessment

1. Quantitative accuracy to Bacillus coagulans

(1) Bacillus coagulans bacterial liquid was obtained by the culture method in example 4, and the microorganism concentration was measured by plate count method, and genome extraction was the same as in example 4.

(2) Bacillus coagulans genomic DNA was diluted by 10-fold gradient.

(3) Probes of the genus bacillus were selected and developed using different concentrations of Bacillus coagulans genomic DNA as templates. The signal probe sequence was GGGTGGGTGGGTGGGTAAAGCTGATTTGAAAGTCATTGGAGAT (SEQ ID NO. 1) and the quench probe sequence was TCTCCAATGACTTTCAAATCAGCTTTACCCA (SEQ ID NO. 2).

(4) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, final pH of 7.9) was added 4. Mu.L of genomic DNA at different dilutions (no sample DNA added as a blank). Treating in water bath at 90deg.C for 10min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.

(6) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (5) to a final concentration of 100nM, and the reaction was treated at 37℃for 30min.

(7) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (6) ₂ O ₂ ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank.

(8) Constructing a standard curve by calculating the linear relation between the absorbance and the concentration of the bacterial liquid, as shown in figure 3A, R ² =0.99 (x is log ₁₀ CFU/mL，y is in OD ₄₂₀ A linear range of 10 ³ ～10 ⁷ ). The accuracy of the quantitative method of the kit provided by the invention is proved.

2. Quantitative accuracy to Bacillus licheniformis

(1) Bacillus licheniformis bacterial liquid was obtained by the culture method in example 4, and the microorganism concentration was measured by plate count method, and genome extraction was the same as in example 4.

(2) Bacillus licheniformis genomic DNA was diluted by 10-fold gradient.

(3) The chromogenic reaction was carried out with different concentrations of Bacillus licheniformis genomic DNA using probes of the genus Bacillus. The signal probe sequence was GGGTGGGTGGGTGGGTAAAGCTGATTTGAAAGTCATTGGAGAT (SEQ ID NO. 1) and the quench probe sequence was TCTCCAATGACTTTCAAATCAGCTTTACCCA (SEQ ID NO. 2). (4) the signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, final pH of 7.9) was added 4. Mu.L of genomic DNA at different dilutions (no sample DNA added as a blank). Treating in water bath at 90deg.C for 10min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.

(8) Constructing a standard curve by calculating the linear relation between the absorbance and the bacterial liquid concentration, as shown in figure 3B, R ² =0.99 (x is log ₁₀ (CFU/mL), y is the OD ₄₂₀ Linear ofIn the range of 10 ³ ～10 ⁷ ). The accuracy of the quantitative method of the kit provided by the invention is proved.

Example 6: quantitative experiments of Bacillus in Yoghurt samples

(1) Reference is made to Achilleos C, berthier f. Quantitive PCR for the specific quantification of Lactococcus lactis and Lactobacillus paracasei and its interest for Lactococcus lactis in cheese samples, food Microbiology 2013; the method of section 2.6 of 36:286-295. The genome of a yogurt sample from commercial sources is extracted. The genomic concentration was 205.89 ng/. Mu.L.

(2) The color reaction was performed using a probe of Bacillus. The signal probe sequence was GGGTGGGTGGGTGGGTAAAGCTGATTTGAAAGTCATTGGAGAT (SEQ ID NO. 1) and the quench probe sequence was TCTCCAATGACTTTCAAATCAGCTTTACCCA (SEQ ID NO. 2).

(4) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9) was added 4. Mu.L of yogurt metagenomic DNA (no sample DNA was added as a blank). Treating in water bath at 90deg.C for 10min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.

(7) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (7 mM H) at a final concentration of 7mM to the system at the end of the reaction of (6) ₂ O ₂ ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured by an ultraviolet spectrophotometer, and the experimental group without adding sample DNA was used as a blank, showing that the absorbance was 0.

(8) According to the standard curve obtained in example 5 (one), the total amount of microorganisms of the genus Bacillus in the sample was calculated to be 0log ₁₀ CFU/mL, obtained according to example 5 (II)Is calculated to be 0log of the total amount of Bacillus microorganisms in the sample ₁₀ CFU/mL。

(9) The bacillus in the same yoghurt sample was quantified by fluorescence quantification (quantification procedure and materials same as in example 13 (6)), and the presence of bacillus was not detected, which was substantially identical to the two data measured by the above method.

Example 7: absolute quantification of bacillus in fermented grain samples

(1) Reference is made to Song Z W, du H, zhang Y, xu Y. Unraveling core functional microbiota in traditional solid-state fermentation by high-throughput amplicons and metatranscriptomics sequencing. Front in microbiology 2017; the method in MATERIALS AND METHODS of 8:1294, extracting metagenome from fermented grains sample of Jingzhizhen town, shandong province, with genome concentration of 120.06 ng/. Mu.L.

(3) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9), 4. Mu.L of fermented grain metagenomic DNA (no sample DNA added as a blank) was added. Treating in water bath at 90deg.C for 10min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.

(4) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (3), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.

(5) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (4) at a final concentration of 100nM and the reaction was treated at 37℃for 30min.

(6) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (5) ₂ O ₂ ) The treatment is carried out at 37 ℃ for 30min. Measuring absorbance at 420nm by ultraviolet spectrophotometer toThe experimental group without sample DNA was used as a blank, and the absorbance was 0.425.

(7) According to the standard curve obtained in example 5 (one), the total amount of Bacillus microorganisms in the sample was calculated to be 4.13log ₁₀ CFU/mL, calculated from the standard curve obtained in example 5 (II), the total Bacillus microorganism amount in the sample was 3.96log ₁₀ CFU/mL。

(8) The bacillus in the same fermented grain sample was quantified by a fluorescent quantitation method (quantitation step and material same as in example 13 (6)), and the result showed that the total amount of bacillus microorganisms was 4.06log ₁₀ CFU/mL was substantially identical to the two sets of data measured by the method described above (coefficient of variation, cv=0.02).

Example 8: absolute quantification of bacillus in cheese samples

(1) Reference is made to Achilleos C, berthier f. Quantitive PCR for the specific quantification of Lactococcus lactis and Lactobacillus paracasei and its interest for Lactococcus lactis in cheese samples, food Microbiology 2013; section 2.6 of the method of 36:286-295, metagenome from commercially available cheese samples was extracted. Metagenomic concentration was 20.18 ng/. Mu.L.

(3) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9) was added 4. Mu.L of cheese metagenomic DNA (no sample DNA was added as a blank). Treating in water bath at 90deg.C for 10min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.

(6) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (7 mM H) at a final concentration of 7mM to the system at the end of the reaction of (5) ₂ O ₂ ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured using an ultraviolet spectrophotometer and the experimental group without sample DNA was used as a blank, showing that the absorbance was 025.

(7) According to the standard curve obtained in example 5 (one), the total amount of Bacillus in the sample was calculated to be 2.38log ₁₀ CFU/mL, calculated as the total Bacillus in the sample based on the standard curve obtained in example 5 (II) was 2.26log ₁₀ CFU/mL。

(8) The same cheese sample was quantified for Bacillus by fluorescence quantification (quantification procedure and material same as in example 13 (6)), which showed a total Bacillus amount of 2.23log ₁₀ CFU/mL, substantially identical to the two sets of data measured by the method described above (coefficient of variation, cv=2.33%).

Example 9: bacillus absolute quantification method based on non-extraction sample genome

1. Quantitative accuracy to Bacillus coagulans

(1) Bacillus coagulans bacterial liquid was obtained according to the culture method in example 4, and the microorganism concentration was measured by plate count method.

(2) Diluting Bacillus coagulans bacterial liquid in (1) by 10-time gradient

(3) The color reaction was performed using a probe of Bacillus. The signal probe sequence was GGGTGGGTGGGTGGGTAAAGCTGATTTGAAAGTCATTGGAGAT (SEQ ID NO. 1) and the quench probe sequence was TCTCCAATGACTTTCAAATCAGCTTTACCCA (SEQ ID NO. 2).

(4) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9) was added 10. Mu.L of different dilutions of bacterial solution (no sample bacterial solution was added as a blank). Treating in boiling water bath for 20min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.

(8) Constructing a standard curve by calculating the linear relation between the absorbance and the concentration of the bacterial liquid, as shown in FIG. 4A, R ² =0.99 (x is log ₁₀ CFU/mL, y is OD ₄₂₀ A linear range of 10 ³ ～10 ⁷ ). Proved by the accuracy of the quantitative method of the kit

2. Quantitative accuracy to Bacillus velezensis

(1) Bacillus velezensis the bacterial liquid was obtained according to the culture method in example 4, and the bacillus concentration was measured by plate count method.

(2) Diluting Bacillus velezensis bacterial liquid in (1) by 10-time gradient

(8) Constructing a standard curve by calculating the linear relation between the absorbance and the concentration of the bacterial liquid, as shown in FIG. 4B, R ² =0.99 (x is log ₁₀ CFU/mL, y is OD ₄₂₀ A linear range of 10 ³ ～10 ⁷ ). The accuracy of the quantitative method of the kit provided by the invention is proved.

Example 10: bacillus absolute quantification method based on non-extracted sample genome for measuring bacillus content in yoghurt sample

(1) The sample is yoghurt purchased in a local supermarket, and the sample treatment method comprises the following steps: to 1mL of the sample, 5mL of phosphate buffer was added, and the cells were collected by centrifugation at 3000 Xg for 10 min.

(2) And (5) washing. To the cells obtained in (1), 5mL of phosphate buffer was added, and the cells were collected by centrifugation at 12000 Xg for 2min and repeated.

(3) The cells were resuspended, and 1mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and pH 7.9) was added to the cells obtained in (2), followed by air-aspiration and mixing.

(4) The color reaction was performed using a probe of bacillus. The signal probe sequence was GGGTGGGTGGGTGGGTAAAGCTGATTTGAAAGTCATTGGAGAT (SEQ ID NO. 1) and the quench probe sequence was TCTCCAATGACTTTCAAATCAGCTTTACCCA (SEQ ID NO. 2).

(5) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9) was added 10. Mu.L of a yogurt broth (no sample broth was added as a blank). Treating in boiling water bath for 20min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.

(6) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (5), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.

(7) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (6) at a final concentration of 100nM, and the reaction was carried out at 37℃for 30min.

(8) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (7) ₂ O ₂ ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured by an ultraviolet spectrophotometer, and the experimental group without adding sample DNA was used as a blank, showing that the absorbance was 0.

(9) According to the standard curve obtained in example 9 (one), the total Bacillus microorganisms in the sample was calculated to be 0log ₁₀ CFU/mL, calculated from the standard curve obtained in example 9 (II), the total Bacillus microorganism amount in the sample was 0log ₁₀ CFU/mL。

(10) The same yogurt sample was quantified for Bacillus by fluorescence quantification (quantification procedure and material same as in example 13 (6)), which showed that the total Bacillus microorganism was 0log ₁₀ CFU/mL, substantially identical to the two sets of data measured by the method described above (coefficient of variation, cv=1.38%).

Example 11: bacillus absolute quantification method based on non-extracted sample genome for measuring bacillus content in fermented grain sample

(1) The sample is derived from fermented grains of certain winery in Shandong Jing Zhizhen, and the sample treatment method is as follows: to 1g of the sample, 5mL of phosphate buffer was added, and the cells were collected by centrifugation at 3000 Xg for 10 min.

(5) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9), 10. Mu.L of fermented grain bacterial liquid (no sample bacterial liquid was added as a blank) was added. Treating in boiling water bath for 20min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.

(8) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (7) ₂ O ₂ ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured by an ultraviolet spectrophotometer, and the experimental group without adding sample DNA was used as a blank, showing that the absorbance was 0.422.

(9) According to the standard curve obtained in example 9 (one), the total Bacillus amount in the sample was calculated to be 3.95log ₁₀ CFU/mL, calculated as the total Bacillus microorganism count in the sample, based on the standard curve obtained in example 9 (II) was 3.79log ₁₀ CFU/mL。

(10) The same fermented grain sample was quantified for Bacillus by a fluorescent quantitative method (quantitative procedure and material same as in example 13 (6)), and the result showed that the total amount of Bacillus was 3.85log ₁₀ CFU/mL was substantially identical to the two sets of data measured by the method described above (coefficient of variation, cv=0.02).

Example 12: bacillus absolute quantification method based on non-extracted sample genome for measuring bacillus content in cheese sample

(1) The sample is cheese purchased in a local supermarket, and the sample treatment method is as follows: to 1g of the sample, 5mL of phosphate buffer was added, and the cells were collected by centrifugation at 3000 Xg for 10 min.

(5) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9) was added 10. Mu.L of cheese bacteria solution (no sample bacteria solution was added as a blank). Treating in boiling water bath for 20min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.

(8) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (7) ₂ O ₂ ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured by an ultraviolet spectrophotometer, and the experimental group without adding sample DNA was used as a blank, showing that the absorbance was 0.23.

(9) According to the standard curve obtained in example 9 (one), the total amount of Bacillus in the sample was calculated to be 2.10log ₁₀ CFU/mL, calculated as the total Bacillus in the sample based on the standard curve obtained in example 9 (II) was 1.98log ₁₀ CFU/mL。

(10) The same cheese sample was quantified for Bacillus microorganisms by fluorescence quantification (quantification procedure and material same as in example 13 (6)), which showed that the total amount of Bacillus microorganisms was 2.03log ₁₀ CFU/mL was substantially identical to the two sets of data measured by the method described above (coefficient of variation, cv=0.03).

Example 13: comparison of microorganism quantitative detection kit and fluorescent quantitative PCR detection result

(1) The samples are three white spirit fermented grain samples from the fermentation end point of a certain winery of Shandong Jing Zhi.

(2) Sample processing:

(i) Total genomes in three samples were extracted at genome concentrations of 369 ng/. Mu.L, 321.89 ng/. Mu.L, 590 ng/. Mu.L, respectively.

(ii) To 1g of the sample, 5mL of phosphate buffer was added, and the cells were collected by centrifugation at 3000 Xg for 10 min. To the obtained cells, 5mL of phosphate buffer was added, and the cells were collected by centrifugation at 12000 Xg for 2min and repeated. The cells were resuspended, and 1mL of the buffer solution of reagent 2 was added to the obtained cells, followed by air-aspiration and mixing.

(4) Assay based on kit quantification method without genome extraction.

(i) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9), 10. Mu.L of fermented grain bacterial liquid (no sample bacterial liquid was added as a blank) was added. Treating in boiling water bath for 20min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.

(ii) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (i), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.

(iii) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (ii) to a final concentration of 100mM, and the reaction was treated at 37℃for 30 minutes.

(iv) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (iii) ₂ O ₂ ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank, showing that the absorbance was 0.43,0.450,0.500.

(v) According to the standard curve obtained in example 9 (one), the total amount of Bacillus microorganisms in the sample was calculated to be 4.31.+ -. 0.35log ₁₀ CFU/mL。

(5) Kit quantitative method determination based on genome extraction

(i) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9), 4. Mu.L of fermented grain metagenomic DNA (no sample DNA added as a blank) was added. Treating in water bath at 90deg.C for 10min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.

(iii) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (ii) at a final concentration of 100nM and treated at 37℃for 30min.

(iv) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (5) ₂ O ₂ ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank, showing that the absorbance was 0.432,0.456,0.490.

(v) According to the standard curve obtained in example 5 (one), the total amount of Bacillus microorganisms in the sample was calculated to be 4.41.+ -. 0.34log ₁₀ CFU/mL。

(6) quantitative Bacillus microorganism content in qPCR samples

(i) Bacillus velezensis bacterial liquid was obtained by the culture method in example 4, and the microbial concentration was measured by plate count method, and genome extraction was the same as in example 4.

(ii) Bacillus velezensis genomic DNA was diluted by 10-fold gradient.

(iii) The qPCR system was SYBR Green 10. Mu.L, upstream and downstream primers 20. Mu.M, template DNA 0.5. Mu.L, and sterile water supplemented 20. Mu.L.

(iv) Reaction procedure for qPCR: pre-denaturation at 95 ℃ for 5min, cyclic stage: 95 ℃ for 5s and 60 ℃ for 20s; the cycle number was 40, and the dissolution profile was raised from 65℃to 95℃by 0.5℃every 5 seconds.

(v) qPCR was performed on the extracted genome using a Bacillus specific primer sequence having a downstream sequence of AAAGCTGATTTGAAAGTCATTGGAGAT (SEQ ID NO. 5) and a downstream sequence of GAGTGGCGAGCGTATCATAGTC (SEQ ID NO. 6).

(vi) The genomic DNA was diluted 10-fold, and a standard curve of CT values and Bacillus velezensis strain concentration was established, as shown in FIG. 4, R ² ＝0.99。

(vii) qPCR system and reaction conditions are the same as (iii), (iv). Based on the CT value of the end of the reaction, the concentration of the Bacillus microorganism in the sample was calculated to be 4.45.+ -. 0.46Lg (CFU/g) by the established standard curve.

(7) By significance difference analysis, the results are shown in FIG. 6, with no significance difference (P < 0.05) between the three quantification methods

Example 14: detection limit for detection by using two different sequence signal probes

Quantification was performed with signaling probes of different sequences, respectively.

(1) Bacillus velezensis bacterial liquid was obtained by the culture method in example 4, and the microbial concentration was measured by plate count method, and the genome at a concentration of 7.08log10 CFU/mL was extracted as in example 4.

(2) The Bacillus velezensis genomic DNA was diluted by a 10-fold gradient to give a DNA template of 2.08log10 CFU/mL.

(3) The sequence of the quenching probe was TCTCCAATGACTTTCAAATCAGCTTTACCCA (SEQ ID NO. 2) using a Bacillus signaling probe sequence of GGGTGGGTGGGTGGGTAAAGCTGATTTGAAAGTCATTGGAGAT (SEQ ID NO. 1). The 2.08log10 CFU/mL Bacillus velezensis genomic DNA obtained in (2) was added to carry out a color reaction.

(4) The Bacillus signal probe sequence GGGATTGGGATTGGGATTGGGAAAGCTGATTTGAAAGTCATTGGAGAT (SEQ ID NO. 3) and the quenching probe sequence ATCTCCAATGACTTTCAAATCAGCTTTCCCAA (SEQ ID NO. 4) were used. The 2.08log10 CFU/mL Bacillus velezensis genomic DNA obtained in (2) was added to carry out a color reaction.

(5) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, final pH of 7.9) was added 4. Mu. L Bacillus velezensis genomic DNA (no sample DNA was added as a blank). Treating in water bath at 90deg.C for 10min. After adding 4. Mu.L of 20. Mu.M of different signaling probes, respectively, the reaction was carried out at 55℃for 30min.

(8) And (5) color reaction. To the system at the end of the reaction of (7), reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM were added, respectively ₂ O ₂ ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank.

(9) Repeating the steps (5) (6) (7) (8) for 9 times, comparing the stability of the detection results, and basically realizing detection with a Coefficient of Variation (CV) of 24.92% based on the quantitative result of the signal sequence of SEQ ID NO.3 as shown in FIG. 7; the quantitative result coefficient of variation of the signal sequence based on SEQ ID NO.1 is 0.84%, and the detection effect is stable.

While the invention has been described with reference to the preferred embodiments, it is not limited thereto, and various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of Jiangnan

<120> an absolute quantitative probe of Bacillus, method, kit and use thereof

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 43

<212> DNA

<213> Synthesis

<400> 1

gggtgggtgg gtgggtaaag ctgatttgaa agtcattgga gat 43

<210> 2

<211> 32

<212> DNA

<213> Synthesis

<400> 2

atctccaatg actttcaaat cagctttacc ca 32

<210> 3

<211> 48

<212> DNA

<213> Synthesis

<400> 3

gggattggga ttgggattgg gaaagctgat ttgaaagtca ttggagat 48

<210> 4

<211> 32

<212> DNA

<213> Synthesis

<400> 4

atctccaatg actttcaaat cagctttccc aa 32

<210> 5

<211> 27

<212> DNA

<213> Synthesis

<400> 5

aaagctgatt tgaaagtcat tggagat 27

<210> 6

<211> 22

<212> DNA

<213> Synthesis

<400> 6

gagtggcgag cgtatcatag tc 22

Claims

1. A set of probes comprising a signaling probe and a quenching probe; the sequence of the signal probe is shown as SEQ ID NO. 1; the sequence of the quenching probe is shown as SEQ ID NO. 2.

2. A detection kit comprising the signaling probe and the quenching probe according to claim 1.

3. The test kit of claim 2, further comprising any one or more of the following: heme, buffer, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt, H ₂ O ₂ 。

4. A method for quantifying bacillus microorganisms, characterized in that it uses the probe according to claim 1 or the detection kit according to any one of claims 2 to 3.

5. The method of quantification of claim 4, wherein the method comprises: melting DNA in the sample to be detected; adding excessive signal probes, and combining with target nucleotide fragments of a sample to be detected to form double chains, so that G quadruplex is exposed outside the sequence; adding enough quenching probes and unbound signaling probes to form double chains so as to destroy the G quadruplex structure; the naked leakage is utilized to react with heme to form G quadruplex/heme mimic enzyme with catalase activity, and the activity of the mimic enzyme is combined to characterize the biomass of bacillus microorganisms.

6. The method of quantification of claim 4, wherein the method is absolute quantification or relative quantification.

7. The method of quantification according to claim 6, wherein when the method is absolute quantification, further comprising: establishing a standard curve of the catalase activity or an index which is related to the catalase activity and biomass of bacillus microorganisms; when a sample to be detected is detected, substituting the detected catalase activity or an index which is related to the catalase activity into a standard curve to obtain the biomass of bacillus microorganisms in the sample to be detected.

8. The method according to any one of claims 4 to 6, wherein the sample to be measured is a sample containing a cell or a genome.

9. The method according to any one of claims 4 to 6, wherein the sample to be assayed is a sample containing a metagenome.

10. The method of claim 8, wherein the sample is a fermented food or a sample obtained during fermentation of a fermented food, or an intestinal, soil, water environmental sample.

11. The method of claim 9, wherein the sample is a fermented food or a sample obtained during fermentation of a fermented food, or an intestinal, soil, water environmental sample.

12. The method of quantification according to claim 10 or 11, wherein the fermented food product is any one or more of the following: traditional fermented vegetables, fermented beverage, fermented rice and flour food.

13. A method of using the kit of any one of claims 2-3, comprising: adding excessive signal probe into DNA melting sample to be detected to react for a period of time to make the signal probeThe needle is combined with a target fragment in the sample to be detected; then adding a sufficient amount of quenching probe to form double chains with the unbound signaling probe; adding heme, reacting for a period of time, adding ABTS and H ₂ O ₂ And (3) reacting for a period of time, detecting the absorbance value of the reactant, and quantifying bacillus microorganisms in the sample by combining the absorbance value.

14. A method for detecting the microbial content of bacillus in a fermented food, intestinal tract, soil or water body, comprising using the probe of claim 1, or the kit of claims 2-3; the fermented food is any one or more of the following: traditional fermented vegetables, fermented beverage, fermented rice and flour food.