CN112553352B

CN112553352B - Probe, method and kit for absolute quantification of bacterial microorganisms and application of probe, method and kit

Info

Publication number: CN112553352B
Application number: CN202011459554.XA
Authority: CN
Inventors: 吴群; 徐岩; 杜如冰
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2020-12-11
Filing date: 2020-12-11
Publication date: 2023-07-25
Anticipated expiration: 2040-12-11
Also published as: CN112553352A

Abstract

The invention discloses a probe, a method and a kit for absolute quantification of bacterial microorganisms and application thereof, and belongs to the fields of biology, fermentation and detection. The bacterial microorganism quantitative probe and the kit can realize the total detection of all bacterial microorganisms, do not need expensive instruments when being used for detecting and quantifying the bacterial microorganisms, and can rapidly complete the quantitative work within 2.5 hours. Meanwhile, the sample used in the present invention does not have to be subjected to nucleic acid extraction. The probe and the detection kit based on the invention are used for quantifying bacterial microorganisms and have the characteristics of rapidness, convenience, cheapness and accuracy.

Description

Probe, method and kit for absolute quantification of bacterial microorganisms and application of probe, method and kit

Technical Field

The invention relates to a probe, a method and a kit for absolute quantification of bacterial microorganisms and application thereof, belonging to the fields of biology, fermentation and detection.

Background

In the traditional fermentation food brewing process, complex microbial flora participates, wherein bacteria are important functional microorganisms. These microorganisms are closely related to the quality of the final product, and during the fermentation process, bacterial microorganisms participate in a series of physiological and biochemical reactions related to degradation of substrates and synthesis of the products, so that macromolecules such as available glycogen and proteins in the raw materials are converted into flavor components such as alcohols, aldehydes, acids and esters, and unique flavor and sensory characteristics are given to the product. Therefore, the real-time tracking of the growth variation trend of the bacterial microorganisms in the fermentation process has important guiding significance for controlling the fermentation process and optimizing the brewing process.

Currently, many methods are used to absolutely quantify microorganisms, such as biological substance label-based detection methods represented by phosphofatty acid detection (PLFA), ATP detection, biomass carbon detection (MBC); the quantitative method is based on biological gene markers, which is represented by high-throughput sequencing, confocal microscopy, flow cytometry and fluorescent quantitative PCR. However, the existing detection methods have the following defects: detection methods based on biomass labels have a low resolution in species, cannot distinguish the species of microorganism, and can only determine the total amount of all microorganisms. The quantitative method based on biological gene markers generally has higher detection limit (for example, the detection limit of fluorescent quantitative PCR can reach within 10 microorganisms), but requires high-volume instruments and strict operation environment, and is not suitable for timely detection after production sampling.

The principle of the G quadruplex/heme mimic enzyme activity detection is that the G quadruplex can form DNA mimic enzyme with catalase activity with heme, can catalyze hydrogen peroxide to oxidize ABTS to generate ABTS+, presents green color reaction, and can detect characteristic absorbance at the wavelength of 420 nm. The stability of the G quadruplex structure is critical to the whole detection process, if the design is improper, when the G quadruplex sequence forms a dimer with other bases, the G quadruplex sequence can not form the G quadruplex, and a quantitative method based on the principle can cause underestimation of the content of a target gene in a sample in use, and reduces the sensitivity and accuracy of the detection method.

At present, the principle based on G quadruplex/heme simulated enzyme activity detection has been reported to be used for specific detection of microorganisms; for example, in the literature Wang Y, li X, xi D, wang X. Visual detection of Fusarium proliferatum based on asymmetric recombinase polymerase amplification and hemin/G-quad DNAzyme, rsc Advances 2019;9:37144-37147, asymmetric specific primers (upstream primer adds reverse sequence modification of G quadruplex, downstream no modification) are used, and the method is only applicable to specific bacteria in a sampleFusarium proliferatumThe detection of the total amount of all bacterial microorganisms cannot be realized; in addition, in the case of detection using the asymmetric specific primer, different concentrations of upstream and downstream primers (low concentration of upstream primer and high concentration of downstream primer) are added to a PCR system, and a double-stranded product is formed by Recombinant Polymerase Amplification (RPA) amplification, and as the PCR reaction proceeds, the upstream primer is consumed and the downstream primer is amplified using newly synthesized double-stranded DNA as a template to form single-stranded DNA having a G quadruplex end, thereby detecting the presence of a G quadruplex/heme-mimetic enzyme activity in a sampleFusarium proliferatum. However, this quantitative method still requires a PCR step to generate G quadruplexes, and the PCR process still requires high-volume PCR equipment and a strict operating environment.

Disclosure of Invention

The invention discloses a method, a kit and application for absolute quantification of bacterial microorganisms, which solve at least one of the following technical problems: (1) The existing method can not realize the detection of the total amount of all bacterial microorganisms; (2) The existing quantitative method has low species resolution and/or insufficient detection accuracy; (3) The existing quantitative method needs high-volume instruments and/or strict operation environment, and is not suitable for timely detection after production and sampling; (4) the existing quantitative method has complicated operation and the like.

It is a first object of the present invention to provide a set of probes, including signaling probes and quenching probes; the sequence of the signal probe is shown as SEQ ID NO.1 (GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG) or SEQ ID NO.3 (GGGATTGGGATTGGGATTGGGACTCCTACGGGAGGCAGCAGTAGGG).

In one embodiment, the quenching probe sequence is shown in SEQ ID NO.2 (CCCTACTGCTGCCTCCCGTAGGAGTACCCA) or SEQ ID NO.4 (CCCTACTGCTGCCTCCCGTAGGAGTCCCAA).

In one embodiment, the signaling probe sequence is shown as SEQ ID NO.1 and the quenching probe sequence is shown as SEQ ID NO. 2. Or the signal probe sequence is shown as SEQ ID NO.3, and the quenching probe sequence is shown as SEQ ID NO.4

It is a second object of the present invention to provide a method for quantifying bacterial microorganisms, said method comprising the use of the probe of the present invention.

The method comprises the following steps: melting DNA in the sample to be detected; adding excessive signal probes (with the sequence shown as SEQ ID NO.1 or SEQ ID NO. 3), and combining with a target nucleotide fragment of a sample to be detected to form double chains, so that the G quadruplex is exposed outside the sequence; adding enough quenching probes (with the sequence shown as SEQ ID NO.2 or SEQ ID NO. 4) to form double chains with unbound signaling probes, and destroying the G quadruplex structure; the bare drain is used to react with heme to form G quadruplex/heme mimic enzyme with catalase activity, which is combined with the activity of catalase to characterize the biomass of bacterial microorganisms.

In one embodiment, the method is an absolute quantification method, further comprising: establishing a standard curve of catalase activity (or an index correlated with catalase activity, such as absorbance of a solution at wavelength 420 nm after catalyzing oxidation of ABTS by hydrogen peroxide to abts+) and biomass of a bacterial microorganism; when the sample to be detected is detected, substituting the detected catalase activity into a standard curve to obtain the biomass of the bacterial microorganism in the sample to be detected.

In one embodiment, the method is a relative quantification method, further comprising: a plurality of samples are tested, and the relative values of the biomass of the bacterial microorganisms in the plurality of different samples are determined according to the relative ratios of the catalase activities detected by the different samples.

In one embodiment, the sample to be tested is a sample containing a cell, genome, metagenome, or the like. Optionally, the sample to be detected is a finished fermented food or a sample obtained in the fermentation process of the fermented food, or an environmental sample such as intestinal tract, soil, water body and the like; optionally, the sample to be measured is subjected to pretreatment such as centrifugation and bacterial cell collection, and then subjected to subsequent measurement. Preferably, the cells in the sample are collected and then subjected to DNA melting treatment directly without genome extraction.

In one embodiment, the sample is a fermented food product or a sample taken from the fermentation process of a fermented food product.

In one embodiment, the fermented food is any one or more of the following: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverage, alcoholic beverage, yoghurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd, fermented rice flour food and the like.

In one embodiment, the melting of the DNA in the sample to be tested is performed at an elevated temperature. Alternatively, the sample to be tested is treated at a temperature above 90 ℃. Can be any one of metal bath, water bath, oven, thermal insulation instrument and the like which can provide environment with corresponding temperature.

In one embodiment, the melting is performed in a buffer. Alternatively, the buffer may be Tris-HCl buffer, further containing KCl, NH ₄ Cl, naCl, or any one or more thereof. Alternatively, the buffer is Tris-HCl, KCl, ph=7.9.

In one embodiment, the excess is an amount of signaling probe added above that required to fully bind to the target nucleotide fragment of the test sample to form a duplex. The specific amounts used may be determined by one of ordinary skill in the art, in combination with one or more specific samples to be tested, or by pre-experimentation.

In one embodiment, the excess is in excess of 10 ¹⁰ And copies of the signaling probe.

In one embodiment, the binding of the signaling probe to the target nucleotide fragment of the test sample to form a double strand is performed at a temperature in the range of 50-60 ℃.

In one embodiment, the sufficient amount is an amount of quenching probe that is added in an amount sufficient to form a double strand with all unbound signaling probes. The specific amounts used may be determined by one of ordinary skill in the art in combination with the general knowledge in the art, or by specific samples to be tested, or by pre-experiments.

In one embodiment, the sufficient amount refers to a double amount of signaling probe.

In one embodiment, the adding a sufficient amount of the quenching probe to form a double strand with the unbound signaling probe is performed at a temperature that causes the quenching probe to form a double strand with the unbound signaling probe; the determination of a specific sample to be tested may be determined by a person skilled in the art in combination with the general knowledge in the art.

In one embodiment, the reaction of the G quadruplex with heme to form G quadruplex/heme mimic enzyme with catalase activity and the combination of catalase activity to characterize the biomass of bacterial microorganism means that after heme reaction is added into the system, ABTS and H are added ₂ O ₂ The catalase activity was then characterized by the absorbance of the reactant.

In one embodiment, the absorbance is at wavelength 420 nm.

In one embodiment, the quantification method specifically comprises:

(1) Carrying out DNA melting treatment on a sample to be detected;

(2) Adding a signal probe, and reacting for 30 min at 55 ℃;

(3) Adding a quenching probe, and reacting for 30 min at 55 ℃;

(4) Adding heme, and reacting at 37 ℃ for 30 min;

(5) Adding 2, 2-azino-bis- (3-ethylbenzodihydrothiazoline-6-sulphonic acid) diammonium salt (ABTS) and H ₂ O ₂ Reacting at 37 ℃ for 30 min;

(6) Detecting the absorbance of the reactant at wavelength 420 nm;

(7) Bacterial microorganisms in the sample are quantified in combination with absorbance values.

In one embodiment, the quantification method further comprises: preparing samples with different known bacterial microorganism contents, and measuring absorbance values obtained by processing different samples by the method; drawing a standard curve of the absorbance value and the microbial content of different bacteria; substituting the absorbance value obtained by the sample to be tested after the sample to be tested is processed by the method into a standard curve to obtain the bacterial microorganism content in the sample to be tested.

The third object of the invention is to provide a detection kit for absolute quantification of bacterial microorganisms, which contains the signaling probe with the sequence shown as SEQ ID NO.1 or SEQ ID NO. 3.

In one embodiment, the detection kit further comprises a quenching probe having a sequence as set forth in SEQ ID NO.2 or SEQ ID NO. 4.

In one embodiment, the detection kit further comprises any one or more of the following: heme, buffer, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS), H ₂ O ₂ . These reagents may not be contained, and an operator may prepare the kit separately when using the kit.

In one embodiment, the detection kit may comprise a buffer solution of Tris-HCl, KCl, and NH ₄ Cl, naCl, or any one or more thereof. Alternatively, the buffer is Tris-HCl, KCl, ph=7.9.

In one embodiment, the detection kit is an absolute quantification kit of bacterial microorganisms, comprising simultaneously four reagents (reagent 1, reagent 2, reagent 3, reagent 4) and a set of bacterial microorganism quantification probes (signaling probes, quenching probes); the reagent 1 comprises heme; the reagent 2 comprises buffer (Tris-HCl, KCl, pH=7.9; wherein KCl can be replaced by NH) ₄ Cl, naCl); the reagent 3 comprises 2, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS); the reagent 4 comprises H ₂ O ₂ 。

In one embodiment, the reagents or probes in the assay kit may be in a liquid or solid state, and may be routinely adjusted to appropriate concentrations by those skilled in the art when in use.

A fourth object of the invention is to provide a method of using the kit.

In one embodiment, the method of use comprises: adding excessive signal probes into a sample to be detected of DNA melting for reacting for a period of time, so that the signal probes are combined with target fragments in the sample to be detected; then adding a sufficient amount of quenching probe to form double chains with the unbound signaling probe; adding heme, reacting for a period of time, adding ABTS and H ₂ O ₂ And (3) reacting for a period of time, detecting the absorbance value of the reactant, and quantifying bacterial microorganisms in the sample by combining the absorbance value.

In one embodiment, the method includes adjusting the reagents and probes to a concentration suitable for use.

(1) Carrying out DNA melting treatment on a sample to be detected; (2) adding a signal probe, and reacting for 30 min at 55 ℃; (3) adding a quenching probe, and reacting for 30 min at 55 ℃; (4) adding heme, and reacting for 30 min at 37 ℃; (5) Adding 2, 2-azino-bis- (3-ethylbenzodihydrothiazoline-6-sulphonic acid) diammonium salt (ABTS) and H ₂ O ₂ Reacting at 37 ℃ for 30 min; (6) detecting absorbance of the reactant at wavelength 420 nm; (7) Bacterial microorganisms in the sample are quantified in combination with absorbance values.

It is a fifth object of the present invention to provide the use of said kit for the quantification of bacterial microorganisms.

In one embodiment, the application is in the technical field of fermented foods or the technical field of detection of environmental microorganisms such as intestinal tracts, soil, water bodies and the like; optionally, the fermented food is any one or more of the following: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverage, alcoholic beverage, yoghurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd, fermented rice flour food and the like.

In one embodiment, the sample to be tested may be a sample containing a cell, genome, metagenome or the like. Optionally, the sample to be detected is a finished fermented food or a sample obtained from the fermentation process of the fermented food; optionally, the sample to be measured is subjected to pretreatment such as centrifugation and bacterial cell collection, and then subjected to subsequent measurement. Preferably, the cells in the sample are collected and then subjected to DNA melting treatment directly without genome extraction.

The beneficial effects are that:

the invention combines the G quadruplex with the specificity sequence to form a signal probe, the signal probe is combined with the target sequence to enable the G quadruplex to be exposed outside the sequence, a sufficient amount of quenching probe and unreacted signal probe are added to form double chains, the structure of the G quadruplex is destroyed, the G quadruplex/heme mimic enzyme is formed by reacting with heme, the catalase activity is shown, and the catalase activity is used for representing the biomass of microorganisms. The bacterial microorganism quantitative probe can realize the total detection of all bacterial microorganisms; further, a signaling probe was optimized with a sequence of GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO. 1) and a quenching probe of CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO. 2). Compared with the signal sequence of SEQ ID NO.3, the G quadruplex sequence in the signal probe of SEQ ID NO.1 does not generate additional space structure with the specific sequence (figure 1), and the detection accuracy is higher and the minimum detection limit is improved.

The probe of the invention is used for detection and bacterial microorganism quantification without expensive instrument detection flow. The absolute quantifying kit for the microorganisms is also provided for the first time, and can complete quantifying work within 2.5 h. The invention realizes microorganism quantification by combining a signal probe and a quenching probe in order to avoid using high-volume equipment such as a PCR instrument. The invention solves the problem that the existing microorganism quantitative means depend on expensive instruments and are very limited in practical use.

Furthermore, the invention can realize rapid bacterial microorganism detection, the sample does not need to be subjected to nucleic acid extraction, and only the microorganisms in the sample need to be eluted in the buffer solution to directly carry out subsequent experiments. Meanwhile, compared with the quantitative result of fluorescent quantitative PCR, the quantitative result obtained by the method has no significant difference.

In conclusion, the probe and the detection kit provided by the invention are used for quantifying bacterial microorganisms and have the characteristics of rapidness, cheapness and accuracy.

Drawings

Fig. 1: signal probe dimer structure. (A) The G quadruplex sequence of SEQ ID NO.1 is not self-loop with the specific sequence; (B) The G quadruplex sequence of SEQ ID NO.3 is self-loop with the specific sequence.

Fig. 2: and (5) verifying the specificity of the probe.

Fig. 3: a standard curve based on genome-extracted bacterial microorganism quantification. (A) To be used forEscherichia coliThe genome is a gradient dilution standard; (B) To be used forBacillus velezensisThe genome is a gradient dilution standard.

Fig. 4: based on a standard curve of bacterial microbial quantification without extraction of the sample genome. (A) To be used forEscherichia coliThe genome is a gradient dilution standard; (B) To be used forBacillus velezensisThe genome is a gradient dilution standard.

Fig. 5: qPCR standard curve.

Fig. 6: comparing the bacterial microbial probe quantification experiment based on genome extraction with the bacterial microbial probe quantification experiment based on no sample genome extraction; wherein, (A) a bacterial microbial probe quantification experiment based on genome extraction, (B) a bacterial microbial probe quantification experiment based on no sample genome extraction, and (C) a qPCR bacterial microbial quantification experiment.

Fig. 7: the stability of the detection results of the probe (A) based on SEQ ID NO.1/SEQ ID NO.2 and the probe (B) based on SEQ ID NO.3/SEQ ID NO.4 were compared.

The specific embodiment is as follows:

example 1: bacterial microorganism quantitative probe combined reagent

A probe combination reagent; containing separately packaged signaling probe reagents and quenching probe reagents; wherein the signal probe sequence is shown as SEQ ID NO.1 or SEQ ID NO.3, and the quenching probe sequence is shown as SEQ ID NO.2 (corresponding to the signal probe SEQ ID NO. 1) or SEQ ID NO.4 (corresponding to the signal probe SEQ ID NO. 3).

The signal probe reagent and the quenching probe reagent are dry powder or liquid; in the case of dry powders, the solution may be diluted to a suitable concentration prior to the experiment, for example, 20. Mu.M using sterile water or buffer; in the case of liquid form, the concentration may be 20 to 200. Mu.M, and the reagent may be diluted before use or used directly.

Example 2: bacterial microorganism quantitative kit and use thereof

A bacterial microorganism quantification kit comprising a separately packaged signaling probe reagent and a quenching probe reagent; wherein the sequence of the signal probe is shown as SEQ ID NO.1 or SEQ ID NO.3, and the sequence of the quenching probe is shown as SEQ ID NO.2 (corresponding to the signal probe SEQ ID NO. 1) or SEQ ID NO.4 (corresponding to the signal probe SEQ ID NO. 3).

The kit can be used together with heme, buffer solution, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS), H ₂ O ₂ Is matched with the components.

The using method is as follows:

(1) And (5) solution preparation. Preparing a heme solution (reagent 1) of 100 nM; preparing Tris-HCl with final concentration of 50 mM, KCl with final concentration of 50 mM and final pH of 7.9 (reagent 2); 7. 7 mM 2, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS) (reagent 3) to H of 7 mM ₂ O ₂ Solution (reagent 4); the solvents were all sterile water.

(2) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL, 4. Mu.L of the sample genomic DNA was added, and the mixture was treated in a water bath at 90℃for 10 minutes. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.

(3) The quenching probe forms a double strand with the unbound signaling probe. The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (2), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.

(4) Forming heme/G quadruplex structure. Reagent 1 with the final concentration of 100 nM is added into the system after the reaction in the step (3), and the reaction is treated for 30 min at 37 ℃.

(5) And (5) color reaction. To the system in which the reaction of (4) was completed, a reagent (ABTS) having a final concentration of 7 mM and a reagent 4 having a final concentration of 7 mM were added, and the mixture was treated at 37℃for 30 minutes to carry out a reaction (green).

Detecting the absorbance of the reactant at wavelength 420 nm; bacterial microorganisms in the sample are quantified in combination with absorbance values.

Of course, when absolute quantification is carried out, a standard curve of the absorbance value and the bacterial microorganism biomass can be drawn by itself, or the bacterial microorganism biomass can be directly converted according to the recommended use method of the kit and the standard curve.

Example 3: bacterial microorganism quantitative kit

The kit also contains 100 nM heme solution (reagent 1), tris-HCL buffer solution, 7 mM 2, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS), 7 mM H ₂ O ₂ A solution.

Example 4: specificity of bacterial microorganism quantitative probe and kit

(1) 36 bacterial species microorganisms widely present in the fermented food samples were selected as positive controls, respectivelyLactobacillus buchneri,Lactobacillus dioilvorans,Lactobacillus brevis,Lactobacillus crustorum,Lactobacillus plantarum,Lactobacillus harbinensis,Lactobacillus acidiliscis,Pediococcus ethanolidurans,Pediococcus acidilactici,Pediococcus pentosaceus,Lactobacillus murinus,Lactobacillus curvatus,Lactobacillus casei,Lactobacillus reuteri,Lactobacillus panis,Lactobacillus fermentum,Lactobacillus johnsonii,Lactobacillus delbrueckii,Lactococcus lactis,Weissella confusa,Weissella paramesenteroides,Weissella viridescens,Leuconostoc citreum,Leuconostoc lactis,Leuconostoc mesenteroides,Leuconostoc pseudomesenteroides,Enterococcus italicus,Enterococcus lactis,Enterococcus faecalis,Bacillus coagulans,Bacillus licheniformis,Bacillus tequilensis,Bacillus subtilis,Bacillus velezensis,Acetobacter pasteurianus,Enterococcus faecium. 7 fungus species widely present in the fermented food samples were selected as negative controls, respectivelyAspergillus tubingensis，Mucor rouxianus，Schizosaccharomyces pombe，Zygosaccharomyces bailii，Pichia kudriavzevii，Saccharomycopsis fibuligera，Saccharomyces cerevisiae。

(2) The above microorganisms are cultured in different culture media, whereinLactobacillus buchneri,Lactobacillus dioilvorans,Lactobacillus brevis,Lactobacillus crustorum,Lactobacillus plantarum,Lactobacillus harbinensis,Lactobacillus acidiliscis,Pediococcus ethanolidurans,Pediococcus acidilactici,Pediococcus pentosaceus,Lactobacillus murinus,Lactobacillus curvatus,Lactobacillus casei,Lactobacillus reuteri,Lactobacillus panis,Lactobacillus fermentum,Lactobacillus johnsonii,Lactobacillus delbrueckii,Lactococcus lactis,Weissella confusa,Weissella paramesenteroides,Weissella viridescens,Leuconostoc citreum,Leuconostoc lactis,Leuconostoc mesenteroides,Leuconostoc pseudomesenteroidesUsing MRS culture medium, wherein the formula of the culture medium is tryptone 10.0 g/L, beef extract 8.0 g/L, yeast extract 4.0 g/L, glucose 18.0 g/L, anhydrous sorbitol oleate 0.8 mL/L, K ₂ HPO ₄ 2.5 g/L, sodium acetate trihydrate 6.0 g/L, triammonium citrate 2.0 g/L, mgSO ₄ ·7H ₂ O 0.3 g/L，MnSO ₄ ·4H ₂ O0.08 g/L. The culture conditions were 48 and h at 30 ℃.Enterococcus italicus,Enterococcus lactis,Enterococcus faecalis,Bacillus coagulans,Bacillus licheniformis,Bacillus tequilensis,Bacillus subtilis,Bacillus velezensis,Acetobacter pasteurianus,Enterococcus faecium，Escherichia coliLB culture medium is used, and the formula of the culture medium is peptone 10.0 g/L, yeast powder 5 g/L and sodium chloride 10 g/L. The culture conditions were 24℃and h.Aspergillus tubingensis，Mucor rouxianus，Schizosaccharomyces pombe，Zygosaccharomyces bailii，Pichia kudriavzevii，Saccharomycopsis fibuligera，Saccharomyces cerevisiaeYPD medium was used in the formulation of yeast extract 10 g/L, peptone 20 g/L, glucose 20 g/L. The culture conditions are as follows: the mold is cultured at 30 ℃ for 5 days, and the yeast is cultured at 30 ℃ for 2 days.

(3) And (5) extracting a single bacterial genome. The bacterial liquid was treated at 12000 rpm for 2 min, and the precipitate was collected. The genome of the 43 pure cultures of microorganisms was extracted using the gene extraction kit DNeasy Tissue Kit.

(4) The probe was selected as bacterial probe, the sequence of the signaling probe was GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO. 1), and the sequence of the quenching probe was CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO. 2).

(4) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9), 4. Mu.L of genomic DNA of different microorganisms was added, respectively, and the mixture was treated in a water bath at 90℃for 10 minutes. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.

(5) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (4), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.

(6) Forming heme/G quadruplex structure. Reagent 1 (heme) with a final concentration of 100 nM was added to the system after the reaction in the step (5), and the reaction was carried out at 37℃for 30 minutes.

(7) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction of (6) ₂ O ₂ ) The treatment is carried out at 37 ℃ for 30 min. As a result, the test group added with the bacterial genome showed chromogenic reaction, and the test group added with the fungal genome and the blank control group did not show chromogenic reaction, thus proving the specificity of the detection of the microorganism in the bacterial domain in the kit.

Example 5: quantitative method accuracy assessment

1. For a pair ofEscherichia coliQuantitative accuracy of (2)

（1）Escherichia coliBacterial solutions were obtained according to the culture method in example 4, and bacterial concentrations were measured by plate count method, and genome extraction was the same as in example 4.

(2) Dilution by 10-fold gradientEscherichia coliGenomic DNA.

(3) Probes using bacterial domains at different concentrationsEscherichia coliGenomic DNA was subjected to a chromogenic reaction. The signal probe sequence was GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO. 1) and the quench probe sequence was CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO. 2).

(4) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, final pH of 7.9) was added 4. Mu.L of different dilutions of genomic DNA (no sample DNA added as a blank). Treating in water bath at 90deg.C for 10 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.

(6) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction in step (5) to a final concentration of 100 nM, and the reaction was carried out at 37℃for 30 minutes.

(7) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction of (6) ₂ O ₂ ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420 and nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank.

(8) Constructing a standard curve by calculating the linear relation between the absorbance and the concentration of the bacterial liquid, as shown in figure 3A, R ² =0.99 (x is log10 CFU/mL, y is OD ₄₂₀ A linear range of 10 ³ ~10 ⁷ ). The accuracy of the quantitative method of the kit provided by the invention is proved.

2. For a pair ofBacillus velezensisQuantitative accuracy of (2)

（1）Bacillus velezensisBacterial solutions were obtained according to the culture method in example 4, and bacterial concentrations were measured by plate count method, and genome extraction was the same as in example 4.

(2) Dilution by 10-fold gradient Bacillus velezensisGenomic DNA.

(3) Probes using bacterial domains at different concentrationsBacillus velezensisGenomic DNA was subjected to a chromogenic reaction. Signal probe sequence GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO. 1), quenchingThe probe sequence was CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO. 2).

(8) Constructing a standard curve by calculating the linear relation between the absorbance and the bacterial liquid concentration, as shown in figure 3B, R ² =0.99 (x is in lg (CFU/mL), y is in OD ₄₂₀ A linear range of 10 ³ ~10 ⁷ ). The accuracy of the quantitative method of the kit provided by the invention is proved.

Example 6: quantitative experiments of bacterial microorganisms in yogurt samples

(1) Reference is made to Achilleos C, berthier F. Quantitative PCR for the specific quantification ofLactococcus lactisandLactobacillus paracaseiand its interest forLactococcus lactisThe genome from a commercially available yoghurt sample was extracted by the method of section 2.6 of in cheese samples, food Microbiology 2013;36:286-295. The genomic concentration was 205.89 ng/. Mu.L.

(2) The chromogenic reaction is carried out using probes of the bacterial domain. The sequence of the signaling probe was GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO. 1) and the sequence of the quenching probe was CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO. 2).

(4) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, final pH of 7.9) was added 4. Mu.L of yogurt metagenomic DNA (no sample DNA was added as a blank). Treating in water bath at 90deg.C for 10 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.

(7) And (5) color reaction. Adding reagent 3 (ABTS) having a final concentration of 7 mM and reagent 4 (7 mM H) having a final concentration of 7 mM to the system at the end of the reaction of (6) ₂ O ₂ ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420. 420 nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0.86 using the experimental group without the sample DNA as a blank.

(8) Based on the standard curve obtained in example 5 (one), the total bacterial microorganism count in the sample was calculated to be 8.22 log ₁₀ CFU/mL, calculated from the standard curve obtained in example 5 (II), the total bacterial microorganism count in the sample was 8.11 log ₁₀ CFU/mL。

(9) The bacteria in the same yoghurt sample was quantified by fluorescence quantification (quantification step and material same as in example 13 (6)), which showed 8.01 log total bacterial microorganisms ₁₀ CFU/mL, substantially identical to the two sets of data measured by the method described above (coefficient of variation, cv=0.008).

Example 7: absolute quantification of bacterial domain microorganisms in fermented grain samples

(1) Referring to the method in MATERIALS AND METHODS of Song Z W, du H, zhang Y, xu Y Unraveling core functional microbiota in traditional solid-state fermentation by high-throughput amplicons and metatranscriptomics sequencing Frontiers in microbiology 2017, 8:1294, metagenome from fermented grain samples of Jingzhizhen, shandong province was extracted at a genome concentration of 100.02 ng/. Mu.L.

(3) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, final pH of 7.9) was added 4. Mu.L of fermented grain metagenomic DNA (no sample DNA added as a blank). Treating in water bath at 90deg.C for 10 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.

(4) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (3), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.

(5) Forming heme/G quadruplex structure. Reagent 1 (heme) with a final concentration of 100 nM was added to the system after the reaction in the step (4), and the reaction was carried out at 37℃for 30 minutes.

(6) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction of (5) ₂ O ₂ ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420 nm was measured using an ultraviolet spectrophotometer and the experimental group without sample DNA was used as a blank, showing that the absorbance was 0.678.

(7) Based on the standard curve obtained in example 5 (one), the total bacterial microorganism count in the sample was calculated to be 6.42 log ₁₀ CFU/mL, calculated from the standard curve obtained in example 5 (II), the total bacterial microorganism count in the sample was 6.34 log ₁₀ CFU/mL。

（8) The bacteria in the same fermented grain sample was quantified by a fluorescent quantitation method (quantitation step and material same as in example 13 (6)), and the result showed that the total amount of bacterial microorganisms was 6.33 log ₁₀ CFU/mL was substantially identical to the two sets of data measured by the method described above (coefficient of variation, cv=0.007).

Example 8: absolute quantification of bacterial domain microorganisms in cheese samples

(1) Reference is made to Achilleos C, berthier F. Quantitative PCR for the specific quantification ofLactococcus lactisandLactobacillus paracaseiand its interest forLactococcus lactisMetagenome from commercially available cheese samples was extracted by the method of section 2.6 of in cheese samples, food Microbiology 2013;36:286-295. Metagenomic concentration was 20.18 ng/. Mu.L.

(3) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, final pH of 7.9) was added 4. Mu.L of cheese metagenomic DNA (no sample DNA added as a blank). Treating in water bath at 90deg.C for 10 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.

(6) And (5) color reaction. Adding reagent 3 (ABTS) with a final concentration of 7 mM and reagent 4 (7 mM H) with a final concentration of 7 mM to the system at the end of the reaction of (5) ₂ O ₂ ) The treatment is carried out at 37 ℃ for 30 min. Determination of the absorption at wavelength 420 nm using an ultraviolet spectrophotometerThe absorbance was 0.564 with the blank control of the experimental group without sample DNA.

(7) According to the standard curve obtained in example 5 (one), the total bacterial microorganism count in the sample was calculated to be 5.29 log ₁₀ CFU/mL, calculated as 5.24 log total bacterial microorganisms in the sample based on the standard curve obtained in example 5 (II) ₁₀ CFU/mL。

(8) The bacteria in the same cheese sample was quantified by fluorescence quantification (quantification step and material same as in example 13 (6)), which showed 5.23 log total bacterial microorganisms ₁₀ CFU/mL was substantially identical to the two sets of data measured by the method described above (coefficient of variation, cv=0.006).

Example 9: absolute quantification method for bacterial domain microorganisms based on non-extraction of sample genome

1. For a pair ofEscherichia coliQuantitative accuracy of (2)

（1）Escherichia coliBacterial fluids were obtained according to the culture method in example 4 and the bacterial concentration was determined by plate counting.

(2) Dilution by 10-fold gradient in (1)Escherichia coliBacterial liquid

(3) The chromogenic reaction is carried out using probes of the bacterial domain. The sequence of the signaling probe was GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO. 1) and the sequence of the quenching probe was CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO. 2).

(4) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9) was added 10. Mu.L of different dilutions of bacterial solution (no sample bacterial solution was added as a blank). Treating in boiling water bath for 20 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.

(8) Constructing a standard curve by calculating the linear relation between the absorbance and the concentration of the bacterial liquid, as shown in FIG. 4A, R ² =0.99 (x is log10 CFU/mL, y is OD ₄₂₀ A linear range of 10 ³ ~10 ⁷ ). Proved by the accuracy of the quantitative method of the kit

2. For a pair ofBacillus velezensisQuantitative accuracy of (2)

（1）Bacillus velezensisBacterial fluids were obtained according to the culture method in example 4 and the bacterial concentration was determined by plate counting.

(2) Dilution by 10-fold gradient in (1)Bacillus velezensisBacterial liquid

(8) Constructing a standard curve by calculating the linear relation between the absorbance and the concentration of the bacterial liquid, as shown in FIG. 4B, R ² =0.99 (x is log10 CFU/mL, y is OD ₄₂₀ A linear range of 10 ³ ~10 ⁷ ). Proved by the accuracy of the quantitative method of the kit

Example 10: method for determining content of bacterial microorganisms in yoghurt sample based on absolute quantification method of bacterial domain microorganisms without extracting sample genome

(1) The sample is yoghurt purchased in a local supermarket, and the sample treatment method comprises the following steps: 1 mL sample was added with 5 mL phosphate buffer, 3000× gAnd (5) centrifuging for 10 min to collect the thalli.

(2) And (5) washing. To the cells obtained in (1), 5 mL phosphate buffer was added, and the cells were collected by centrifugation at 12000 Xg for 2 minutes and repeated.

(3) The cells were resuspended, and 1 mL reagent 2 (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9) was added to the cells obtained in (2), followed by air-aspiration and mixing.

(4) The chromogenic reaction is carried out using probes of the bacterial domain. The sequence of the signaling probe was GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO. 1) and the sequence of the quenching probe was CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO. 2).

(5) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9) was added 10. Mu.L of yogurt bacteria (no sample bacteria was added as a blank). Treating in boiling water bath for 20 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.

(6) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (5), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.

(7) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction in step (6) to a final concentration of 100 nM, and the reaction was carried out at 37℃for 30 minutes.

(8) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction of (7) ₂ O ₂ ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420. 420 nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0.84 using the experimental group without the sample DNA as a blank.

(9) According to the standard curve obtained in example 9 (one), the total bacterial microorganism count in the sample was calculated to be 8.28 log ₁₀ CFU/mL, calculated from the standard curve obtained in example 9 (II), the total bacterial microorganism count in the sample was 7.82 log ₁₀ CFU/mL。

(10) The bacteria in the same yoghurt sample was quantified by fluorescence quantification (quantification step and material same as in example 13 (6)), which showed 8.01 log total bacterial microorganisms ₁₀ CFU/mL was substantially identical to the two sets of data measured by the method described above (coefficient of variation, cv=0.029).

Example 11: method for determining content of bacterial microorganisms in fermented grain samples based on absolute quantification method of bacterial domain microorganisms without extracting sample genome

(1) The sample is derived from fermented grains of certain winery in Shandong Jing Zhizhen, and the sample treatment method is as follows: 5 mL phosphate buffer was added to the 1 g sample, and the cells were collected by centrifugation at 3000 Xg for 10 min.

(5) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9), 10. Mu.L of fermented grain broth (no sample broth added as a blank) was added. Treating in boiling water bath for 20 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.

(8) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction of (7) ₂ O ₂ ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420 nm was measured using an ultraviolet spectrophotometer and the experimental group without sample DNA was used as a blank, showing an absorbance of 0.772.

(9) According to the standard curve obtained in example 9 (one), the total bacterial microorganism count in the sample was calculated to be 7.60 log ₁₀ CFU/mL, calculated as 7.17 log total bacterial microorganisms in the sample based on the standard curve obtained in example 9 (II) ₁₀ CFU/mL。

(10) The bacteria in the same fermented grain sample were quantified by a fluorescent quantitation method (quantitation step and material same as in example 13 (6)), and the result showed that the total amount of bacterial microorganisms was 7.38 log ₁₀ CFU/mL, two sets of numbers determined by the method described aboveIs substantially uniform (coefficient of variation, cv=0.024).

Example 12: method for determining content of bacterial microorganisms in cheese sample based on absolute quantification method of bacterial domain microorganisms without extracting sample genome

(1) The sample is cheese purchased in a local supermarket, and the sample treatment method is as follows: 5 mL phosphate buffer was added to the 1 g sample, and the cells were collected by centrifugation at 3000 Xg for 10 min.

(5) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9) was added 10. Mu.L of cheese bacteria solution (blank control without sample bacteria solution). Treating in boiling water bath for 20 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.

(8) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction of (7) ₂ O ₂ ) The treatment is carried out at 37 ℃ for 30 min. Determination at wavelength 420 nm using an ultraviolet spectrophotometerThe absorbance below, which was a blank for the experimental group without sample DNA, showed a absorbance of 0.53.

(9) According to the standard curve obtained in example 9 (one), the total bacterial microorganism content in the sample was calculated to be 5.16 log ₁₀ CFU/mL, calculated as the total bacterial microorganism count in the sample was 4.84 log based on the standard curve obtained in example 9 (II) ₁₀ CFU/mL。

(10) The bacteria in the same cheese sample was quantified by fluorescence quantification (quantification step and material same as in example 13 (6)), which showed 5.10 log total bacterial microorganisms ₁₀ CFU/mL, substantially identical to the two sets of data measured by the method described above (coefficient of variation, cv=0.033).

Example 13: comparison of microorganism quantitative detection kit and fluorescent quantitative PCR detection result

(1) The samples are three white spirit fermented grain samples from the fermentation end point of a certain winery of Shandong Jing Zhi.

(2) Sample processing:

(i) Total genomes in three samples were extracted at genome concentrations of 369 ng/. Mu.L, 590 ng/. Mu.L, 321.89 ng/. Mu.L, respectively.

(ii) 5 mL phosphate buffer was added to the 1 g sample, and the cells were collected by centrifugation at 3000 Xg for 10 min. To the obtained cells, 5 mL phosphate buffer was added, and the cells were collected by centrifugation at 12000 Xg for 2 min and repeated. The cells were resuspended, and 1 mL reagent 2 buffer was added to the obtained cells, followed by air-aspiration and mixing.

(4) Assay based on kit quantification method without genome extraction.

(i) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9), 10. Mu.L of fermented grain broth (no sample broth added as a blank) was added. Treating in boiling water bath for 20 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.

(ii) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (i), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.

(iii) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction in step (ii) to a final concentration of 100 mM, and the reaction was carried out at 37℃for 30 minutes.

(iv) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction (iii) ₂ O ₂ ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420 nm was measured using an ultraviolet spectrophotometer and the experimental group without sample DNA was used as a blank, showing that the absorbance was 0.732,0.781,0.78.

(v) According to the standard curve obtained in example 9 (one), the total bacterial microorganism content in the sample was calculated to be 7.52.+ -. 0.28 log ₁₀ CFU/mL。

(5) Kit quantitative method determination based on genome extraction

(i) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, final pH of 7.9) was added 4. Mu.L of fermented grain metagenomic DNA (no sample DNA added as a blank). Treating in water bath at 90deg.C for 10 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.

(iii) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction in step (ii) to a final concentration of 100 nM, and the mixture was treated at 37℃for 30 minutes.

(iv) And (5) color reaction. Adding reagent 3 (ABT) with final concentration of 7 mM to the system after the reaction of (5)S) and reagent 4 (H) at a final concentration of 7 mM ₂ O ₂ ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420 nm was measured using an ultraviolet spectrophotometer and the experimental group without sample DNA was used as a blank, showing that the absorbance was 0.761,0.80,0.80.

(v) According to the standard curve obtained in example 5 (one), the total bacterial microorganism content in the sample was calculated to be 7.50.+ -. 0.22 log ₁₀ CFU/mL。

(6) quantitative bacterial microorganism content in the sample by qPCR

（i）Escherichia coliBacterial solutions were obtained according to the culture method in example 4, and bacterial concentrations were measured by plate count method, and genome extraction was the same as in example 4.

(ii) Dilution by 10-fold gradientEscherichia coliGenomic DNA.

(iii) The qPCR system was SYBR Green 10. Mu.L, upstream and downstream primers 0.4. Mu.L, template DNA 0.5. Mu.L, and sterile water was used to make up 20. Mu.L.

(iv) Reaction procedure for qPCR: pre-denaturation at 95 ℃ for 5 min, cycle phase: 95. c5 s,60 ℃ 20 s; the cycle number 40, the dissolution profile increased from 65 ℃ to 95 ℃, 0.5 ℃ per 5 s.

(v) qPCR was performed on the extracted genome using bacterial specific primers with a primer sequence of ACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO. 5) downstream and GACTACHVGGGTWTCTAAT (SEQ ID NO. 6) downstream.

(vi) Establishment by 10-fold gradient dilution of genomic DNACTValue and value ofEscherichia coliAs shown in FIG. 5, the standard curve of the fungus concentration, R ² =0.99。

(vii) qPCR system and reaction conditions are the same as (iii), (iv). Based on the CT value of the end of the reaction, the concentration of the bacterial microorganism in the sample was calculated to be 7.52.+ -. 0.39 Lg (CFU/g) by the established standard curve.

(7) The result is shown in figure 6, and the three quantitative methods have no significant differenceP<0.05）

Example 14: detection limit for detection by using two different sequence signal probes

Quantification was performed with signaling probes of different sequences, respectively.

（1）Escherichia coliBacterial solutions were obtained according to the culture method in example 4, and the bacterial concentration was determined by plate counting, and the genome at a concentration of 8.2 log10 CFU/mL was extracted as in example 4.

(2) Dilution by 10-fold gradientEscherichia coliGenomic DNA, 3.2 log10 CFU/mL of DNA template was obtained.

(3) With bacterial signaling probe sequence GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO. 1) and quenching probe sequence CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO. 2). Adding 3.2 log10 CFU/mL obtained in (2)Escherichia coliGenomic DNA was subjected to a chromogenic reaction.

(4) The bacterial signaling probe sequence (SEQ ID NO. 3) GGGATTGGGATTGGGATTGGGACTCCTACGGGAGGCAGCAGTAGGG and the quenching probe sequence (SEQ ID NO. 4) CCCTACTGCTGCCTCCCGTAGGAGTCCCAA were used. Adding 3.2 log10 CFU/mL obtained in (2)Escherichia coliGenomic DNA was subjected to a chromogenic reaction.

(5) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, final pH 7.9) was added 4. Mu.LEscherichia coliGenomic DNA (blank control without sample DNA). Treating in water bath at 90deg.C for 10 min. After adding 4. Mu.L of 20. Mu.M of different signaling probes, respectively, the reaction was carried out at 55℃for 30 min.

(8) And (5) color reaction. To the system in which the reaction of (7) was completed, reagent 3 (ABTS) having a final concentration of 7 mM and reagent 4 (H) having a final concentration of 7 mM were added, respectively ₂ O ₂ ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420 and nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank.

(9) The steps (5), (6), (7) and (8) were repeated 9 times, and the stability of the detection results was compared as shown in fig. 7. The variation Coefficient (CV) of the quantitative result of the signal sequence based on SEQ ID NO.3 is 11.33%, so that detection can be basically realized; the quantitative result variation coefficient based on the signal sequence of SEQ ID NO.1 is 0.95%, and the detection effect is stable.

While the invention has been described with reference to the preferred embodiments, it is not limited thereto, and various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of Jiangnan

<120> a probe, method, kit for absolute quantification of bacterial microorganism and use thereof

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 41

<212> DNA

<213> Synthesis

<400> 1

gggtgggtgg gtgggtactc ctacgggagg cagcagtagg g 41

<210> 2

<211> 30

<212> DNA

<213> Synthesis

<400> 2

ccctactgct gcctcccgta ggagtaccca 30

<210> 3

<211> 46

<212> DNA

<213> Synthesis

<400> 3

gggattggga ttgggattgg gactcctacg ggaggcagca gtaggg 46

<210> 4

<211> 30

<212> DNA

<213> Synthesis

<400> 4

ccctactgct gcctcccgta ggagtcccaa 30

<210> 5

<211> 25

<212> DNA

<213> Synthesis

<400> 5

actcctacgg gaggcagcag taggg 25

<210> 6

<211> 19

<212> DNA

<213> Synthesis

<400> 6

gactachvgg gtwtctaat 19

Claims

1. A set of probes comprising a signaling probe and a quenching probe; the sequence of the signal probe is shown as SEQ ID NO.1, and the sequence of the quenching probe is shown as SEQ ID NO. 2; or the sequence of the signal probe is shown as SEQ ID NO.3, and the sequence of the quenching probe is shown as SEQ ID NO. 4.

2. A detection kit comprising the signaling probe and the quenching probe according to claim 1.

3. The test kit of claim 2, further comprising any one or more of the following: heme, buffer, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt, H ₂ O ₂ 。

4. A method of using the kit of any one of claims 2-3, comprising: adding excessive signal probe into a sample to be detected of DNA melting to react for a period of timeTime, combining the signal probe with a target fragment in the sample to be detected; then adding a sufficient amount of quenching probe to form double chains with the unbound signaling probe; adding heme, reacting for a period of time, adding ABTS and H ₂ O ₂ For a period of time, detecting the absorbance of the reactant, and quantifying bacterial microorganisms in the sample in combination with the absorbance, which is not diagnostic.

5. A method for quantifying bacterial microorganisms, wherein the method uses the probe of claim 1 or the detection kit of any one of claims 2 to 3, and the method is not for diagnostic purposes.

6. The method of quantification of claim 5, wherein the method comprises: melting DNA in the sample to be detected; adding excessive signal probes, and combining with target nucleotide fragments of a sample to be detected to form double chains, so that G quadruplex naked leakage is outside the sequence; adding enough quenching probes and unbound signaling probes to form double chains so as to destroy the G quadruplex structure; the bare drain is used to react with heme to form G quadruplex/heme mimic enzyme with catalase activity, which is combined with the activity of catalase to characterize the biomass of bacterial microorganisms.

7. The method of quantification of claim 5, wherein the method is absolute quantification or relative quantification.

8. The method of quantification of claim 7, wherein when the method is absolute quantification, further comprising: establishing a standard curve of catalase activity or an index related to the catalase activity and biomass of the bacterial microorganism; when the sample to be detected is detected, substituting the detected catalase activity or an index which is related to the catalase activity into a standard curve to obtain the biomass of the bacterial microorganism in the sample to be detected.

9. The method according to any one of claims 5 to 7, wherein the sample to be measured is a sample containing a cell, a genome or a metagenome.

10. The method of claim 9, wherein the sample is a fermented food or a sample obtained during fermentation of a fermented food, or an intestinal, soil, water environmental sample.

11. The method of claim 10, wherein the fermented food product is any one of the following: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverage, alcoholic beverage, yoghurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd and fermented rice flour food.

12. A method of detecting bacterial microbial content in a fermented food product, gut, soil or water comprising using the probe of claim 1, or the kit of claims 2-3; the fermented food is any one of the following: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverage, alcoholic beverage, yoghurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd and fermented rice flour food, which are not used for diagnosis.