CN112553352B - Probe, method and kit for absolute quantification of bacterial microorganisms and application of probe, method and kit - Google Patents

Abstract

The invention discloses a probe, method, kit and application for the absolute quantification of bacteria and microorganisms, and belongs to the fields of biology, fermentation and detection. The bacterial microorganism quantitative probe and kit of the present invention can realize the total detection of all bacterial microorganisms, do not need to use expensive instruments when used for detection and bacterial microorganism quantification, and can quickly complete the quantitative work within 2.5 hours. At the same time, the samples used in the present invention do not necessarily undergo nucleic acid extraction. The probe and detection kit based on the present invention are used for the quantification of bacteria and microorganisms, and have the characteristics of fast, convenient, cheap and accurate.

Description

Probe, method, kit and application thereof for absolute quantification of bacterial microorganisms

technical field

The invention relates to a probe, method, kit and application for absolute quantification of bacteria and microorganisms, belonging to the fields of biology, fermentation and detection.

Background technique

There are complex microbial flora involved in the brewing process of traditional fermented food, among which bacteria are important functional microorganisms. These microorganisms are closely related to the quality of the final product. During the fermentation process, bacterial microorganisms participate in a series of physiological and biochemical reactions related to substrate degradation and product synthesis, and convert the available glycogen, protein and other macromolecules in raw materials into alcohols, aldehydes, acids, esters and other flavor components, giving the product unique flavor and sensory characteristics. Therefore, real-time tracking of the growth trend of bacteria and microorganisms during the fermentation process has important guiding significance for the control of the fermentation process and the optimization of the brewing process.

At present, many methods are used for absolute quantification of microorganisms, such as detection methods based on biological markers represented by phospho-fatty acid detection (PLFA), ATP detection, and biomass carbon detection (MBC); quantitative methods based on biological gene markers represented by high-throughput sequencing, confocal microscopy, flow cytometry, and fluorescent quantitative PCR. However, the current detection methods have shortcomings: the detection method based on biological substance markers has a low species resolution, cannot distinguish the types of microorganisms, and can only measure the total amount of all microorganisms. Quantitative methods based on biological gene markers generally have relatively high detection limits (for example, the detection limit of fluorescent quantitative PCR can reach within 10 microorganisms), but require high-cost equipment and strict operating environments, and are not suitable for timely detection after production sampling.

The principle of the G-quadruplex/heme mimic enzyme activity detection is that the G-quadruplex can form a DNA mimic enzyme with catalase activity with heme, which can catalyze the oxidation of ABTS by hydrogen peroxide to generate ABTS+, showing a green color reaction, and can detect the characteristic absorbance value at a wavelength of 420 nm. The stability of the G quadruplex structure is crucial to the entire detection process. If the design is improper, when the G quadruplex sequence forms a dimer with other bases, it will cause the G quadruplex sequence to fail to form a G quadruplex. Quantitative methods based on this principle will lead to underestimation of the content of the target gene in the sample and reduce the sensitivity and accuracy of the detection method.

目前，基于G四链体/血红素模拟酶活检测的原理有被用于微生物的特异性检测的报道；例如文献Wang Y, Li X, Xi D, Wang X. Visual detection of Fusariumproliferatum based on asymmetric recombinase polymerase amplification andhemin/G-quadruplex DNAzyme. Rsc Advances 2019;9:37144-37147.中，使用了不对称特异性引物（上游引物添加G四链体的反向序列修饰，下游不修饰），该方法只能适用于样本中特定细菌Fusarium proliferatum的检测，无法实现所有细菌微生物的总量检测；此外，该文献利用该不对称特异性引物进行检测时，是在PCR体系中添加不同浓度的上下游引物（上游引物浓度低，下游引物浓度高），通过重组聚合酶扩增（RPA）扩增形成双链产物，随着PCR反应的进行，上游引物被消耗殆尽，下游引物使用新合成的双链DNA为模板扩增，从而形成带有G四链体末端的单链DNA，从而使用G四链体/血红素模拟酶活检测检测样本中的Fusarium proliferatum 。 However, this quantitative method still requires a PCR step to generate a G quadruplex, and the PCR process still requires high-cost PCR equipment and a strict operating environment.

Contents of the invention

A method, kit and application for absolute quantification of bacteria and microorganisms of the present invention solve at least one of the following technical problems: (1) The existing methods cannot realize the total detection of all bacteria and microorganisms; (2) The existing quantitative methods have low species resolution and/or insufficient detection accuracy; (3) The existing quantitative methods require high-cost instruments and equipment and/or strict operating environments, and are not suitable for timely detection after production sampling; (4) The existing quantitative methods are cumbersome to operate, etc.

The first object of the present invention is to provide a set of probes, including a signal probe and a quencher probe; the sequence of the signal probe is shown in SEQ ID NO.1 (GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG) or SEQ ID NO.3 (GGGATTGGGATTGGGATTGGGACTCCTACGGGAGGCAGCAGTAGGG).

In one embodiment, the quenching probe sequence is shown in SEQ ID NO.2 (CCCTACTGCTGCCTCCCGTAGGAGTACCCA) or SEQ ID NO.4 (CCCTACTGCTGCCTCCCGTAGGAGTCCCAA).

In one embodiment, the signal probe sequence is shown in SEQ ID NO.1, and the quenching probe sequence is shown in SEQ ID NO.2. Or the signal probe sequence is shown in SEQ ID NO.3, and the quenching probe sequence is shown in SEQ ID NO.4

A second object of the present invention is to provide a method for the quantification of bacterial microorganisms, said method comprising the use of the probes of the present invention.

The method comprises: melting of DNA in the sample to be tested; adding an excess signal probe (sequence such as SEQ ID NO.1 or SEQ ID NO.3) to combine with the target nucleotide fragment of the sample to form a double strand, so that the G quadruplex is exposed outside the sequence; adding a sufficient amount of quenching probe (sequence such as SEQ ID NO.2 or SEQ ID NO.4) to form a double strand with the unbound signal probe, destroying the G quadruplex structure; A G-quadruplex/heme-mimetic enzyme of catalase activity, combined with catalase activity characterizes bacterial microbial biomass.

In one embodiment, the method is an absolute quantitative method, further comprising: establishing a standard curve of catalase activity (or an index correlated with catalase activity, such as the absorbance value of the solution at a wavelength of 420 nm after catalyzing ABTS by hydrogen peroxide oxidation to generate ABTS+) and the biomass of bacterial microorganisms; when detecting the sample to be tested, substituting the detected catalase activity into the standard curve to obtain the biomass of the bacterial microorganisms in the sample to be tested.

In one embodiment, the method is a relative quantitative method, further comprising: detecting a plurality of samples, and determining the relative value of the biomass of bacterial microorganisms in the plurality of different samples according to the relative ratio of catalase activity detected in different samples.

In one embodiment, the sample to be tested is a sample containing bacteria, genome or metagenomics. Optionally, the sample to be tested is a finished product of fermented food or a sample taken from the fermentation process of fermented food, or an environmental sample such as intestinal tract, soil, water body, etc.; optionally, the sample to be tested is subjected to pretreatment such as centrifugation and collection of bacteria before subsequent determination. Preferably, after the bacteria in the sample are collected, the DNA melting process is directly performed without genome extraction.

In one embodiment, the sample is a fermented food or a sample taken from a fermentation process of a fermented food.

In one embodiment, the fermented food is any one or more of the following: white wine, rice wine, soy sauce, beer, wine, vinegar, fermented tea, traditional fermented vegetables, fermented beverages, alcoholic beverages, yogurt, cheese, fruit vinegar, fermented rice, fermented soy sauce, curd, fermented rice noodle food, etc.

In one embodiment, the melting of the DNA in the sample to be tested is carried out in a high temperature manner. Optionally, the sample to be tested is processed at a temperature higher than 90°C. It can be any environment that can provide the corresponding temperature, such as a metal bath, a water bath, an oven, or an incubator.

In one embodiment, said melting is performed in a buffer. Optionally, the buffer may be a Tris-HCl buffer, further containing any one or more of KCl, NH ₄ Cl, and NaCl. Optionally, the buffer is Tris-HCl, KCl, pH=7.9.

In one embodiment, the excess refers to that the added amount is higher than the amount of the signal probe required to combine with all the target nucleotide fragments of the sample to be tested to form a double strand. The specific dosage can be determined by those skilled in the art in combination with common knowledge in the field or specific samples to be tested, or through preliminary experiments.

In one embodiment, the excess refers to more than 10 ¹⁰ copies of the signaling probe.

In one embodiment, the combination of the signal probe with the target nucleotide fragment of the sample to be tested to form a double strand is carried out at a temperature range of 50-60°C.

In one embodiment, the sufficient amount refers to the amount of the quenching probe required when the added amount is sufficient to form double strands with all unbound signal probes. The specific dosage can be determined by those skilled in the art in combination with common knowledge in the field or specific samples to be tested, or determined through preliminary experiments.

In one embodiment, the sufficient amount refers to double the amount of signaling probes.

In one embodiment, the addition of a sufficient amount of quenching probe to form a double strand with the unbound signal probe is carried out at a temperature that enables the quencher probe to form a double strand with the unbound signal probe; those skilled in the art can determine in combination with common knowledge in the field or specific samples to be tested.

In one embodiment, the use of the exposed G quadruplex to react with heme to form a G quadruplex/heme mimetic enzyme with catalase activity, combined with the activity of catalase to characterize the biomass of bacterial microorganisms refers to adding ABTS and _H2O2 to the system after adding heme to the system, and then characterizing the catalase activity through the absorbance value of the reactant _.

In one embodiment, the absorbance value is the absorbance value at a wavelength of 420 nm.

In one embodiment, the quantitative method is specifically:

(1) The sample to be tested is subjected to DNA melting treatment;

(2) Add the signal probe and react at 55 °C for 30 min;

(3) Add a quenching probe and react at 55 °C for 30 min;

(4) Add heme and react at 37 °C for 30 min;

(5) Add 2,2-azino-bis-(3-ethylbenzodihydrothiazoline-6-sulfonic acid) diammonium salt (ABTS) and H ₂ O ₂ , and react at 37°C for 30 minutes;

(6) Detect the absorbance value of the reactant at a wavelength of 420 nm;

(7) Quantify the bacterial microorganisms in the sample by combining the absorbance value.

In one embodiment, the quantitative method further includes: configuring samples with different known bacterial and microbial contents, measuring the absorbance values of different samples after being processed by the above method; drawing a standard curve between the absorbance values and different bacterial and microorganism contents; substituting the absorbance values obtained after the samples to be tested are processed by the above method into the standard curve, to obtain the contents of the bacteria and microorganisms in the samples to be tested.

The third object of the present invention is to provide a detection kit for the absolute quantification of bacterial microorganisms, which contains a signal probe of the sequence of the present invention such as SEQ ID NO.1 or SEQ ID NO.3.

In one embodiment, the detection kit further contains a quencher probe with a sequence such as SEQ ID NO.2 or SEQ ID NO.4.

In one embodiment, the detection kit further contains any one or more of the following: heme, buffer, 2,2-azino-bis-(3-ethylbenzodihydrothiazoline-6-sulfonic acid) diammonium salt (ABTS), H ₂ O ₂ . These reagents may not be included, and the operator must prepare them separately when using the kit.

In one embodiment, in the detection kit, the buffer may be Tris-HCl buffer, and may also contain any one or more of KCl, NH ₄ Cl, and NaCl. Optionally, the buffer is Tris-HCl, KCl, pH=7.9.

In one embodiment, the detection kit is a kit for absolute quantification of bacterial microorganisms, and the kit includes four reagents (reagent 1, reagent 2, reagent 3, reagent 4) and a set of quantitative probes for bacterial microorganisms (signal probe, quenching probe); the reagent 1 includes heme; the reagent 2 includes a buffer (Tris-HCl, KCl, pH=7.9; wherein KCl can be replaced by NH ₄ Cl, NaCl); the reagent 3 includes 2,2-azino-bis-(3-ethyl Benzodihydrothiazoline-6-sulfonic acid) diammonium salt (ABTS); said reagent 4 includes H ₂ O ₂ .

In one embodiment, in the detection kit, the reagent or probe may be in a liquid state or a solid state, and those skilled in the art can routinely adjust to an appropriate concentration during use.

The fourth object of the present invention is to provide a method for using the kit.

In one embodiment, the method of use includes: adding an excess signal probe to the unzipped DNA sample to react for a period of time, so that the signal probe binds to the target fragment in the sample to be tested; then adding a sufficient amount of quenching probe to form a double strand with the unbound signal probe; adding heme, reacting for a period of time, adding ABTS and H ₂ O ₂ , reacting for a period of time, detecting the absorbance value of the reactant, and quantifying the bacterial microorganisms in the sample based on the absorbance value.

In one embodiment, the method includes adjusting reagents and probes to concentrations suitable for use.

(1) The sample to be tested was subjected to DNA melting treatment; (2) Signal probe was added and reacted at 55 °C for 30 min; (3) Quenching probe was added and reacted at 55 °C for 30 min; (4) Heme _was added and reacted at 37 °C for 30 min; 30 min; (6) Detect the absorbance value of the _reactant at a wavelength of 420 nm; (7) Quantify the bacterial microorganisms in the sample by combining the absorbance value.

The fifth object of the present invention is to provide the application of the kit in the quantification of bacterial microorganisms.

In one embodiment, the application is in the technical field of fermented food, or in the technical field of detection of environmental microorganisms such as intestines, soil, and water; optionally, the fermented food is any one or more of the following: white wine, rice wine, soy sauce, beer, wine, vinegar, fermented tea, traditional fermented vegetables, fermented beverages, alcoholic beverages, yogurt, cheese, fruit vinegar, fermented rice, fermented soy beans, curd, fermented rice noodles, etc.

In one embodiment, during the application, the sample to be tested may be a sample containing bacteria, genome or metagenomics. Optionally, the sample to be tested is a finished product of fermented food or a sample taken from the fermentation process of fermented food; optionally, the sample to be tested is subjected to pretreatment such as centrifugation and collection of bacteria before subsequent determination. Preferably, after the bacteria in the sample are collected, the DNA melting process is directly performed without genome extraction.

Beneficial effect:

In the present invention, the G quadruplex is combined with a specific sequence to form a signal probe, the signal probe is combined with the target sequence so that the G quadruplex is exposed outside the sequence, and a sufficient amount of quenching probe is added to form a double strand with the unreacted signal probe, destroying the G quadruplex structure, and reacting with heme to form a G quadruplex/heme mimic enzyme, which exhibits catalase activity, and uses the catalase activity to characterize the biomass of microorganisms. The bacterial microorganism quantitative probe of the present invention can realize the total detection of all bacterial microorganisms; further, the signal probe is optimized, the signal probe sequence is GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO.1), and the quenching probe is CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO.2). Compared with the signal sequence of SEQ ID NO.3, the G quadruplex sequence in the signal probe of SEQ ID NO.1 does not produce an additional spatial structure with the specific sequence (Figure 1), and the detection accuracy is higher and the minimum detection limit is improved.

When the probe of the present invention is used for detection and quantification of bacterial microorganisms, the detection process of expensive instruments is not required. It also provides a kit for absolute quantification of microorganisms for the first time, which can complete the quantitative work within 2.5 hours. In order to avoid the use of high-cost equipment, such as a PCR instrument, the present invention realizes microbial quantification by combining signal probes and quenching probes. The invention solves the problem that the current microbiological quantification means rely on relatively expensive instruments and are very limited in the actual application process.

Further, the present invention can realize rapid detection of bacteria and microorganisms, the sample does not have to be subjected to nucleic acid extraction, only the microorganisms in the sample need to be eluted in the buffer, and subsequent experiments can be directly carried out. At the same time, compared with the quantitative results of fluorescent quantitative PCR, the quantitative results obtained by the present invention have no significant difference.

In summary, the probe and detection kit provided by the present invention are fast, cheap and accurate for the quantification of bacterial microorganisms.

Description of drawings

Figure 1: Signaling probe dimer structure. (A) The G-quadruplex sequence of SEQ ID NO.1 does not form a loop with the specific sequence; (B) The G-quadruplex sequence of SEQ ID NO.3 forms a loop with the specific sequence.

Figure 2: Probe specificity verification.

Figure 3: Standard Curve for Bacterial Microbiome Quantification Based on Genome Extraction. (A) Escherichia coli genome was used as serial dilution standard; (B) Bacillus velezensis genome was used as serial dilution standard.

Figure 4: Standard curve based on bacterial microbiome quantification without extracting sample genomes. (A) Escherichia coli genome was used as serial dilution standard; (B) Bacillus velezensis genome was used as serial dilution standard.

Figure 5: qPCR standard curve.

Figure 6: Comparison of bacterial microbial probe quantitative experiments based on genome extraction, bacterial microbial probe quantitative experiments based on non-extracted sample genomes, and qPCR bacterial microbial quantitative experiments; among them, (A) bacterial microbial probe quantitative experiments based on genome extraction, (B) bacterial microbial probe quantitative experiments based on non-extracted sample genomes, (C) qPCR bacterial microbial quantitative experiments.

Figure 7: Comparison of the stability of detection results based on the probe of SEQ ID NO.1/SEQ ID NO.2 (A) and the probe of SEQ ID NO.3/SEQ ID NO.4 (B).

Detailed ways:

Embodiment 1: Bacterial microorganism quantitative probe combination reagent

Probe combination reagent; containing independently packaged signal probe reagent and quenching probe reagent; wherein, the signal probe sequence is shown in SEQ ID NO.1 or SEQ ID NO.3, and the quenching probe sequence is shown in SEQ ID NO.2 (corresponding to signal probe SEQ ID NO.1) or SEQ ID NO.4 (corresponding to signal probe SEQ ID NO.3).

Signal probe reagents and quenching probe reagents are in dry powder or liquid form; when they are dry powders, they can be diluted to an appropriate concentration before the experiment, for example, diluted with sterile water or buffer solution to a concentration of 20 μM; in liquid form, the concentration can be 20-200 μM, and the reagents can be diluted before use, or used directly.

Embodiment 2: bacterial microorganism quantification kit and its use

The bacterial microorganism quantification kit contains independently packaged signal probe reagents and quenching probe reagents; wherein, the signal probe sequence is shown in SEQ ID NO.1 or SEQ ID NO.3, and the quenching probe sequence is shown in SEQ ID NO.2 (corresponding to signal probe SEQ ID NO.1) or SEQ ID NO.4 (corresponding to signal probe SEQ ID NO.3).

When the kit is used, it can be used in conjunction with heme, buffer, 2,2-azino-bis-(3-ethylbenzodihydrothiazoline-6-sulfonic acid) diammonium salt (ABTS), and H ₂ O ₂ .

The method of use is:

(1) Solution configuration. Prepare 100 nM heme solution (Reagent 1); prepare Tris-HCL with a final concentration of 50 mM, KCl with a final _{concentration} of 50 mM, and a final pH of 7.9 (Reagent 2); 7 mM 2,2-azino-bis-(3-ethylbenzodihydrothiazoline-6-sulfonic acid) diammonium salt (ABTS) (Reagent 3) and 7 mM _H2O2 solution (Reagent 4); the solvents are all sterile water.

(2) The signal probe forms a double strand with the sample DNA. Add 4 μL of sample genomic DNA to 2 mL of reagent 2, and treat in a water bath at 90 °C for 10 min. After adding 4 μL of 20 μM signal probe, react at 55 °C for 30 min.

(3) The quencher probe forms a double strand with the unbound signal probe. The quencher probe doubles with the unbound signal probe, disrupting the G quadruplex structure. Add 8 μL of 20 μM quenching probe to the system after the reaction in step (2), and react at 55 °C for 30 min.

(4) Formation of heme/G quadruplex structure. Add reagent 1 at a final concentration of 100 nM to the system after the reaction in step (3), and treat at 37 °C for 30 min.

(5) Color reaction. Add reagent (ABTS) with a final concentration of 7 mM and reagent 4 with a final concentration of 7 mM to the system after the reaction in (4), and treat at 37°C for 30 min to perform a display reaction (green).

Detect the absorbance value of the reactant at a wavelength of 420 nm; combine the absorbance value to quantify the bacterial microorganisms in the sample.

Of course, when performing absolute quantification, you can draw a standard curve between the absorbance value and the bacterial microbial biomass, or directly convert the bacterial microbial biomass according to the usage method and standard curve recommended by the kit.

Embodiment 3: bacterial microorganism quantification kit

The bacterial microorganism quantification kit contains independently packaged signal probe reagents and quenching probe reagents; wherein, the signal probe sequence is shown in SEQ ID NO.1 or SEQ ID NO.3, and the quenching probe sequence is shown in SEQ ID NO.2 (corresponding to signal probe SEQ ID NO.1) or SEQ ID NO.4 (corresponding to signal probe SEQ ID NO.3).

The kit also contains 100 nM heme solution (reagent 1), Tris-HCL buffer, 7 mM 2,2-azino-bis-(3-ethylbenzodihydrothiazoline-6-sulfonic acid) diammonium salt (ABTS), 7 mM _{H2O2 solution} .

Embodiment 4: the specificity of bacterial microorganism quantitative probe, kit

（1）选择发酵食品样本中广泛存在的36个细菌种微生物作为阳性对照，分别为Lactobacillus buchneri , Lactobacillus dioilvorans , Lactobacillus brevis , Lactobacillus crustorum , Lactobacillus plantarum , Lactobacillus harbinensis , Lactobacillus acidiliscis , Pediococcus ethanolidurans , Pediococcus acidilactici , Pediococcus pentosaceus , Lactobacillus murinus , Lactobacillus curvatus , Lactobacillus casei , Lactobacillus reuteri , Lactobacillus panis , Lactobacillus fermentum , Lactobacillus johnsonii , Lactobacillus delbrueckii , Lactococcus lactis , Weissella confusa , Weissella paramesenteroides , Weissella viridescens , Leuconostoc citreum , Leuconostoc lactis , Leuconostoc mesenteroides , Leuconostoc pseudomesenteroides , Enterococcus italicus , Enterococcus lactis , Enterococcus faecalis , Bacillus coagulans , Bacillus licheniformis , Bacillus tequilensis , Bacillus subtilis , Bacillus velezensis , Acetobacter pasteurianus , Enterococcus faecium 。 Seven fungal species widely present in fermented food samples were selected as negative controls, namely Aspergillus tubingensis , Mucor rouxianus , Schizosaccharomyces pombe , Zygosaccharomyces bailii , Pichia kudriavzevii , Saccharomycopsis fibuligera , and Saccharomyces cerevisiae .

（2）以上微生物选择不同的培养基进行培养，其中Lactobacillus buchneri , Lactobacillus dioilvorans , Lactobacillus brevis , Lactobacillus crustorum , Lactobacillus plantarum , Lactobacillus harbinensis , Lactobacillus acidiliscis , Pediococcus ethanolidurans , Pediococcus acidilactici , Pediococcus pentosaceus , Lactobacillus murinus , Lactobacillus curvatus , Lactobacillus casei , Lactobacillus reuteri , Lactobacillus panis , Lactobacillus fermentum , Lactobacillus johnsonii , Lactobacillus delbrueckii , Lactococcus lactis , Weissella confusa , Weissella paramesenteroides , Weissella viridescens , Leuconostoc citreum , Leuconostoc lactis , Leuconostoc mesenteroides , Leuconostoc pseudomesenteroides使用MRS培养基，培养基配方为胰蛋白胨10.0 g/L，牛肉浸膏8.0 g/L，酵母提取物4.0 g/L，葡萄糖18.0 g/L，无水山梨醇油酸酯0.8 mL/L，K ₂ HPO ₄ 2.5 g/L，三水合乙酸钠6.0 g/L，柠檬酸三铵2.0 g/L，MgSO ₄ ·7H ₂ O 0.3 g/L，MnSO ₄ ·4H ₂ O 0.08 g/L。 The culture condition was 30°C for 48 h. Enterococcus italicus , Enterococcus lactis , Enterococcus faecalis , Bacillus coagulans , Bacillus licheniformis , Bacillus tequilensis , Bacillus subtilis , Bacillus velezensis , Acetobacter pasteurianus , Enterococcus faecium , Escher ichia coli uses LB medium, the medium formula is peptone 10.0 g/L, yeast powder 5 g/L, and sodium chloride 10 g/L. The culture condition was 37°C for 24 h. Aspergillus tubingensis , Mucor rouxianus , Schizosaccharomyces pombe , Zygosaccharomyces bailii , Pichia kudriavzevii , Saccharomycopsis fibuligera , Saccharomyces cerevisiae use YPD medium, the medium formula is yeast extract 10 g/L, peptone 20 g/L, glucose 20 g/L L. The culture conditions were as follows: the mold was cultured at 30°C for 5 days, and the yeast was cultured at 30°C for 2 days.

(3) Single bacterial genome extraction. The above bacterial solution was treated at 12000 rpm for 2 min, and the precipitate was collected. The genomes of 43 microbial pure cultures were extracted using the gene extraction kit DNeasy Tissue Kit.

(4) The probe is selected as a bacterial probe, the sequence of the signal probe is GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO.1), and the sequence of the quenching probe is CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO.2).

(4) The signal probe forms a double strand with the sample DNA. Add 4 μL of genomic DNA of different microorganisms to 2 mL of reagent 2 (including Tris-HCL at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and a final pH of 7.9), and treat in a water bath at 90 °C for 10 min. After adding 4 μL of 20 μM signal probe, react at 55 °C for 30 min.

(5) The quencher probe forms a double strand with the unbound signal probe, destroying the G quadruplex structure. Add 8 μL of 20 μM quenching probe to the system after the reaction in step (4), and react at 55 °C for 30 min.

(6) Formation of heme/G quadruplex structure. Add reagent 1 (heme) at a final concentration of 100 nM to the system after the reaction in step (5), and treat at 37 °C for 30 min.

(7) Color reaction. Add reagent 3 (ABTS) with a final concentration of 7 mM and reagent 4 (H ₂ O ₂ ) with a final concentration of 7 mM to the system after the reaction in (6), and treat at 37°C for 30 min. Results As shown in Figure 2, the experimental group added with bacterial genomes had a color reaction, while the experimental group added with fungal genomes and the blank control group had no color reaction, which proved the specificity of the kit for detecting microorganisms in the bacterial domain.

Example 5: Quantitative method accuracy assessment

1. Quantitative accuracy of Escherichia coli

(1) The Escherichia coli bacterial liquid was obtained according to the cultivation method in Example 4, the bacterial concentration was determined by the plate counting method, and the extraction of the genome was the same as in Example 4.

(2) Escherichia coli genomic DNA was diluted by 10-fold gradient.

(3) Using the probes of the bacterial domain, the color reaction was carried out with different concentrations of Escherichia coli genomic DNA. The signal probe sequence is GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO.1), and the quenching probe sequence is CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO.2).

(4) The signal probe forms a double strand with the sample DNA. To 2 mL of Reagent 2 (including Tris-HCL at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and a final pH of 7.9), 4 μL of different dilutions of genomic DNA (without adding sample DNA was used as a blank control). Incubate in a water bath at 90°C for 10 min. After adding 4 μL of 20 μM signal probe, react at 55 °C for 30 min.

(5) The quencher probe forms a double strand with the unbound signal probe, destroying the G quadruplex structure. Add 8 μL of 20 μM quenching probe to the system after the reaction in step (4), and react at 55 °C for 30 min.

(6) Formation of heme/G quadruplex structure. Add reagent 1 (heme) at a final concentration of 100 nM to the system after the reaction in step (5), and treat at 37 °C for 30 min.

(7) Color reaction. Add reagent 3 (ABTS) with a final concentration of 7 mM and reagent 4 (H ₂ O ₂ ) with a final concentration of 7 mM to the system after the reaction in (6), and treat at 37°C for 30 min. The absorbance value at a wavelength of 420 nm was measured by an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank control.

(8) Construct a standard curve by calculating the linear relationship between the absorbance value and the bacterial concentration, as shown in Figure 3A, R ² =0.99 (the unit of x is log10 CFU/mL, the unit of y is OD ₄₂₀ , and the linear range is 10 ³ to 10 ⁷ ). Prove the accuracy of the kit quantitative method provided by the present invention.

2. Quantitative accuracy of Bacillus velezensis

(1) The bacterial liquid of Bacillus velezensis was obtained according to the cultivation method in Example 4, the bacterial concentration was determined by the plate counting method, and the extraction of the genome was the same as in Example 4.

(2) Bacillus velezensis genomic DNA was diluted by 10-fold gradient.

(3) Using bacterial domain probes, color reaction was performed with different concentrations of Bacillus velezensis genomic DNA. The signal probe sequence is GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO.1), and the quenching probe sequence is CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO.2).

(4) The signal probe forms a double strand with the sample DNA. To 2 mL of Reagent 2 (including Tris-HCL at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and a final pH of 7.9), 4 μL of different dilutions of genomic DNA (without adding sample DNA was used as a blank control). Incubate in a water bath at 90°C for 10 min. After adding 4 μL of 20 μM signal probe, react at 55 °C for 30 min.

(5) The quencher probe forms a double strand with the unbound signal probe, destroying the G quadruplex structure. Add 8 μL of 20 μM quenching probe to the system after the reaction in step (4), and react at 55 °C for 30 min.

(6) Formation of heme/G quadruplex structure. Add reagent 1 (heme) at a final concentration of 100 nM to the system after the reaction in step (5), and treat at 37 °C for 30 min.

(7) Color reaction. Add reagent 3 (ABTS) with a final concentration of 7 mM and reagent 4 (H ₂ O ₂ ) with a final concentration of 7 mM to the system after the reaction in (6), and treat at 37°C for 30 min. The absorbance value at a wavelength of 420 nm was measured by an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank control.

(8) Construct a standard curve by calculating the linear relationship between the absorbance value and the concentration of the bacterial solution, as shown in Figure 3B, R ² =0.99 (the unit of x is lg (CFU/mL), the unit of y is OD ₄₂₀ , and the linear range is 10 ³ ~10 ⁷ ). Prove the accuracy of the kit quantitative method provided by the present invention.

Embodiment 6: Quantitative experiment of bacterial microorganism in the yogurt sample

(1) Refer to the method in section 2.6 of Achilleos C, Berthier F. Quantitative PCR for the specific quantification of Lactococcus lactis and Lactobacillus paracasei and its interest for Lactococcus lactis in cheese samples. Food Microbiology 2013;36:286-295. The genome of the sample. Genome concentration was 205.89 ng/μL.

(2) Color reaction using probes from the bacterial domain. The sequence of the signal probe is GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO.1), and the sequence of the quenching probe is CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO.2).

(4) The signal probe forms a double strand with the sample DNA. To 2 mL of reagent 2 (including Tris-HCL at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and a final pH of 7.9), add 4 μL of yogurt metagenomic DNA (no sample DNA was added as a blank control). Incubate in a water bath at 90°C for 10 min. After adding 4 μL of 20 μM signal probe, react at 55 °C for 30 min.

(5) The quencher probe forms a double strand with the unbound signal probe, destroying the G quadruplex structure. Add 8 μL of 20 μM quenching probe to the system after the reaction in step (4), and react at 55 °C for 30 min.

(6) Formation of heme/G quadruplex structure. Add reagent 1 (heme) at a final concentration of 100 nM to the system after the reaction in step (5), and treat at 37 °C for 30 min.

(7) Color reaction. Add reagent 3 (ABTS) with a final concentration of 7 mM and reagent 4 (7 mM H ₂ O ₂ ) with a final concentration of 7 mM to the system after the reaction in (6), and treat at 37°C for 30 min. The absorbance value at a wavelength of 420 nm was measured by an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank control, and the absorbance value was 0.86.

(8) According to the standard curve obtained in Example 5 (1), the total amount of bacterial microorganisms in the sample is calculated to be 8.22log ₁₀ CFU/mL, and according to the standard curve obtained in Example 5 (2), the total amount of bacterial microorganisms in the sample is calculated to be 8.11log ₁₀ CFU/mL.

(9) The bacteria in the same yoghurt sample above were quantified by the fluorescence quantitative method (quantification steps and materials were the same as in Example 13 (6)). The results showed that the total amount of bacteria and microorganisms was 8.01 log ₁₀ CFU/mL, which was basically consistent with the two groups of data determined by the above method (coefficient of variation, CV=0.008).

Example 7: Absolute Quantification of Bacterial Domain Microorganisms in Fermented Grain Samples

(1) Refer to Song Z W, Du H, Zhang Y, Xu Y. Unraveling core functional microbiota in traditional solid-state fermentation by high-throughput amplicons and metatranscriptomics sequencing. Frontiers in microbiology 2017;8:1294 MATERIALS AND METHODS Methods: Metagenomes were extracted from fermented grains samples from Jingzhi Town, Shandong Province, and the genome concentration was 100.02 ng/μL.

(2) Color reaction using probes from the bacterial domain. The sequence of the signal probe is GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO.1), and the sequence of the quenching probe is CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO.2).

(3) The signal probe forms a double strand with the sample DNA. To 2 mL of reagent 2 (including Tris-HCL at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and a final pH of 7.9), add 4 μL of fermented grain metagenomic DNA (no sample DNA was added as a blank control). Incubate in a water bath at 90°C for 10 min. After adding 4 μL of 20 μM signal probe, react at 55 °C for 30 min.

(4) The quencher probe forms a double strand with the unbound signal probe, destroying the G quadruplex structure. Add 8 μL of 20 μM quenching probe to the system after the reaction in step (3), and react at 55 °C for 30 min.

(5) Formation of heme/G quadruplex structure. Add reagent 1 (heme) at a final concentration of 100 nM to the system after the reaction in step (4), and treat at 37 °C for 30 min.

(6) Color reaction. Add reagent 3 (ABTS) with a final concentration of 7 mM and reagent 4 (H ₂ O ₂ ) with a final concentration of 7 mM to the system after the reaction in (5), and treat at 37°C for 30 min. The absorbance value at a wavelength of 420 nm was measured by an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank control, and the absorbance value was 0.678.

(7) According to the standard curve obtained in Example 5 (1), the total amount of bacterial microorganisms in the sample is calculated to be 6.42log ₁₀ CFU/mL, and according to the standard curve obtained in Example 5 (2), the total amount of bacterial microorganisms in the sample is calculated to be 6.34log ₁₀ CFU/mL.

(8) Quantify the bacteria in the same fermented grains sample above by fluorescence quantification (quantification steps and materials are the same as those in Example 13 (6)). The results show that the total amount of bacterial microorganisms is 6.33 log ₁₀ CFU/mL, which is basically consistent with the two groups of data determined by the above method (coefficient of variation, CV=0.007).

Example 8: Absolute quantification of bacteria domain microorganisms in cheese samples

(1) Refer to the method in section 2.6 of Achilleos C, Berthier F. Quantitative PCR for the specific quantification of Lactococcus lactis and Lactobacillus paracasei and its interest for Lactococcus lactis in cheese samples. Food Microbiology 2013;36:286-295. Extract cheese samples from the market metagenome. The metagenomic concentration was 20.18 ng/μL.

(2) Color reaction using probes from the bacterial domain. The sequence of the signal probe is GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO.1), and the sequence of the quenching probe is CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO.2).

(3) The signal probe forms a double strand with the sample DNA. Add 4 μL of cheese metagenomic DNA to 2 mL of Reagent 2 (including Tris-HCL at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and a final pH of 7.9) (no sample DNA was added as a blank control). Incubate in a water bath at 90°C for 10 min. After adding 4 μL of 20 μM signal probe, react at 55 °C for 30 min.

(4) The quencher probe forms a double strand with the unbound signal probe, destroying the G quadruplex structure. Add 8 μL of 20 μM quenching probe to the system after the reaction in step (3), and react at 55 °C for 30 min.

(5) Formation of heme/G quadruplex structure. Add reagent 1 (heme) at a final concentration of 100 nM to the system after the reaction in step (4), and treat at 37 °C for 30 min.

(6) Color reaction. Add reagent 3 (ABTS) with a final concentration of 7 mM and reagent 4 (7 mM H ₂ O ₂ ) with a final concentration of 7 mM to the system after the reaction in (5), and treat at 37°C for 30 min. The absorbance value at a wavelength of 420 nm was measured by an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank control, and the absorbance value was 0.564.

(7) According to the standard curve obtained in Example 5 (1), the total amount of bacterial microorganisms in the sample was calculated to be 5.29log ₁₀ CFU/mL, and according to the standard curve obtained in Example 5 (2), the total amount of bacterial microorganisms in the sample was calculated to be 5.24log ₁₀ CFU/mL.

(8) Quantify the bacteria in the same cheese sample above by the fluorescence quantitative method (quantification steps and materials are the same as those in Example 13 (6)). The results show that the total amount of bacterial microorganisms is 5.23 log ₁₀ CFU/mL, which is basically consistent with the two groups of data determined by the above method (coefficient of variation, CV=0.006).

Example 9: Absolute Quantification Method for Bacteria Domain Microorganisms Based on No Sample Genome Extraction

1. Quantitative accuracy of Escherichia coli

(1) The Escherichia coli bacterial liquid was obtained according to the cultivation method in Example 4, and the bacterial concentration was determined by plate counting.

(2) Dilute the Escherichia coli bacteria solution in (1) by 10 times

(3) Color reaction using probes from the bacterial domain. The sequence of the signal probe is GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO.1), and the sequence of the quenching probe is CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO.2).

(4) The signal probe forms a double strand with the sample DNA. To 2 mL of Reagent 2 (including Tris-HCL at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and a final pH of 7.9), 10 μL of bacterial solutions of different dilutions were added (no sample bacterial solution was used as a blank control). Treat in a boiling water bath for 20 min. After adding 4 μL of 20 μM signal probe, react at 55 °C for 30 min.

(5) The quencher probe forms a double strand with the unbound signal probe, destroying the G quadruplex structure. Add 8 μL of 20 μM quenching probe to the system after the reaction in step (4), and react at 55 °C for 30 min.

(6) Formation of heme/G quadruplex structure. Add reagent 1 (heme) at a final concentration of 100 nM to the system after the reaction in step (5), and treat at 37 °C for 30 min.

(7) Color reaction. Add reagent 3 (ABTS) with a final concentration of 7 mM and reagent 4 (H ₂ O ₂ ) with a final concentration of 7 mM to the system after the reaction in (6), and treat at 37°C for 30 min. The absorbance value at a wavelength of 420 nm was measured by an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank control.

(8) Construct a standard curve by calculating the linear relationship between the absorbance value and the concentration of the bacterial solution, as shown in Figure 4A, R ² =0.99 (the unit of x is log10 CFU/mL, the unit of y is OD ₄₂₀ , and the linear range is 10 ³ to 10 ⁷ ). Prove the accuracy of the kit quantitative method provided by the present invention

2. Quantitative accuracy of Bacillus velezensis

(1) Bacillus velezensis bacterial liquid was obtained according to the cultivation method in Example 4, and the bacterial concentration was determined by plate counting method.

(2) Dilute the Bacillus velezensis bacteria solution in (1) by 10 times

(3) Color reaction using probes from the bacterial domain. The sequence of the signal probe is GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO.1), and the sequence of the quenching probe is CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO.2).

(4) The signal probe forms a double strand with the sample DNA. To 2 mL of Reagent 2 (including Tris-HCL at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and a final pH of 7.9), 10 μL of bacterial solutions of different dilutions were added (no sample bacterial solution was used as a blank control). Treat in a boiling water bath for 20 min. After adding 4 μL of 20 μM signal probe, react at 55 °C for 30 min.

(5) The quencher probe forms a double strand with the unbound signal probe, destroying the G quadruplex structure. Add 8 μL of 20 μM quenching probe to the system after the reaction in step (4), and react at 55 °C for 30 min.

(6) Formation of heme/G quadruplex structure. Add reagent 1 (heme) at a final concentration of 100 nM to the system after the reaction in step (5), and treat at 37 °C for 30 min.

(7) Color reaction. Add reagent 3 (ABTS) with a final concentration of 7 mM and reagent 4 (H ₂ O ₂ ) with a final concentration of 7 mM to the system after the reaction in (6), and treat at 37°C for 30 min. The absorbance value at a wavelength of 420 nm was measured by an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank control.

(8) Construct a standard curve by calculating the linear relationship between the absorbance value and the concentration of the bacterial solution, as shown in Figure 4B, R ² =0.99 (the unit of x is log10 CFU/mL, the unit of y is OD ₄₂₀ , and the linear range is 10 ³ to 10 ⁷ ). Prove the accuracy of the kit quantitative method provided by the present invention

Example 10: Determination of the content of bacterial microorganisms in yogurt samples based on the absolute quantification method of bacterial domain microorganisms without extracting the sample genome

(1) The sample was yogurt purchased from a local supermarket, and the sample processing method was as follows: 5 mL of phosphate buffer was added to 1 mL of the sample, and the bacteria were collected by centrifugation at 3000 × g for 10 min.

(2) Washing. Add 5 mL of phosphate buffer solution to the cells obtained in (1), centrifuge at 12,000 × g for 2 min to collect the cells, and repeat once.

(3) To resuspend the bacteria, add 1 mL of reagent 2 (including Tris-HCL at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and a final pH of 7.9) to the bacterial cells obtained in (2), and mix by pipetting.

(4) Color reaction using probes from the bacterial domain. The sequence of the signal probe is GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO.1), and the sequence of the quenching probe is CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO.2).

(5) The signal probe forms a double strand with the sample DNA. To 2 mL of reagent 2 (including Tris-HCL at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and a final pH of 7.9), add 10 μL of yogurt bacterial liquid (no sample bacterial liquid is used as a blank control). Incubate in a boiling water bath for 20 min. After adding 4 μL of 20 μM signal probe, react at 55 °C for 30 min.

(6) The quencher probe forms a double strand with the unbound signal probe, destroying the G quadruplex structure. Add 8 μL of 20 μM quenching probe to the system after the reaction in step (5), and react at 55 °C for 30 min.

(7) Formation of heme/G quadruplex structure. Add reagent 1 (heme) at a final concentration of 100 nM to the system after the reaction in step (6), and treat at 37 °C for 30 min.

(8) Color reaction. Add reagent 3 (ABTS) with a final concentration of 7 mM and reagent 4 (H ₂ O ₂ ) with a final concentration of 7 mM to the system after the reaction in (7), and treat at 37°C for 30 min. The absorbance value at a wavelength of 420 nm was measured by an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank control, and the absorbance value was 0.84.

(9) According to the standard curve obtained in Example 9 (1), the total amount of bacterial microorganisms in the sample is calculated to be 8.28log ₁₀ CFU/mL, and according to the standard curve obtained in Example 9 (2), the total amount of bacterial microorganisms in the sample is calculated to be 7.82log ₁₀ CFU/mL.

(10) The bacteria in the same yoghurt sample above were quantified by fluorescence quantification (quantification steps and materials were the same as in Example 13 (6)). The results showed that the total amount of bacterial microorganisms was 8.01 log ₁₀ CFU/mL, which was basically consistent with the two groups of data determined by the above method (coefficient of variation, CV=0.029).

Example 11: Determination of the content of bacterial microorganisms in fermented grains samples based on the absolute quantification method of bacterial domain microorganisms without extracting the sample genome

(1) The samples came from the fermented grains of a winery in Jingzhi Town, Shandong Province. The sample processing method was as follows: 5 mL of phosphate buffer was added to 1 g of the sample, and the bacteria were collected by centrifugation at 3000 × g for 10 min.

(2) Washing. Add 5 mL of phosphate buffer solution to the cells obtained in (1), centrifuge at 12,000 × g for 2 min to collect the cells, and repeat once.

(3) To resuspend the bacteria, add 1 mL of reagent 2 (including Tris-HCL at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and a final pH of 7.9) to the bacterial cells obtained in (2), and mix by pipetting.

(4) Color reaction using probes from the bacterial domain. The sequence of the signal probe is GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO.1), and the sequence of the quenching probe is CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO.2).

(5) The signal probe forms a double strand with the sample DNA. To 2 mL of Reagent 2 (including Tris-HCL at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and a final pH of 7.9), add 10 μL of wine fermented grains (without sample bacteria as a blank control). Incubate in a boiling water bath for 20 min. After adding 4 μL of 20 μM signal probe, react at 55 °C for 30 min.

(6) The quencher probe forms a double strand with the unbound signal probe, destroying the G quadruplex structure. Add 8 μL of 20 μM quenching probe to the system after the reaction in step (5), and react at 55 °C for 30 min.

(7) Formation of heme/G quadruplex structure. Add reagent 1 (heme) at a final concentration of 100 nM to the system after the reaction in step (6), and treat at 37 °C for 30 min.

(8) Color reaction. Add reagent 3 (ABTS) with a final concentration of 7 mM and reagent 4 (H ₂ O ₂ ) with a final concentration of 7 mM to the system after the reaction in (7), and treat at 37°C for 30 min. The absorbance value at a wavelength of 420 nm was measured by an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank control, and the absorbance value was 0.772.

(9) According to the standard curve obtained in Example 9 (1), the total amount of bacterial microorganisms in the sample is calculated to be 7.60log ₁₀ CFU/mL, and according to the standard curve obtained in Example 9 (2), the total amount of bacterial microorganisms in the sample is calculated to be 7.17log ₁₀ CFU/mL.

(10) Quantify the bacteria in the same fermented grains sample above by fluorescence quantification (quantification steps and materials are the same as those in Example 13 (6)). The results show that the total amount of bacterial microorganisms is 7.38 log ₁₀ CFU/mL, which is basically consistent with the two groups of data determined by the above method (coefficient of variation, CV=0.024).

Example 12: Determination of the content of bacterial microorganisms in cheese samples based on the absolute quantification method of bacterial domain microorganisms without extracting the sample genome

(1) The sample was cheese purchased from a local supermarket, and the sample processing method was as follows: 5 mL of phosphate buffer was added to 1 g of the sample, and the bacteria were collected by centrifugation at 3000 × g for 10 min.

(2) Washing. Add 5 mL of phosphate buffer solution to the cells obtained in (1), centrifuge at 12,000 × g for 2 min to collect the cells, and repeat once.

(3) To resuspend the bacteria, add 1 mL of reagent 2 (including Tris-HCL at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and a final pH of 7.9) to the bacterial cells obtained in (2), and mix by pipetting.

(4) Color reaction using probes from the bacterial domain. The sequence of the signal probe is GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO.1), and the sequence of the quenching probe is CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO.2).

(5) The signal probe forms a double strand with the sample DNA. To 2 mL of reagent 2 (including Tris-HCL at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and a final pH of 7.9), add 10 μL of cheese bacteria solution (no sample bacteria solution is used as a blank control). Incubate in a boiling water bath for 20 min. After adding 4 μL of 20 μM signal probe, react at 55 °C for 30 min.

(6) The quencher probe forms a double strand with the unbound signal probe, destroying the G quadruplex structure. Add 8 μL of 20 μM quenching probe to the system after the reaction in step (5), and react at 55 °C for 30 min.

(7) Formation of heme/G quadruplex structure. Add reagent 1 (heme) at a final concentration of 100 nM to the system after the reaction in step (6), and treat at 37 °C for 30 min.

(8) Color reaction. Add reagent 3 (ABTS) with a final concentration of 7 mM and reagent 4 (H ₂ O ₂ ) with a final concentration of 7 mM to the system after the reaction in (7), and treat at 37°C for 30 min. The absorbance value at a wavelength of 420 nm was measured by an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank control, and the absorbance value was 0.53.

(9) According to the standard curve obtained in Example 9 (1), the total amount of bacterial microorganisms in the sample is calculated to be 5.16log ₁₀ CFU/mL, and according to the standard curve obtained in Example 9 (2), the total amount of bacterial microorganisms in the sample is calculated to be 4.84log ₁₀ CFU/mL.

(10) The bacteria in the same cheese sample above were quantified by fluorescence quantification (quantification steps and materials were the same as in Example 13 (6)). The results showed that the total amount of bacterial microorganisms was 5.10 log ₁₀ CFU/mL, which was basically consistent with the two groups of data determined by the above method (variation coefficient, CV=0.033).

Embodiment 13: Microbial Quantitative Detection Kit and Fluorescent Quantitative PCR Detection Result Comparison

(1) The samples were selected from three samples of liquor fermented grains from a winery in Jingzhi, Shandong Province at the end of fermentation.

(2) Sample processing:

(i) The total genomes in the three samples were extracted, and the genome concentrations were 369 ng/μL, 590 ng/μL, and 321.89 ng/μL, respectively.

(ii) Add 5 mL of phosphate buffer to 1 g of sample, and centrifuge at 3000 × g for 10 min to collect the bacteria. Add 5 mL of phosphate buffer to the obtained cells, collect the cells by centrifugation at 12000 × g for 2 min, and repeat once. The bacteria were resuspended, and 1 mL of reagent 2 buffer was added to the obtained bacteria, and mixed by pipetting.

(3) Color reaction using probes from the bacterial domain. The sequence of the signal probe is GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO.1), and the sequence of the quenching probe is CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO.2).

(4) Determination based on the quantitative method of the kit without extracting the genome.

(i) The signal probe forms a double strand with the sample DNA. To 2 mL of Reagent 2 (including Tris-HCL at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and a final pH of 7.9), add 10 μL of wine fermented grains (without sample bacteria as a blank control). Treat in a boiling water bath for 20 min. After adding 4 μL of 20 μM signal probe, react at 55 °C for 30 min.

(ii) The quencher probe forms a duplex with the unbound signal probe, disrupting the G quadruplex structure. Add 8 μL of 20 μM quenching probe to the system after the reaction in step (i), and react at 55 °C for 30 min.

(iii) Formation of a heme/G quadruplex structure. Add reagent 1 (heme) with a final concentration of 100 mM to the system after the reaction in step (ii), and treat at 37 °C for 30 min.

(iv) Color reaction. Add reagent 3 (ABTS) with a final concentration of 7 mM and reagent 4 (H ₂ O ₂ ) with a final concentration of 7 mM to the system after the reaction in (iii), and treat at 37°C for 30 min. The absorbance value at a wavelength of 420 nm was measured by an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank control, and the absorbance values were 0.732, 0.781, and 0.78.

(v) According to the standard curve obtained in Example 9 (1), the total amount of bacterial microorganisms in the sample is calculated to be 7.52 ± 0.28 log ₁₀ CFU/mL.

(5) Determination of kit quantitative method based on genome extraction

(i) The signal probe forms a double strand with the sample DNA. To 2 mL of reagent 2 (including Tris-HCL at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and a final pH of 7.9), add 4 μL of fermented grain metagenomic DNA (no sample DNA was added as a blank control). Incubate in a water bath at 90°C for 10 min. After adding 4 μL of 20 μM signal probe, react at 55 °C for 30 min.

(ii) The quencher probe forms a duplex with the unbound signal probe, disrupting the G quadruplex structure. Add 8 μL of 20 μM quenching probe to the system after the reaction in step (i), and react at 55 °C for 30 min.

(iii) Formation of a heme/G quadruplex structure. Add reagent 1 (heme) at a final concentration of 100 nM to the system after the reaction in step (ii), and treat at 37 °C for 30 min.

(iv) Color reaction. Add reagent 3 (ABTS) with a final concentration of 7 mM and reagent 4 (H ₂ O ₂ ) with a final concentration of 7 mM to the system after the reaction in (5), and treat at 37°C for 30 min. The absorbance value at a wavelength of 420 nm was measured by an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank control, and the absorbance values were 0.761, 0.80, and 0.80.

(v) According to the standard curve obtained in Example 5 (1), the total amount of bacterial microorganisms in the sample is calculated to be 7.50 ± 0.22 log ₁₀ CFU/mL.

(6) qPCR quantification of bacterial microbial content in samples

(i) The Escherichia coli bacterial liquid was obtained according to the cultivation method in Example 4, the bacterial concentration was determined by plate counting, and the genome was extracted as in Example 4.

(ii) Escherichia coli genomic DNA was diluted by a 10-fold gradient.

(iii) The qPCR system is 10 μL of SYBR Green, 0.4 μL of upstream and downstream primers, 0.5 μL of template DNA, and 20 μL of sterile water.

(iv) Reaction program for qPCR: pre-denaturation at 95 °C for 5 min, cycle phase: 95 °C for 5 s, 60 °C for 20 s; cycle number 40, melting curve from 65 °C to 95 °C, increasing by 0.5 °C every 5 s.

(v) qPCR was performed on the extracted genome using bacteria-specific primers, the downstream sequence of the primer sequence was ACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO.5), and the downstream sequence was GACTACHVGGGTWTCTAAT (SEQ ID NO.6).

(vi) Genomic DNA was serially diluted 10 times to establish a standard curve between CT value and Escherichia coli bacterial concentration, as shown in Figure 5, R ² =0.99.

(vii) The qPCR system and reaction conditions are the same as (iii) and (iv). According to the CT value at the end of the reaction, the concentration of bacterial microorganisms in the sample was calculated by the established standard curve to be 7.52 ± 0.39 Lg (CFU/g).

(7) Through significant difference analysis, the results are shown in Figure 6, there is no significant difference among the three quantitative methods ( P <0.05)

Example 14: Detection limit of detection using two different sequence signal probes

Signal probes of different sequences were used for quantification.

(1) The Escherichia coli bacterial liquid was obtained according to the cultivation method in Example 4, and the bacterial concentration was determined by plate counting method, and the concentration was 8.2 log10 CFU/mL. The extraction of the genome was the same as in Example 4.

(2) Genomic DNA of Escherichia coli was serially diluted 10 times to obtain 3.2 log10 CFU/mL DNA template.

(3) The bacterial signal probe sequence is GGGTGGGTGGGTGGGTACTCCTACGGGAGGCAGCAGTAGGG (SEQ ID NO.1), and the quenching probe sequence is CCCTACTGCTGCCTCCCGTAGGAGTACCCA (SEQ ID NO.2). Add 3.2 log10 CFU/mL Escherichia coli genomic DNA obtained in (2) for color reaction.

(4) The bacterial signal probe sequence is (SEQ ID NO.3) GGGATTGGGATTGGGATTGGGACTCCTACGGGAGGCAGCAGTAGGG, and the quenching probe sequence is CCCTACTGCTGCCTCCCGTAGGAGTCCCAA (SEQ ID NO.4). Add 3.2 log10 CFU/mL Escherichia coli genomic DNA obtained in (2) for color reaction.

(5) The signal probe forms a double strand with the sample DNA. Add 4 μL of Escherichia coli genomic DNA to 2 mL of Reagent 2 (including Tris-HCL at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and a final pH of 7.9) (no sample DNA is added as a blank control). Incubate in a water bath at 90°C for 10 min. After adding 4 μL of 20 μM different signal probes, react at 55 °C for 30 min.

(6) The quencher probe forms a double strand with the unbound signal probe, destroying the G quadruplex structure. Add 8 μL of 20 μM quenching probes to the system after the reaction in step (5), and react at 55 °C for 30 min.

(7) Formation of heme/G quadruplex structure. Add reagent 1 (heme) at a final concentration of 100 nM to the system after the reaction in step (6), and treat at 37 °C for 30 min.

(8) Color reaction. Reagent 3 (ABTS) with a final concentration of 7 mM and reagent 4 (H ₂ O ₂ ) with a final concentration of 7 mM were added to the system after the reaction in (7), and treated at 37°C for 30 min. The absorbance value at a wavelength of 420 nm was measured by an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank control.

(9) Repeat steps (5) (6) (7) (8) 9 times to compare the stability of the test results, as shown in Figure 7. The coefficient of variation (CV) of the quantitative result of the signal sequence based on SEQ ID NO.3 is 11.33%, and the detection can basically be realized; the coefficient of variation of the quantitative result of the quantitative result of the signal sequence based on SEQ ID NO.1 is 0.95%, and the detection effect is stable.

Although the present invention has been disclosed as above with preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims as the criterion.

SEQUENCE LISTING

<110> Jiangnan University

<120> A probe, method, kit and application for absolute quantification of bacterial microorganisms

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 41

<212>DNA

<213> Synthetic

<400> 1

gggtgggtgg gtgggtactc ctacgggagg cagcagtagg g 41

<210> 2

<211> 30

<212>DNA

<213> Synthetic

<400> 2

ccctactgct gcctcccgta ggagtaccca 30

<210> 3

<211> 46

<212>DNA

<213> Synthetic

<400> 3

gggattggga ttggggattgg gactcctacg ggaggcagca gtaggg 46

<210> 4

<211> 30

<212>DNA

<213> Synthetic

<400> 4

ccctactgct gcctcccgta gagtcccaa 30

<210> 5

<211> 25

<212>DNA

<213> Synthetic

<400> 5

actcctacgg gaggcagcag taggg 25

<210> 6

<211> 19

<212>DNA

<213> Synthetic

<400> 6

gactachvgg gtwtctaat 19

Claims (12)

1. A set of probes comprising a signaling probe and a quenching probe; the sequence of the signal probe is shown as SEQ ID NO.1, and the sequence of the quenching probe is shown as SEQ ID NO. 2; or the sequence of the signal probe is shown as SEQ ID NO.3, and the sequence of the quenching probe is shown as SEQ ID NO. 4.

2. A detection kit comprising the signaling probe and the quenching probe according to claim 1.

3. The test kit of claim 2, further comprising any one or more of the following: heme, buffer, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt, H ₂ O ₂ 。

4. A method of using the kit of any one of claims 2-3, comprising: adding excessive signal probe into a sample to be detected of DNA melting to react for a period of timeTime, combining the signal probe with a target fragment in the sample to be detected; then adding a sufficient amount of quenching probe to form double chains with the unbound signaling probe; adding heme, reacting for a period of time, adding ABTS and H ₂ O ₂ For a period of time, detecting the absorbance of the reactant, and quantifying bacterial microorganisms in the sample in combination with the absorbance, which is not diagnostic.

5. A method for quantifying bacterial microorganisms, wherein the method uses the probe of claim 1 or the detection kit of any one of claims 2 to 3, and the method is not for diagnostic purposes.

6. The method of quantification of claim 5, wherein the method comprises: melting DNA in the sample to be detected; adding excessive signal probes, and combining with target nucleotide fragments of a sample to be detected to form double chains, so that G quadruplex naked leakage is outside the sequence; adding enough quenching probes and unbound signaling probes to form double chains so as to destroy the G quadruplex structure; the bare drain is used to react with heme to form G quadruplex/heme mimic enzyme with catalase activity, which is combined with the activity of catalase to characterize the biomass of bacterial microorganisms.

7. The method of quantification of claim 5, wherein the method is absolute quantification or relative quantification.

8. The method of quantification of claim 7, wherein when the method is absolute quantification, further comprising: establishing a standard curve of catalase activity or an index related to the catalase activity and biomass of the bacterial microorganism; when the sample to be detected is detected, substituting the detected catalase activity or an index which is related to the catalase activity into a standard curve to obtain the biomass of the bacterial microorganism in the sample to be detected.

9. The method according to any one of claims 5 to 7, wherein the sample to be measured is a sample containing a cell, a genome or a metagenome.

10. The method of claim 9, wherein the sample is a fermented food or a sample obtained during fermentation of a fermented food, or an intestinal, soil, water environmental sample.

11. The method of claim 10, wherein the fermented food product is any one of the following: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverage, alcoholic beverage, yoghurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd and fermented rice flour food.

12. A method of detecting bacterial microbial content in a fermented food product, gut, soil or water comprising using the probe of claim 1, or the kit of claims 2-3; the fermented food is any one of the following: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverage, alcoholic beverage, yoghurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd and fermented rice flour food, which are not used for diagnosis.