CN101113471A - Method for detecting food-derived pathogenic enterobacteria by composite fluorescence PCR technique - Google Patents
Method for detecting food-derived pathogenic enterobacteria by composite fluorescence PCR technique Download PDFInfo
- Publication number
- CN101113471A CN101113471A CNA2007100575780A CN200710057578A CN101113471A CN 101113471 A CN101113471 A CN 101113471A CN A2007100575780 A CNA2007100575780 A CN A2007100575780A CN 200710057578 A CN200710057578 A CN 200710057578A CN 101113471 A CN101113471 A CN 101113471A
- Authority
- CN
- China
- Prior art keywords
- primer sequence
- mol
- primer
- sample
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method by using composite fluorescence PCR technique to detect food-borne pathogenic enterobacter and pertains to bacteria detection technical field. The main technic proposal is to design a primer group sequence. The pathogenic enterobacter is common pathogenic bacteria in food and imposes a serious thread to human health. The quick and accurate detection of pathogenic enterobacter in food is a main premise condition for effective prevention and control of pathogen bacteria infection. The food-borne pathogenic enterobacter required detection mainly comprises shigella, salmonella, Yersinia enterocolitica, hemorrhagic scherichia coli and scherichia coli O157: H7. The invention overcomes technical shortage in the prior art aiming at the object bacteria and provides the quick and low-cost detection method by using composite fluorescence PCR technique to detect shigella, salmonella, Yersinia enterocolitica, hemorrhagic scherichia coli and scherichia coli O157: H7. The method can use two-diode PCR reaction and primarily screen shigella, salmonella, Yersinia enterocolitica, hemorrhagic scherichia coli and scherichia coli O157: H7.
Description
Technical field
The present invention relates to the bacteriologic test technology, specifically use fluorescent PCR to react and detect malignant bacteria, the particularly technology of food-borne pathogenic enterobacteria.
Background technology
Common pathogenic bacteria in food is the one of the main reasons that causes food poisoning, can cause multiple disease to take place, and people's health in serious threat, and common pathogenic bacteria in food mainly is an enterobacteria.Pathogenic bacterium in the accurate detection food are preconditions of effectively prevention and control pathogenic bacterial infection.Along with development of molecular biology, method for determining bacteria in the food test quarantine on traditional simple biochemical test level to molecular biological method such as technical developments such as PCR, probe hybridization, but molecular biological detection method still is difficult to replace traditional biochemical identification in a short time, and molecular biology method is mainly used in the primary dcreening operation of a large amount of samples at present.The food source property enterobacteria that needs to detect mainly comprises following several: Shigellae, Salmonellas, yersinia entero-colitica, Enterohemorrhagic E.coli and Escherichia coli O 157: H7 etc.
Summary of the invention
At above-mentioned object bacteria, the present invention has overcome shortcoming of the prior art, provides a kind of detection Shigellae, Salmonellas, yersinia entero-colitica, Enterohemorrhagic E.coli and Escherichia coli O 157 that uses composite fluorescence PCR technology fast and low-cost: the H7 method.
This method comprises: use this method and detect the employed primer sets of food-borne pathogenic microorganism and supporting with it PCR reaction conditions.Wherein the full sequence of primer, probe is as follows:
Primer:
One: 5 ' CCGTGTACGCTTAGTCGCTTAACCTC of primer sequence
Two: 5 ' TCTTTAAGAATCTGGATCAAGCTGAAA of primer sequence
Three: 5 ' CGAATGTGTCACCACATTCTCACCT of primer sequence
Four: 5 ' GGTAAAGAGGTTCTGACTACACGATG of primer sequence
Five: 5 ' CCCCATCGTGTAGTCAGAACCTCT of primer sequence
Six: 5 ' ATTTGAAGAGGTTTTAACTACATGTTAT of primer sequence
Seven: 5 ' ATAACATGTAGTTAAAACCTCTTCAAAT of primer sequence
Eight: 5 ' TGAACAGGAGGTTTCTGCGTTAG of primer sequence
Nine: 5 ' ATATGTCAACCTCTGACTGATAGTCTGA of primer sequence
Ten: 5 ' CTTTATGAAAGCCTGCGAGTAAAG of primer sequence
Primer sequence 11: 5 ' CTGTTATGCTGGCTATCAGTCCTCT
The invention provides the method that detects the food-borne pathogenic enterobacteria more fast with low cost by fluorescence PCR method.
The present invention is achieved by the following technical solutions:
(1) design specific oligonucleotide primer is used for the chimeric fluorescent PCR technology for detection of fluorescence dye;
(2) integrate each primer and make it non-interference.
(3) with the primer sequence group, amplification testing sample template is carried out the specific amplification of goal gene;
(4) use the fluorescent PCR instrument to carry out the real-time fluorescence luminous intensity measurement in the amplification procedure and after the PCR reaction finishes, carry out the mensuration of the segmental melting curve of institute's synthetic DNA, and data transmission is crossed the peak value that software kit analysis can be observed the specificity melting curve of various pathogenic micro-organisms to the computer expert.
The genome of the specific primer sets amplification of system 1 usefulness of the present invention Salmonellas, Shigellae, small intestine Yersinia all produces fluorescent signal, and generates corresponding melting curve peak value, does not all find false positive and false-negative result.
Among the present invention in the fluorescent PCR reaction system each component composition as follows:
Constituent concentration application of sample amount
2 times of 12.5 μ L of PCR system premixture
One: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
Two: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
Three: 10 μ mol/L 0.6 μ L of the chimeric method the primer of fluorescence sequence
Four: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
Five: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
Six: 10 μ mol/L 0.6 μ L of the chimeric method the primer of fluorescence sequence
Seven: 10 μ mol/L 0.6 μ L of the chimeric method the primer of fluorescence sequence
Distilled water 8.5 μ L
The melting temperature (Tm) program of fluorescent PCR amplification program and mensuration amplified fragments is:
(1) 95 ℃ 10 minutes;
(2) 95 ℃ 15 seconds;
(3) 60 ℃ 30 seconds;
(4) got back to for (2) step, repeat 40 times;
(5) 95 ℃ 2 minutes;
(6) 60 ℃ to 95 ℃ per seconds of gradient increased temperature rise 0.2 ℃.
The fluorescent PCR result uses the fluorescent PCR instrument to carry out the real-time fluorescence luminous intensity measurement in amplification procedure, and carries out the melting temperature (Tm) that gradient increased temperature is measured amplified fragments after the pcr amplification EP (end of program).Data transmission is crossed software kit analysis to the computer expert can observe the fluorescence that carries out the specific amplification generation, can obtain the peculiar melting curve peak value of the specific fragment of Shigella (77 ℃ ± 0.3 ℃): the peculiar melting curve bimodal of specific fragment (81 ℃ ± 0.3 ℃ and 84.5 ℃ ± 0.3 ℃) of the peculiar melting curve peak value of the specific fragment of small intestine Yersinia (74 ℃ ± 0.3 ℃) salmonella.
If obtain the peculiar melting curve peak value of the specific fragment of Shigella (77 ℃ ± 0.3 ℃) is then proved to have Shigellae in the testing sample; If obtain the peculiar melting curve peak value of the specific fragment of small intestine Yersinia (74 ℃ ± 0.3 ℃) is then proved and contains the small intestine Yersinia in the testing sample; The peculiar melting curve bimodal of the specific fragment of salmonella (81 ℃ ± 0.3 ℃ and 84.5 ℃ ± 0.3 ℃) then proves and contains Salmonellas in the testing sample.As other results occur and show then check failure this time can not determine whether there is Shigellae, Salmonellas and small intestine Yersinia need check again.
The specific primer sets amplification of system 2 usefulness of the present invention intestinal bacteria O
157: H
7The genome of strain and Enterohemorrhagic E.coli all produces fluorescent signal, and generates corresponding melting curve peak value, does not all find false positive and false-negative result.
Among the present invention in the fluorescent PCR reaction system each component composition as follows:
Constituent concentration application of sample amount
2 times of 12.5 μ L of PCR system premixture
Eight: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
Nine: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
Ten: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
The chimeric method the primer of fluorescence sequence 11: 10 μ mol/L 0.3 μ L
Distilled water 10.3 μ L
The melting temperature (Tm) program of fluorescent PCR amplification program and mensuration amplified fragments is:
(1) 95 ℃ 10 minutes;
(2) 95 ℃ 15 seconds;
(3) 60 ℃ 30 seconds;
(4) got back to for (2) step, repeat 40 times;
(5) 95 ℃ 2 minutes;
(6) 60 ℃ to 95 ℃ per seconds of gradient increased temperature rise 0.2 ℃.
The fluorescent PCR result uses the fluorescent PCR instrument to carry out the real-time fluorescence luminous intensity measurement in amplification procedure, and carries out the melting temperature (Tm) that gradient increased temperature is measured amplified fragments after the pcr amplification EP (end of program).Data transmission is crossed software kit analysis to the computer expert can observe the fluorescence that carries out the specific amplification generation, can obtain intestinal bacteria O
157: H
7The peculiar melting curve peak value of specific fragment (74 ℃ ± 0.3 ℃) of peculiar melting curve peak value of the specific fragment of strain (77.5 ℃ ± 0.3 ℃) and Enterohemorrhagic E.coli.
If obtain to intestinal bacteria O
157: H
7The peculiar melting curve peak value of the specific fragment of strain (77.5 ℃ ± 0.3 ℃) then proves to have intestinal bacteria O in the testing sample
157: H
7Strain; Contain Enterohemorrhagic E.coli in the testing sample if obtain the peculiar melting curve peak value of the specific fragment of Enterohemorrhagic E.coli (74 ℃ ± 0.3 ℃) then prove.As other results occur and show then check failure this time can not determine whether there is intestinal bacteria O
157: H
7Strain and Enterohemorrhagic E.coli.
Compared with prior art, the invention has the beneficial effects as follows: the authentication method based on fluorescent PCR is applicable to directly amplified target gene from clinical samples such as patient's mycetome liquid, food and body fluid culture, thereby bacterium, and two pipe fluorescent PCR reactions just can detect Shigellae, Salmonellas, small intestine Yersinia, intestinal bacteria O to use present method only to need once
157: H
7Strain and Enterohemorrhagic E.coli can be saved cost and the time detected.Fluorescence PCR method have detect accurately, high specificity, highly sensitive characteristics, can identify special target bacteria quickly and accurately.It has avoided cultivating repeatedly with the method amplification bacterium target gene of PCR, saves time; The PCR authentication method is not subjected to the influence of culture condition and bacterium physiological status, and is more accurate than the Physiology and biochemistry authentication method.
Description of drawings
Composite fluorescence PCR technology for detection testing sample DNA in Fig. 1 fresh meat sample to be measured, SYBR Green fluorescence signal intensity.
Composite fluorescence PCR technology for detection testing sample DNA in Fig. 2 fresh meat sample to be measured, amplified production melting temperature (Tm) peak value.
Composite fluorescence PCR technology for detection testing sample DNA in Fig. 3 biscuit sample to be measured, SYBR Green fluorescence signal intensity.
Composite fluorescence PCR technology for detection testing sample DNA in Fig. 4 biscuit sample to be measured, amplified production melting temperature (Tm) peak value.
Composite fluorescence PCR technology for detection testing sample DNA in Fig. 5 raw material milk sample to be measured, SYBR Green fluorescence signal intensity.
Composite fluorescence PCR technology for detection testing sample DNA in Fig. 6 raw material milk sample to be measured, amplified production melting temperature (Tm) peak value.
Composite fluorescence PCR technology for detection testing sample DNA in Fig. 7 canned beef sample to be measured, SYBR Green fluorescence signal intensity.
Composite fluorescence PCR technology for detection testing sample DNA in Fig. 8 canned beef sample to be measured, amplified production melting temperature (Tm) peak value.
Composite fluorescence PCR technology for detection testing sample DNA in Fig. 9 dried bean curd sample to be measured, SYBR Green fluorescence signal intensity.
Composite fluorescence PCR technology for detection testing sample DNA in Figure 10 dried bean curd sample to be measured, amplified production melting temperature (Tm) peak value.
Embodiment
Below in conjunction with accompanying drawing and embodiment the present invention is described in further detail.
Sample: somewhere outlet fresh meat.
Detect the doubtful bacterium colony of Shigellae with conventional physiology, biochemical method, carry out the detection of following composite fluorescence PCR technology for detection food-borne pathogens then:
1. sample preparation
(1) gets 100 grams sample to be checked, pulverize.
(2) being dissolved in 1 liter of nutrient broth 37 ℃ cultivated 8 hours.
2.DNA extracting
Get nutrient broth 1mL and in ice bath, left standstill 5 minutes, at room temperature 12000 rev/mins then, centrifugal 5 minutes, abandon supernatant liquor, add 100 μ L lysozyme solns, 37 ℃ of insulations 10 minutes are added TE damping fluid 500 μ L, the vibration mixing.Add with the saturated phenol of volume Tris (pH8.0), strong vibration, 12000 rev/mins centrifugal 3 minutes, get supernatant liquor, repeat the phenol extracting.Get supernatant liquor, add the sodium acetate (2mol/L) of 0.1 times of volume, mixing, add isopyknic ice ethanol again, stand at low temperature is 30 minutes behind the mixing, 12000 rev/mins, centrifugal 5 minutes, abandon supernatant, add 70% cold washing with alcohol once, following 12000 rev/mins of room temperature, centrifugal 5 minutes, abandon supernatant, add 50 μ L TE solution, put-20 ℃ of preservations.
3.PCR amplification
Each component composition is as follows in the PCR reaction system:
Constituent concentration application of sample amount
2 times of 12.5 μ L of PCR system premixture
One: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
Two: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
Three: 10 μ mol/L 0.6 μ L of the chimeric method the primer of fluorescence sequence
Four: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
Five: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
Six: 10 μ mol/L 0.6 μ L of the chimeric method the primer of fluorescence sequence
Seven: 10 μ mol/L 0.6 μ L of the chimeric method the primer of fluorescence sequence
Distilled water 8.5 μ L
The melting temperature (Tm) program of fluorescent PCR amplification program and mensuration amplified fragments is:
(1) 95 ℃ 10 minutes;
(2) 95 ℃ 15 seconds;
(3) 65 ℃ 30 seconds;
(4) got back to for (2) step, repeat 40 times;
(5) 95 ℃ 2 minutes;
(6) 60 ℃ to 95 ℃ per seconds of gradient increased temperature rise 0.2 ℃.
PCR carries out 2 pipe PCR experiments altogether, and what wherein the DNA sample was added is respectively: this testing sample DNA; The negative control of no sample.
4. detected fluorescent PCR collection of illustrative plates is observed
This testing sample be can observe in the fluorescent PCR process and tangible SYBR Green fluorescence, result such as Fig. 1 produced.Negative control does not produce SYBR Green fluorescence result in the PCR process, at the fluorescence curve by observation amplified production melting temperature (Tm), can find characteristic peaks such as Fig. 2 of Shigella.
The SYBR Green fluorescence intensity signals of the curve representative among Fig. 1 is DNA cloning result in the sample.
The melting temperature (Tm) peak value of the curve representative among Fig. 2 is the characteristic peaks of Shigella in the sample.
Experiment shows and contains Shigellae in the sample.
After 3 days, prove that the purpose bacterium colony of being checked is a shigella flexneri, with one of them bacterial strain called after CIQ810 by conventional microorganism culturing and biochemistry detection.The fluorescent PCR assay is consistent with the biochemistry detection result.
Sample: somewhere outlet biscuit.
Detect the doubtful bacterium colony of Salmonellas with conventional physiology, biochemical method, carry out the detection of following composite fluorescence PCR technology for detection food-borne pathogens then:
1. sample preparation
(1) gets 100 grams sample to be checked, pulverize.
(2) being dissolved in 1 liter of nutrient broth 37 ℃ cultivated 8 hours.
2.DNA extracting
Get nutrient broth 1mL and in ice bath, left standstill 5 minutes, at room temperature 12000 rev/mins then, centrifugal 5 minutes, abandon supernatant liquor, add 100 μ L lysozyme solns, 37 ℃ of insulations 10 minutes are added TE damping fluid 500 μ L, the vibration mixing.Add with the saturated phenol of volume Tris (pH8.0), strong vibration, 12000 rev/mins centrifugal 3 minutes, get supernatant liquor, repeat the phenol extracting.Get supernatant liquor, add the sodium acetate (2mol/L) of 0.1 times of volume, mixing, add isopyknic ice ethanol again, stand at low temperature is 30 minutes behind the mixing, 12000 rev/mins, centrifugal 5 minutes, abandon supernatant, add 70% cold washing with alcohol once, following 12000 rev/mins of room temperature, centrifugal 5 minutes, abandon supernatant, add 50 μ L TE solution, put-20 ℃ of preservations.
3.PCR amplification
Each component composition is as follows in the PCR reaction system:
Constituent concentration application of sample amount
2 times of 12.5 μ L of PCR system premixture
One: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
Two: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
Three: 10 μ mol/L 0.6 μ L of the chimeric method the primer of fluorescence sequence
Four: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
Five: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
Six: 10 μ mol/L 0.6 μ L of the chimeric method the primer of fluorescence sequence
Seven: 10 μ mol/L 0.6 μ L of the chimeric method the primer of fluorescence sequence
Distilled water 8.5 μ L
The melting temperature (Tm) program of fluorescent PCR amplification program and mensuration amplified fragments is:
(1) 95 ℃ 10 minutes;
(2) 95 ℃ 15 seconds;
(3) 65 ℃ 30 seconds;
(4) got back to for (2) step, repeat 40 times;
(5) 95 ℃ 2 minutes;
(6) 60 ℃ to 95 ℃ per seconds of gradient increased temperature rise 0.2 ℃.
PCR carries out 2 pipe PCR experiments altogether, and what wherein the DNA sample was added is respectively: this testing sample DNA; The negative control of no sample.
4. detected fluorescent PCR collection of illustrative plates is observed
This testing sample be can observe in the fluorescent PCR process and tangible SYBR Green fluorescence, result such as Fig. 3 produced.Negative control does not produce SYBR Green fluorescence result in the PCR process, at the fluorescence curve by observation amplified production melting temperature (Tm), can find characteristic peaks such as Fig. 4 of salmonella.
The SYBR Green fluorescence intensity signals of the curve representative among Fig. 3 is DNA cloning result in the sample.
The melting temperature (Tm) peak value of the curve representative among Fig. 4 is the characteristic peaks of salmonella in the sample.
Experiment shows and contains Salmonellas in the sample.
After 3 days, prove that the purpose bacterium colony of being checked is a Salmonella enteritidis, with one of them bacterial strain called after CIQ815 by conventional microorganism culturing and biochemistry detection.The fluorescent PCR assay is consistent with the biochemistry detection result.
Sample: the raw material milk of somewhere censorship.
Detect the doubtful bacterium colony of small intestine Yersinia with conventional physiology, biochemical method, carry out the detection of following composite fluorescence PCR technology for detection food-borne pathogens then:
1. sample preparation
(1) get 100 the gram centrifugal.
(2) throw out is dissolved in 1 liter of nutrient broth 37 ℃ again and cultivated 8 hours.
2.DNA extracting
Get nutrient broth 1mL and in ice bath, left standstill 5 minutes, at room temperature 12000 rev/mins then, centrifugal 5 minutes, abandon supernatant liquor, add 100 μ L lysozyme solns, 37 ℃ of insulations 10 minutes are added TE damping fluid 500 μ L, the vibration mixing.Add with the saturated phenol of volume Tris (pH8.0), strong vibration, 12000 rev/mins centrifugal 3 minutes, get supernatant liquor, repeat the phenol extracting.Get supernatant liquor, add the sodium acetate (2mol/L) of 0.1 times of volume, mixing, add isopyknic ice ethanol again, stand at low temperature is 30 minutes behind the mixing, 12000 rev/mins, centrifugal 5 minutes, abandon supernatant, add 70% cold washing with alcohol once, following 12000 rev/mins of room temperature, centrifugal 5 minutes, abandon supernatant, add 50 μ L TE solution, put-20 ℃ of preservations.
3.PCR amplification
Each component composition is as follows in the PCR reaction system:
Constituent concentration application of sample amount
2 times of 12.5 μ L of PCR system premixture
One: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
Two: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
Three: 10 μ mol/L 0.6 μ L of the chimeric method the primer of fluorescence sequence
Four: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
Five: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
Six: 10 μ mol/L 0.6 μ L of the chimeric method the primer of fluorescence sequence
Seven: 10 μ mol/L 0.6 μ L of the chimeric method the primer of fluorescence sequence
Distilled water 8.5 μ L
The melting temperature (Tm) program of fluorescent PCR amplification program and mensuration amplified fragments is:
(1) 95 ℃ 10 minutes;
(2) 95 ℃ 15 seconds;
(3) 65 ℃ 30 seconds;
(4) got back to for (2) step, repeat 40 times;
(5) 95 ℃ 2 minutes;
(6) 60 ℃ to 95 ℃ per seconds of gradient increased temperature rise 0.2 ℃.
PCR carries out 2 pipe PCR experiments altogether, and what wherein the DNA sample was added is respectively: this testing sample DNA; The negative control of no sample.
4. detected fluorescent PCR collection of illustrative plates is observed
This testing sample be can observe in the fluorescent PCR process and tangible SYBR Green fluorescence, result such as Fig. 5 produced.Negative control does not produce SYBR Green fluorescence result in the PCR process, at the fluorescence curve by observation amplified production melting temperature (Tm), can find characteristic peaks such as Fig. 6 of small intestine Yersinia.
The SYBR Green fluorescence intensity signals of the curve representative among Fig. 5 is DNA cloning result in the sample.
The melting temperature (Tm) peak value of the curve representative among Fig. 6 is the characteristic peaks of small intestine Yersinia in the sample.
Experiment shows and contains the small intestine Yersinia in the sample.
After 3 days, prove that the purpose bacterium colony of being checked is the small intestine Yersinia, with one of them bacterial strain called after CIQ919 by conventional microorganism culturing and biochemistry detection.The fluorescent PCR assay is consistent with the biochemistry detection result.
Embodiment 4
Sample: the canned meat of somewhere censorship.
Detect intestinal bacteria O with conventional physiology, biochemical method
157: H
7Doubtful bacterium colony, carry out the detection of following composite fluorescence PCR technology for detection food-borne pathogens then:
1. sample preparation
(1) gets 100 grams sample to be checked, pulverize.
(2) sample dissolution after handling in 1 liter of nutrient broth 37 ℃ cultivated 8 hours.
2.DNA extracting
Get nutrient broth 1mL and in ice bath, left standstill 5 minutes, at room temperature 12000 rev/mins then, centrifugal 5 minutes, abandon supernatant liquor, add 100 μ L lysozyme solns, 37 ℃ of insulations 10 minutes are added TE damping fluid 500 μ L, the vibration mixing.Add with the saturated phenol of volume Tris (pH8.0), strong vibration, 12000 rev/mins centrifugal 3 minutes, get supernatant liquor, repeat the phenol extracting.Get supernatant liquor, add the sodium acetate (2mol/L) of 0.1 times of volume, mixing, add isopyknic ice ethanol again, stand at low temperature is 30 minutes behind the mixing, 12000 rev/mins, centrifugal 5 minutes, abandon supernatant, add 70% cold washing with alcohol once, following 12000 rev/mins of room temperature, centrifugal 5 minutes, abandon supernatant, add 50 μ L TE solution, put-20 ℃ of preservations.
3.PCR amplification
Each component composition is as follows in the PCR reaction system:
Constituent concentration application of sample amount
2 times of 12.5 μ L of PCR system premixture
Eight: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
Nine: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
Ten: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
The chimeric method the primer of fluorescence sequence 11: 10 μ mol/L 0.3 μ L
Distilled water 10.3 μ L
The melting temperature (Tm) program of fluorescent PCR amplification program and mensuration amplified fragments is:
(1) 95 ℃ 10 minutes;
(2) 95 ℃ 15 seconds;
(3) 60 ℃ 30 seconds;
(4) got back to for (2) step, repeat 40 times;
(5) 95 ℃ 2 minutes;
(6) 60 ℃ to 95 ℃ per seconds of gradient increased temperature rise 0.2 ℃.
PCR carries out 2 pipe PCR experiments altogether, and what wherein the DNA sample was added is respectively: this testing sample DNA; The negative control of no sample.
4. detected fluorescent PCR collection of illustrative plates is observed
This testing sample be can observe in the fluorescent PCR process and tangible SYBR Green fluorescence, result such as Fig. 7 produced.Negative control does not produce SYBR Green fluorescence result in the PCR process, at the fluorescence curve by observation amplified production melting temperature (Tm), can find intestinal bacteria O
157: H
7Characteristic peaks such as Fig. 8.
The SYBR Green fluorescence intensity signals of the curve representative among Fig. 7 is DNA cloning result in the sample.
The melting temperature (Tm) peak value of the curve representative among Fig. 8 is intestinal bacteria O in the sample
157: H
7Characteristic peaks.
Experiment shows and contains intestinal bacteria O in the sample
157: H
7
After 3 days, prove that the purpose bacterium colony of being checked is intestinal bacteria O by conventional microorganism culturing and biochemistry detection
157: H
7, with one of them bacterial strain called after CIQ869.The fluorescent PCR assay is consistent with the biochemistry detection result.
Sample: the dried bean curd of somewhere censorship.
Detect the doubtful bacterium colony of Enterohemorrhagic E.coli with conventional physiology, biochemical method, carry out the detection of following composite fluorescence PCR technology for detection food-borne pathogens then:
1. sample preparation
(1) gets 100 grams sample to be checked, pulverize.
(2) sample dissolution after handling in 1 liter of nutrient broth 37 ℃ cultivated 8 hours.
2.DNA extracting
Get nutrient broth 1mL and in ice bath, left standstill 5 minutes, at room temperature 12000 rev/mins then, centrifugal 5 minutes, abandon supernatant liquor, add 100 μ L lysozyme solns, 37 ℃ of insulations 10 minutes are added TE damping fluid 500 μ L, the vibration mixing.Add with the saturated phenol of volume Tris (pH8.0), strong vibration, 12000 rev/mins centrifugal 3 minutes, get supernatant liquor, repeat the phenol extracting.Get supernatant liquor, add the sodium acetate (2mol/L) of 0.1 times of volume, mixing, add isopyknic ice ethanol again, stand at low temperature is 30 minutes behind the mixing, 12000 rev/mins, centrifugal 5 minutes, abandon supernatant, add 70% cold washing with alcohol once, following 12000 rev/mins of room temperature, centrifugal 5 minutes, abandon supernatant, add 50 μ L TE solution, put-20 ℃ of preservations.
3.PCR amplification
Each component composition is as follows in the PCR reaction system:
Constituent concentration application of sample amount
2 times of 12.5 μ L of PCR system premixture
Eight: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
Nine: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
Ten: 10 μ mol/L 0.3 μ L of the chimeric method the primer of fluorescence sequence
The chimeric method the primer of fluorescence sequence 11: 10 μ mol/L 0.3 μ L
Distilled water 10.3 μ L
The melting temperature (Tm) program of fluorescent PCR amplification program and mensuration amplified fragments is:
(1) 95 ℃ 10 minutes;
(2) 95 ℃ 15 seconds;
(3) 60 ℃ 30 seconds;
(4) got back to for (2) step, repeat 40 times;
(5) 95 ℃ 2 minutes;
(6) 60 ℃ to 95 ℃ per seconds of gradient increased temperature rise 0.2 ℃.
PCR carries out 2 pipe PCR experiments altogether, and what wherein the DNA sample was added is respectively: this testing sample DNA; The negative control of no sample.
4. detected fluorescent PCR collection of illustrative plates is observed
This testing sample be can observe in the fluorescent PCR process and tangible SYBR Green fluorescence, result such as Fig. 9 produced.Negative control does not produce SYBR Green fluorescence result in the PCR process, at the fluorescence curve by observation amplified production melting temperature (Tm), can find characteristic peaks such as Figure 10 of Enterohemorrhagic E.coli.
The SYBR Green fluorescence intensity signals of the curve representative among Fig. 9 is DNA cloning result in the sample.
The melting temperature (Tm) peak value of the curve representative among Figure 10 is the characteristic peaks of Enterohemorrhagic E.coli in the sample.
Experiment shows and contains Enterohemorrhagic E.coli in the sample.
After 3 days, prove that the purpose bacterium colony of being checked is an Enterohemorrhagic E.coli, with one of them bacterial strain called after CIQ639 by conventional microorganism culturing and biochemistry detection.The fluorescent PCR assay is consistent with the biochemistry detection result.
Sequence list
SEQUENCE?LISTING
＜110〉Tianjin Exit-Entrance Check and Guarantine Bureau
＜120〉method of utilization composite fluorescence PCR technology for detection food-borne pathogenic enterobacteria
<130>2007118
<160>11
<170>PatentIn?version?3.3
<210>1
<211>26
<212>DNA
＜213〉synthetic
<220>
<221>primer_bind
<222>(1)..(26)
<400>1
ccgtgtacgc?ttagtcgctt?aacctc 26
<210>2
<211>27
<212>DNA
＜213〉synthetic
<220>
<221>primer_bind
<222>(1)..(27)
<400>2
tctttaagaa?tctggatcaa?gctgaaa 27
<210>3
<211>25
<212>DNA
＜213〉synthetic
<220>
<221>primer_bind
<222>(1)..(25)
<400>3
cgaatgtgtc?accacattct?cacct 25
<210>4
<211>26
<212>DNA
＜213〉synthetic
<220>
<221>primer_bind
<222>(1)..(26)
<400>4
ggtaaagagg?ttctgactac?acgatg 26
<210>5
<211>24
<212>DNA
＜213〉synthetic
<220>
<221>primer_bind
<222>(1)..(24)
<400>5
ccccatcgtg?tagtcagaac?ctct 24
<210>6
<211>28
<212>DNA
＜213〉synthetic
<220>
<221>primer_bind
<222>(1)..(28)
<400>6
atttgaagag?gttttaacta?catgttat 28
<210>7
<211>28
<212>DNA
＜213〉synthetic
<220>
<221>primer_bind
<222>(1)..(28)
<400>7
ataacatgta?gttaaaacct?cttcaaat 28
<210>8
<211>23
<212>DNA
＜213〉synthetic
<220>
<221>primer_bind
<222>(1)..(23)
<400>8
tgaacaggag?gtttctgcgt?tag 23
<210>9
<211>27
<212>DNA
＜213〉synthetic
<220>
<221>primer_bind
<222>(1)..(27)
<400>9
atatgtcaac?ctctgactga?tagtctg 27
<210>10
<211>24
<212>DNA
＜213〉synthetic
<220>
<221>primer_bind
<222>(1)..(24)
<400>10
ctttatgaaa?gcctgcgagt?aaag 24
<210>11
<211>25
<212>DNA
＜213〉synthetic
<220>
<221>primer_bind
<222>(1)..(25)
<400>11
ctgttatgct?ggctatcagt?cctct 25
Claims (5)
1. a method of using composite fluorescence PCR technology for detection food-borne pathogenic enterobacteria is characterized in that, employed primer sets sequence is as follows:
Primer:
One: 5 ' CCGTGTACGCTTAGTCGCTTAACCTC of primer sequence
Two: 5 ' TCTTTAAGAATCTGGATCAAGCTGAAA of primer sequence
Three: 5 ' CGAATGTGTCACCACATTCTCACCT of primer sequence
Four: 5 ' GGTAAAGAGGTTCTGACTACACGATG of primer sequence
Five: 5 ' CCCCATCGTGTAGTCAGAACCTCT of primer sequence
Six: 5 ' ATTTGAAGAGGTTTTAACTACATGTTAT of primer sequence
Seven: 5 ' ATAACATGTAGTTAAAACCTCTTCAAAT of primer sequence
Eight: 5 ' TGAACAGGAGGTTTCTGCGTTAG of primer sequence
Nine: 5 ' ATATGTCAACCTCTGACTGATAGTCTGA of primer sequence
Ten: 5 ' CTTTATGAAAGCCTGCGAGTAAAG of primer sequence
Primer sequence 11: 5 ' CTGTTATGCTGGCTATCAGTCCTCT.
2. a kind of method of using composite fluorescence PCR technology for detection food-borne pathogenic enterobacteria according to claim 1 is characterized in that each component composition is as follows in the PCR reaction system 1:
Constituent concentration application of sample amount
2 times of 12.5 μ L of PCR system premixture
One: 10 μ mol/L 0.3 μ L of primer sequence
Two: 10 μ mol/L 0.3 μ L of primer sequence
Three: 10 μ mol/L 0.6 μ L of primer sequence
Four: 10 μ mol/L 0.3 μ L of primer sequence
Five: 10 μ mol/L 0.3 μ L of primer sequence
Six: 10 μ mol/L 0.6 μ L of primer sequence
Seven: 10 μ mol/L 0.6 μ L of primer sequence
DNA sample 1 μ L
Distilled water 8.5 μ L
Cumulative volume 25 μ L.
3. a kind of method of using composite fluorescence PCR technology for detection food-borne pathogenic enterobacteria according to claim 1 is characterized in that each component composition is as follows in the PCR reaction system 2:
Constituent concentration application of sample amount
2 times of 12.5 μ L of PCR system premixture
Eight: 10 μ mol/L 0.3 μ L of primer sequence
Nine: 10 μ mol/L 0.3 μ L of primer sequence
Ten: 10 μ mol/L 0.3 μ L of primer sequence
Primer sequence 11: 10 μ mol/L, 0.3 μ L
DNA sample 1 μ L
Distilled water 10.3 μ L
Cumulative volume 25 μ L.
4. a kind of method of using composite fluorescence PCR technology for detection food-borne pathogenic enterobacteria according to claim 1 is characterized in that, the melting temperature (Tm) program of fluorescent PCR amplification program and mensuration amplified fragments is:
(1) 95 ℃ 10 minutes;
(2) 95 ℃ 15 seconds;
(3) 65 ℃ 30 seconds;
(4) got back to for (2) step, repeat 40 times;
(5) 95 ℃ 2 minutes;
(6) 60 ℃ to 95 ℃ per seconds of gradient increased temperature rise 0.2 ℃.
5. the described a kind of application of composite fluorescence PCR technology aspect detection food-borne pathogenic enterobacteria of using of claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007100575780A CN101113471A (en) | 2007-06-07 | 2007-06-07 | Method for detecting food-derived pathogenic enterobacteria by composite fluorescence PCR technique |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007100575780A CN101113471A (en) | 2007-06-07 | 2007-06-07 | Method for detecting food-derived pathogenic enterobacteria by composite fluorescence PCR technique |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101113471A true CN101113471A (en) | 2008-01-30 |
Family
ID=39022000
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2007100575780A Pending CN101113471A (en) | 2007-06-07 | 2007-06-07 | Method for detecting food-derived pathogenic enterobacteria by composite fluorescence PCR technique |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101113471A (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102329864A (en) * | 2011-09-16 | 2012-01-25 | 广西出入境检验检疫局检验检疫技术中心 | Fluorescence PCR (polymerase chain reaction) kit for detecting yersinia enterocolitica |
| CN101532980B (en) * | 2009-04-16 | 2012-07-18 | 浙江工商大学 | Enzyme immunosensor for detecting Shigella species and its preparation method and application |
| MD4218C1 (en) * | 2012-06-07 | 2013-11-30 | Национальный Центр Общественного Здоровья Министерства Здравоохранения Республики Молдова | Method for diagnosis of infections caused by enterobacteria producers of beta-lactamases |
| CN103468811A (en) * | 2013-09-17 | 2013-12-25 | 北京卓诚惠生生物科技有限公司 | Yersinia enterocolitica virulence gene multiplex-PCR (Polymerase Chain Reaction) detection primer group and kit |
| CN105803058A (en) * | 2016-01-25 | 2016-07-27 | 南昌大学 | Analysis method for flora detection using high-resolution melting curve |
| US10724106B2 (en) | 2012-06-27 | 2020-07-28 | Mobidiag Oy | Method for determining the presence of diarrhoea causing pathogens |
| CN112763470A (en) * | 2020-12-28 | 2021-05-07 | 季华实验室 | Multi-channel bioluminescence detection method |
-
2007
- 2007-06-07 CN CNA2007100575780A patent/CN101113471A/en active Pending
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101532980B (en) * | 2009-04-16 | 2012-07-18 | 浙江工商大学 | Enzyme immunosensor for detecting Shigella species and its preparation method and application |
| CN102329864A (en) * | 2011-09-16 | 2012-01-25 | 广西出入境检验检疫局检验检疫技术中心 | Fluorescence PCR (polymerase chain reaction) kit for detecting yersinia enterocolitica |
| MD4218C1 (en) * | 2012-06-07 | 2013-11-30 | Национальный Центр Общественного Здоровья Министерства Здравоохранения Республики Молдова | Method for diagnosis of infections caused by enterobacteria producers of beta-lactamases |
| US10724106B2 (en) | 2012-06-27 | 2020-07-28 | Mobidiag Oy | Method for determining the presence of diarrhoea causing pathogens |
| CN103468811A (en) * | 2013-09-17 | 2013-12-25 | 北京卓诚惠生生物科技有限公司 | Yersinia enterocolitica virulence gene multiplex-PCR (Polymerase Chain Reaction) detection primer group and kit |
| CN103468811B (en) * | 2013-09-17 | 2014-09-10 | 北京卓诚惠生生物科技有限公司 | Yersinia enterocolitica virulence gene multiplex-PCR (Polymerase Chain Reaction) detection primer group and kit |
| CN105803058A (en) * | 2016-01-25 | 2016-07-27 | 南昌大学 | Analysis method for flora detection using high-resolution melting curve |
| CN112763470A (en) * | 2020-12-28 | 2021-05-07 | 季华实验室 | Multi-channel bioluminescence detection method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101113473A (en) | Method for detecting food-derived pathogenic vibrio bacteria by composite fluorescence PCR technique | |
| CN107022644A (en) | Six kinds of multiple LAMP detection primers of food-borne pathogens, detection kit and detection method in fruits and vegetables | |
| CN101113471A (en) | Method for detecting food-derived pathogenic enterobacteria by composite fluorescence PCR technique | |
| Zhu et al. | Rapid detection of Vibrio parahaemolyticus in shellfish by real-time recombinase polymerase amplification | |
| CN103436602B (en) | Kit and method for simultaneous detection of Staphylococcus aureus gene and Escherichia coli gene by using dual molecular beacon-LAMP process | |
| Wang et al. | Rapid and sensitive recombinase polymerase amplification combined with lateral flow strips for detecting Candida albicans | |
| US20220098645A1 (en) | Fast and portable microfluidic detection system as an alternative to salmonella's classical culture method | |
| CN107523619A (en) | The PCR detection kit of drug-fast bacteria comprising mcr genes and its application | |
| CN102363815A (en) | Reagent for detecting salmonellae by using cross primer nucleic acid isothermal amplification technology, amplification method and detection method for salmonellae | |
| CN106434935A (en) | Composition and method for identifying pasteurella multocida and/or haemophilus parasuis | |
| CN101182574B (en) | Method for detecting food-borne enterocolitisyersinia genus by loop-mediated isothermal amplification | |
| Zhuang et al. | Advances in detection methods for viable Salmonella spp.: Current applications and challenges | |
| CN102952881A (en) | Enterobacter cloacae specific PCR (polymerase chain reaction) detection primer | |
| CN105567802A (en) | Fluorescence PCR (polymerase chain reaction) detection kit for Chlamydia pneumoniae | |
| CN105567821A (en) | Bacillus-anthracis fluorescence PCR detection kit | |
| US20230265529A1 (en) | Methods and Compositions for Determining Salmonella Presence and Concentration Using PCR Primers of Varying Amplification Efficiencies | |
| CN109811073A (en) | Double PCR early stage quickly detects primer and its application of Streptococcusagalactiae and Streptococcus iniae | |
| CN113512601B (en) | Molecular targets for screening for Proteus and quantitative detection methods | |
| CN105624285A (en) | Mycoplasma pneumoniae fluorescent PCR detection reagent kit | |
| AU2020103778A4 (en) | Primer Set for Detection of Streptococcus agalactiae, Detection Kit and Multiplex PCR Detection Method | |
| Zhuang et al. | Progress in methods for the detection of viable Escherichia coli | |
| CN106319054B (en) | Detect the primer and detection method of brucella | |
| Gwak et al. | How to rapidly and sensitively detect for Escherichia coli O157: H7 and Salmonella Typhimurium in cabbage using filtration, DNA concentration, and real-time PCR after short-term enrichment | |
| CN108707682A (en) | One kind is for detecting the active fluorescence RAA primers of salmonella, probe and detection method | |
| CN101113472A (en) | Method for detecting food-derived pathogenic microorganism by composite fluorescence PCR technique |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20080130 |