AU2020103778A4

AU2020103778A4 - Primer Set for Detection of Streptococcus agalactiae, Detection Kit and Multiplex PCR Detection Method

Info

Publication number: AU2020103778A4
Application number: AU2020103778A
Authority: AU
Inventors: Yanhua HUANG; Biao Jiang; Wei Li; Li Lin; Chun Liu; Youlu Su
Original assignee: Zhongkai University of Agriculture and Engineering
Current assignee: Zhongkai University of Agriculture and Engineering
Priority date: 2020-11-30
Filing date: 2020-11-30
Publication date: 2021-02-11
Anticipated expiration: 2028-11-30

Abstract

The present invention discloses a primer set for detection of Streptococcus agalactiae, which comprises a primer pair hylB, a primer pair ponA and a primer pair cfb, wherein the primer pair hylB comprises a primer hylB F with the nucleotide sequence shown as SEQ ID NO.1 and a primer hylB R with the nucleotide sequence shown as SEQ ID NO.2; the primer pair ponA comprises a primer ponA F with the nucleotide sequence shown as SEQ ID NO.3 and a primer ponA R with the nucleotide sequence shown as SEQ ID NO.4; and the primer pair cfb comprises a primer cfb F with the nucleotide sequence shown as SEQ ID NO.5 and a primer cfb R with the nucleotide sequence shown as SEQ ID NO.6. The present invention also discloses a detection kit containing the primer set and a multiplex PCR detection method using the detection kit. The present invention has good specificity, high sensitivity, simplicity, rapidity, high efficiency and high precision, is suitable for rapid inspection and quarantine of streptococcus agalactiae in pollution-free aquatic products, and can be directly applied to early monitoring and early warning of aquatic diseases. The minimum concentration of DNA of detected streptococcus agalactiae is 7.74x10- ng/uL, without the need for bacterial culture, the amount of samples required for detection is small, and minimally invasive sampling can be achieved. Drawings of Description M '1 2 13 4 5 M bp FIG. 1 18

Description

Drawings of Description

M '1 2 13 4 5 M

bp

FIG. 1

Description Primer Set for Detection of Streptococcus agalactiae, Detection Kit and Multiplex PCR Detection Method

Technical Field

The present invention belongs to the field of pathogenic bacteria detection of aquaculture animals, and particularly relates to a primer set for detection of streptococcus agalactiae. Meanwhile, the present invention also relates to a detection kit containing the primer set and a multiplex PCR detection method using the detection kit.

Background

Streptococcus agalactiae belongs to genus Streptococcus, family Streptococcus, order Lactobacillus, class Bacillus, and is a facultative gram-positive coccus and one of the important pathogenic bacteria of cultured fishes. Streptococcus agalactiae also can infect humans and mammals, and is an important pathogenic bacterium common to humans, animals and fishes. So far, it has been found that more than 30 cultured freshwater fishes and marine fishes are susceptible to infection of streptococcus agalactiae. The world aquaculture loses as much as 10 billion U.S. dollars every year due to streptococcus agalactiae disease, and tilapia is the most vulnerable to this pathogen. The streptococcus agalactiae disease has rapid onset, without obvious symptoms except for some acute deaths, so it is difficult to determine the type of pathogenic bacteria from the symptoms of diseased fishes, which affects the effective treatment of the disease. Therefore, the establishment of a rapid detection technology for streptococcus agalactiae in aquaculture production is an important means to effectively prevent streptococcus disease and also provides a guarantee for improving the quality safety of aquatic products. At present, the detection of streptococcus agalactiae mainly relies on isolation and physiological and biochemical identification methods of pathogenic bacteria, and these methods have complicated operation and long detection cycle and cannot achieve the purpose of rapid identification. With the advantages of rapidness, simplicity and high sensitivity, molecular identification is the development trend of microorganism identification. Molecular detection methods for streptococcus agalactiae have been reported at home and abroad, but most use a purely cultured bacteria solution for detection. An ordinary PCR method only can detect one gene at a time, which often results in missing detection or false detection.

Multiplex PCR can simultaneously amplify the target sequences of multiple target fragments in one reaction. This technology can be used for detection or identification of a variety of pathogenic microorganisms, adding multiple pairs of specific primers into the same

PCR reaction tube at the same time for PCR amplification. The biggest problem is the design of primers and the optimization of reaction conditions, because the amplification of various primers after mixing may cause a phenomenon of band loss, various primers have a competitive relation, and strong primers may cover weak primers, which result in loss of target fragments, and the interaction among primers even can produce severe primer dimers. At present, the establishment of the triplex PCR detection method for streptococcus agalactiae is reported in literature, but the minimum detection concentration of this detection technology for DNA samples of streptococcus agalactiae is only 3.2x10 ng/L. In view of this, it is imperative to develop rapid and efficient multiplex PCR with good specificity and high sensitivity for streptococcus agalactiae, which is of great significance for strengthening rapid inspection and quarantine of streptococcus agalactiae in aquaculture water and aquatic products, early monitoring and early warning of aquatic diseases, inspection and production of pollution-free aquatic products, and hygienic quality supervision and inspection of aquatic products.

Summary

In view of the above defects, the first purpose of the present invention is to provide a primer set for detection of streptococcus agalactiae, which has good specificity and high sensitivity for streptococcus agalactiae.

The hylB gene encoding the hyaluronate lyase of streptococcus agalactiae, the ponA gene of penicillin-binding proteins and the cfb gene of the pore-forming toxin characteristic CAMP factor are virulence genes of streptococcus agalactiae that are really related to the disease, and the design of primers with these genes as targets can improve the specificity and sensitivity of detection. Therefore, the first purpose of the present invention is realized by the following technical solution:

A primer set for detection of streptococcus agalactiae, comprises a primer pair hylB, a primer pair ponA and a primer pair cfb, wherein the primer pair hylB comprises a primer hylB-F with the nucleotide sequence shown as SEQ ID NO.1 and a primer hylB-R with the nucleotide sequence shown as SEQ ID NO.2; the primer pair ponA comprises a primer ponA F with the nucleotide sequence shown as SEQ ID NO.3 and a primer ponA-R with the nucleotide sequence shown as SEQ ID NO.4; and the primer paircfb comprises a primercfb F with the nucleotide sequence shown as SEQ ID NO.5 and a primer cfb-R with the nucleotide sequence shown as SEQ ID NO.6.

The second purpose of the present invention is to provide a kit containing the primer set for detection of streptococcus agalactiae.

Further, the detection kit for streptococcus agalactiae further comprises a TE buffer, lysozyme, proteinase K, an SDS solution, phenol-chloroform-isoamylol, isopropyl alcohol, ethanol with a volume concentration of 70%, a CTAB-NaCl solution, a positive control and PCR DsMix.

Further, in the detection kit for streptococcus agalactiae, the volume ratio of phenol to chloroform to isoamylol in the phenol-chloroform-isoamylol is 26-24:23.2-24.8:0.8-1.2.

Further, in the detection kit for streptococcus agalactiae, the CTAB-NaCl solution is prepared by dissolving CTAB in a 0.5 mol/L NaCl solution, and the mass volume ratio of CTAB to the NaCl solution is 0.8-1.2:20.2-19.8.

Further, in the detection kit for streptococcus agalactiae, the positive control is a DNA template of streptococcus agalactiae.

Further, in the detection kit for streptococcus agalactiae, the concentration of a primer in the primer set is 10 M.

The third purpose of the present invention is to provide a multiplex PCR detection method using the kit to detect streptococcus agalactiae.

The multiplex PCR detection method using the kit to detect streptococcus agalactiae, comprises the following steps:

1) Taking 50-100 mg of sample to be detected, adding 1000 L of TE buffer, fully homogenizing with a homogenizer, taking and transferring 180 L of tissue homogenate into a 1.5 ml centrifuge tube, adding 20 L of lysozyme with a concentration of 50 mg/mL, and incubating at 30°C for 10 min;

2) Adding 10 L of SDS with a mass concentration of 10% and 5 L of 20 mg/mL proteinase K to the solution obtained in step 1), and incubating at 37°C for 1 h;

3) Adding 50 L of 5 mol/L NaCl solution to the incubated solution in step 2), then adding 40 L of CTAB-NaCl solution after mixing fully, and incubating at 65°C for 20 min;

4) Adding phenol-chloroform-isoamylol with the same volume as the incubated solution to the incubated solution in step 3), fully mixing, and centrifuging at 12000 g/min for 4-5 min;

5) Transferring the supernatant obtained after centrifuging in step 4) into a new tube, adding 0.6-0.8 time volume of isopropyl alcohol to the supernatant, and centrifuging at 12000 g/min for 4-5 min;

6) Removing the supernatant, washing precipitate with 1 mL of ethanol with a volume concentration of 70%, and centrifuging at 12000 g/min for 4-5 min;

7) Removing the supernatant after centrifuging in step 6), drying precipitate at a normal temperature for 5-10 min, and redissolving in 30-50 L of TE buffer, thus obtaining a sample DNA template;

8) The prepared multiplex PCR reaction system for a sample group comprises: 12.5 L of 2xPCR DsMix, 0.5 L of primer hylB-F, 0.5 L of primer hylB-R, 0.6 L of primer ponA F, 0.6 L of primer ponA-R, 0.5 L of primer cfb-F, 0.5 L of primer cfb-R, 1.0 L of sample DNA template obtained in step 7), and 8.3 L of sterile water;

9) The prepared multiplex PCR reaction system for a positive control group comprises: 12.5 L of 2xPCR DsMix, 0.5 L of primer hylB-F, 0.5 L of primer hylB-R, 0.6 L of primer ponA-F, 0.6 L of primer ponA-R, 0.5 L of primer cfb-F, 0.5 L of primer cfb-R, 1.0 L of positive control, and 8.3 L of sterile water;

10) After separately mixing the multiplex PCR reaction system for a sample group prepared in step 8) and the multiplex PCR reaction system for a positive control group prepared in step 9), centrifuging at 12000 g/min for 10 s, placing in a PCR amplifier, respectively pre-denaturing at 94°C for 5 min, denaturing at 94°C for 30 s, annealing at 57°C for 30 s and extending at 72°C for 45 s which are cycled for 30 times, and extending at 72°C for 10 min for PCR reaction;

11) Performing electrophoresis detection on the PCR reaction result obtained in step 10), and observing the result under the gel imaging system; if the electrophoresis band of the sample well has a band with the same size as the positive control well, the sample to be detected contains streptococcus agalactiae.

In step 11), a sample well, a positive control well and a reference well are provided; the sample well is formed by mixing 5 L of the PCR reaction product of the sample group obtained in step 10) and 1 L of 6xLoading Buffer and then adding into a 1% agarose gel sample application well; the positive control well is formed by mixing 5 L of the PCR reaction product of the positive control group obtained in step 10) and 1 L of 6xLoading Buffer and then adding into a 1% agarose gel sample application well; the reference well is formed by adding 5 L of DL2000 DNA Marker into a 1% agarose gel sample application well; and electrophoresis is respectively carried out on the sample well, the positive control well and the reference well at a voltage of 120 V for 25 min.

The detection method of the present invention can be used to detect animal bodies, aquatic products, aquaculture environments, food for aquaculture and the like for streptococcus agalactiae. The aquaculture environments include aquaculture water and aquaculture soil.

Compared with the prior art, the present invention has the following beneficial effects:

1. The primer set of the present invention has high specificity and can determine whether target genes exist according to the need of amplification so as to determine whether a sample contains streptococcus agalactiae, thus realizing detection of streptococcus agalactiae.

2. The detection kit of the present invention can simultaneously detect three important virulence genes of streptococcus agalactiae, greatly improving the detection sensitivity. The minimum concentration of DNA of detected streptococcus agalactiae is 7.74x10' ng/uL. The sensitivity is increased by more than 200 times compared with that of the rapid multiplex PCR detection method for streptococcus agalactiae reported in literature, and the detection can be completed within about 5 h. Compared with traditional detection methods, the present invention saves cost and time, and reduces labor force.

3. The multiplex PCR detection method for streptococcus agalactiae of the present invention not only makes pathogens in cultured fish bodies and aquaculture environments detected more rapidly, but also can be used in the tracking detection of various periods during the fish culture process as well as provide timely warning of disease outbreaks, avoid the spread of pathogenic bacteria, reduce the risk of disease outbreaks in cultured fishes and improve the quality safety of aquatic products. The method has high practical value and is beneficial to increase of the economic and social benefits of aquaculture.

4. The detection of the present invention is simple in operation without the need for complex instruments or special reagents, only requires a conventional PCR instrument, and has low requirements for the technical quality of the detection personnel, and the detection personnel are only simply trained.

5. The primer set and the detection method provided by the present invention have good specificity, high sensitivity, simplicity, rapidity, high efficiency and high precision, is suitable for rapid inspection and quarantine of streptococcus agalactiae in pollution-free aquatic products, and can be directly applied to early monitoring and early warning of aquatic diseases.

6. The primer set and the detection method provided by the present invention have wide application scope, and can not only detect whether streptococcus agalactiae exists in fishes and aquaculture water but also rapidly detect whether streptococcus agalactiae exists in other environments or animals.

7. The detection kit of the present invention has low preparation cost, simple preparation process, no need of bacterial culture and a small amount of samples required for detection, can realize minimally invasive sampling and easily realize large-scale industrial production, and has broad market prospects.

Description of Drawings

Fig. 1 is an electrophoretogram of detection results of a multiplex PCR amplification product and a single PCR amplification product in embodiment 2. M is Marker DL2000; lane 1 is amplification results of multiplex PCR, which are hylB, ponA and cfb genes from top to bottom; lane 2 is an amplification result of single PCR of the hylB gene; lane 3 is an amplification result of single PCR of the ponA gene; lane 4 is an amplification result of single PCR of the cfb gene; and lane 5 is a negative control.

Fig. 2 shows a specificity test of multiplex PCR in embodiment 5. M is Marker DL2000; lane 1 is a DNA template of streptococcus agalactiae; lane 2 is a DNA template of streptococcus iniae; lane 3 is a DNA template of photobacterium damsela; lane 4 is a DNA template of enterococcus faecalis; lane 1 is a DNA template of staphylococcus; lane 6 is a DNA template of Edwardsiella tarda; and lane 7 is sterile water.

Fig. 3 shows a sensitivity test of multiplex PCR in embodiment 6. M is Marker DL2000; lane 1 is a DNA concentration 2.42x101 ng/uL of streptococcus agalactiae; lane 2 is a DNA concentration 4.84x10 ng/uL of streptococcus agalactiae; lane 3 is a DNA concentration 9.68x101 ng/uL of streptococcus agalactiae; lane 4 is a DNA concentration 1.94x101 ng/uL of streptococcus agalactiae; lane 5 is a DNA concentration 3.87x10-2 ng/uL of streptococcus agalactiae; lane 6 is a DNA concentration 7.74x10-3 ng/uL of streptococcus agalactiae; and lane 7 is a DNA concentration 1.55x10-3 ng/uL of streptococcus agalactiae.

Detailed Description

The present invention is further described below in combination with specific embodiments and drawings. The embodiments are implemented on the premise of the technology of the present invention, and detailed implementation mode and specific operation procedures are given, but the protection scope of the present invention is not limited to the following embodiments.

Embodiment 1 Extraction of Genomic DNA of Sample

1. Extraction of genomic DNA of fish (including bacteria therein):

1) Taking 50-100 mg of sample to be detected of fish tissues, adding 1000 L of TE buffer, fully homogenizing with a homogenizer, taking and transferring 180 L of tissue homogenate into a 1.5 ml centrifuge tube, adding 20 L of lysozyme with a concentration of mg/mL, and incubating at 30°C for 10 min.

2) Adding 10 L of SDS with a mass concentration of 10% and 5 L of 20 mg/mL proteinase K to the solution obtained in step 1), and incubating at 37°C for 1 h.

3) Adding 50 L of 5 mol/L NaCl solution to the incubated solution in step 2), then adding 40 L of CTAB-NaCl solution after mixing fully, and incubating at 65°C for 20 min.

4) Adding phenol-chloroform-isoamylol with the same volume as the incubated solution to the incubated solution in step 3), fully mixing, and centrifuging at 12000 g/min for 4-5 min.

5) Transferring the supernatant obtained after centrifuging in step 4) into a new tube, adding 0.6-0.8 time volume of isopropyl alcohol to the supernatant, and centrifuging at 12000 g/min for 4-5 min.

6) Removing the supernatant after centrifuging in step 5), washing precipitate with 1 mL of ethanol with a volume concentration of 70%, and centrifuging at 12000 g/min for 4-5 min.

7) Removing the supernatant after centrifuging in step 6), drying precipitate at a normal temperature for 5-10 min, and redissolving in 30-50 L of TE buffer, thus obtaining a sample DNA template.

2. Extraction of bacterial genomic DNA:

1) Respectively collecting cultured streptococcus agalactiae, streptococcus iniae, enterococcus faecalis, photobacterium damsela, staphylococcus and Edwardsiella tarda by centrifugation, respectively resuspending the bacteria in 1000 L of TE buffer respectively, taking and transferring 180 L of bacteria resuspension into a 1.5 ml centrifuge tube, adding L of lysozyme with a concentration of 50 mg/mL, and incubating at 30°C for 10 min.

7) Removing the supernatant after centrifuging in step 6), drying precipitate at a normal temperature for 5-10 min, and redissolving in 30-50 L of TE buffer, thus obtaining a bacterial genomic DNA template.

Embodiment 2 Design and Validity Test of Primer Set for Detection of Streptococcus Agalactiae by Multiplex PCR

1. Three specific virulence genes hylB, ponA and cfb of streptococcus agalactiae are selected, the corresponding primer pairs are analyzed and designed by Primer Premier 6.0 software, each primer pair can specially identify the specificity of the above bacterial virulence genes respectively, and the primer sequences are as follows:

SEQ ID NO. Primer Name Primer Sequence (5'-3') Fragment Size Gene to be (bp) detected

1 hylB-F CGCGACTTTGGCTTTCTGAG 790 2 hylB-R TAATTGAGCGAGGGACACCG hylb

3 ponA-F AGCTATCCCTGGTGITGCAC 59S ponA 4 ponA-R ACCGTTAGGTACTGTArTGTTGT

5 cfb-F TGGGATTrGGGArAACTAAGC 34S cfb 6 cfb-R TTTGAAGTGCTGCTTGTAATG

2. Validity test:

(1) The primer set designed above is synthesized, and the primers of the primer set are respectively used to perform single PCR verification on DNA of streptococcus agalactiae extracted in embodiment 1, wherein the single PCR reaction system is as follows:

Component Volume (pL)

2 X PCR DsMix 12.5

Primer F (10 pM) 1.0

Primer R (10 pM) 1.0

DNA Template of Streptococcus Agalactiae 1.0

Sterile Water 9.5

Total 25.0

(2) Multiplex PCR verification is performed on three virulence genes of streptococcus agalactiae simultaneously, and the following multiplex PCR reaction system is used:

Component Volume (pL)

2 X PCR DsMix 12.5

hylB-F (10 pM) 0.5

hylB-R (10 pM) 0.5

ponA-F (10 pM) 0.6

ponA-R (10 pM) 0.6

cfb-F (10 pM) 0.5

cfb-R (10 pM) 0.5

DNA Template of Streptococcus Agalactiae 1.0

Sterile Water 8.3

Total 25.0

(3) The following PCR reaction procedure is used to conduct PCR reaction on the above PCR reaction system:

1) Pre-denaturing at 94°C for 4 min.

2) Denaturing at 94°C for 30 s.

Annealing at 57°C for 30 s.

Extending at 72°C for 1 min.

Circulating for 30 times.

3) Extending at 72°C for 10 min.

After the PCR reaction, 5 L of PCR reaction product is respectively taken from each group to be mixed with 1 L of 6xLoading Buffer, and then respectively added into a 1% agarose gel sample application well; and meanwhile, a control group is added next to the sample well, 5 L of DL2000 DNA Marker is added into the agarose gel sample application well of the control group as a control, electrophoresis is carried out at a voltage of 120 V, and results are observed under the gel imaging system after about 25 min.

3. Detection results:

The detection results are shown in Fig. 1. In Fig. 1, M is Marker DL2000; lane 1 is amplification results of multiplex PCR of three virulence genes of streptococcus agalactiae, which are hylB, ponA and cfb genes from top to bottom; lane 2 is an amplification result of single PCR of the hylB gene, with the length of the target amplified fragment of 790 bp; lane 3 is an amplification result of single PCR of the ponA gene, with the length of the target amplified fragment of 598 bp; lane 4 is an amplification result of single PCR of the cfb gene, with the length of the target amplified fragment of 348 bp; lane 5 is a negative control of multiplex PCR of three virulence genes; and it can be seen from Fig. 1 that single PCR is used to detect the corresponding single band, multiplex PCR is used to detect three corresponding single bands which respectively coincide with amplified fragments with the lengths of 790 bp, 598 bp and 348 bp of hylB, ponA andcfb genes, indicating that the primer set for detection of streptococcus agalactiae of the present invention can accurately and specifically detect three important virulence genes of streptococcus agalactiae.

Embodiment 4 Kit

The detection kit of the embodiment can be used to rapidly detect by multiplex PCR whether samples contain streptococcus agalactiae, and is composed of a primer set for detection of hylB, ponA and cfb genes of streptococcus agalactiae, a TE buffer, lysozyme, proteinase K, an SDS solution, phenol-chloroform-isoamylol, isopropyl alcohol, ethanol with a volume concentration of 70%, a CTAB-NaCl solution, a positive control and PCR DsMix, wherein:

(1) Primer set for detection of streptococcus agalactiae: a tube 1 is filled with primers hylB-F and hylB-R of the hylB gene of streptococcus agalactiae, with the nucleotide sequences respectively shown as SEQ ID NO.1 and SEQ ID NO.2; a tube 2 is filled with primers ponA-F and ponA-R of the ponA gene of streptococcus agalactiae, with the nucleotide sequences respectively shown as SEQ ID NO.3 and SEQ ID NO.4; a tube 3 is filled with primers cfb-F and cfb-R of the cfb gene of streptococcus agalactiae, with the nucleotide sequences respectively shown as SEQ ID NO.5 and SEQ ID NO.6; and the concentrations of the above primers are respectively 10 M.

(2) Lysozyme (50 mg/mL) is placed in a container, one tube.

(3) Proteinase K (20 mg/mL) is placed in a container, one tube.

(4) A TE buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0) is prepared, and placed in a

container, one tube.

(5) SDS with a mass concentration of 10% is placed in a container, one tube.

(6) Phenol-chloroform-isoamylol with a volume ratio of phenol to chloroform to isoamylol equal to 25:24:1 is placed in a container, one tube.

(7) Isopropyl alcohol is placed in a container, one tube.

(8) Ethanol with a volume concentration of 70% is prepared, and placed in a container, one tube.

(9) A CTAB-NaCl solution is prepared by dissolving 5 g of CTAB in 100 mL of 0.5 M NaCl solution, and placed in a container, one tube.

(10) Preparation of positive control: the genomic DNA of streptococcus agalactiae is extracted, and placed in a container, one tube.

(11) 2xPCR DsMix is placed in a container, one tube.

(12) A foam board: the above 13 tubes are respectively placed in the corresponding holes of the form board, and then put in a box, thus obtaining the detection kit of the embodiment.

In the embodiment, each reagent tube is subjected to sampling inspection after preparation to monitor the quality thereof.

Embodiment 5 Conducting a multiplex PCR specificity test using the kit prepared in embodiment 4

The following samples are prepared respectively: a sample 1 containing streptococcus agalactiae, a sample 2 containing streptococcus iniae, a sample 3 containing photobacterium damsela, a sample 4 containing enterococcus faecalis, a sample 5 containing staphylococcus, a sample 6 containing Edwardsiella tarda, and a sample 7 that is sterile water. The method in embodiment 1 is used to respectively extract DNA of each sample as a template for multiplex PCR, and the method in embodiment 2 is used to perform multiplex PCR detection on each sample.

The detection results are shown in Fig. 2. It can be seen from Fig. 2 that the triplex PCR detection method of the present invention can detect three specific virulence genes of streptococcus agalactiae simultaneously and are free from interference of common pathogenic bacteria of other aquatic animals. The multiplex PCR detection method established by the present invention has strong specificity.

Embodiment 6 Conducting a multiplex PCR sensitivity test using the kit prepared in embodiment 4

The bacteria solution of streptococcus agalactiae cultured at 28°C for 20 h is taken, the bacterial genomic DNA is extracted with the method in embodiment 1, the genomic DNA is subjected to 5 times series gradient dilution, and with the genomic DNA with the concentrations respectively equal to 2.42x101 ng/uL, 4.84x100 ng/uL, 9.68x10-1 ng/uL, 1.94x101 ng/uL, 3.87x102 ng/uL, 7.74x10-3 ng/uL and 1.55x10-3 ng/uL as templates, the method in embodiment 2 is used to perform multiplex PCR detection on each sample.

The detection results are shown in Fig. 3. The detection method of the present invention can even detect samples containing streptococcus agalactiae with the concentration of genomic DNA equal to 7.74x10-3 ng/uL, which shows that the detection limit of the multiplex PCR of streptococcus agalactiae of the present invention can reach 7.74x10-3 ng/uL. The detection method has high sensitivity which is 200 times higher than the multiplex PCR detection method for streptococcus agalactiae reported in literature.

The present invention can be summarized in other specific forms that do not depart from the spirit or main feature of the present invention. The above embodiments of the present invention only can be regarded as description of the present invention rather than limitation to the present invention. For example, the primer set and the detection method of the above embodiments can be used to detect aquaculture water, aquaculture soil and food for aquaculture to determine whether streptococcus agalactiae exists. Therefore, any minor amendment, equivalent change and modification made to the above embodiments according to the technical essence of the present invention shall fall within the protection scope of the technical solution of the present invention.

Claims

Claims 1. A primer set for detection of streptococcus agalactiae, characterized by comprising a primer pair hylB, a primer pair ponA and a primer pair cfb, wherein the primer pair hylB comprises a primer hylB-F with the nucleotide sequence shown as SEQ ID NO.1 and a primer hylB-R with the nucleotide sequence shown as SEQ ID NO.2; the primer pair ponA comprises a primer ponA-F with the nucleotide sequence shown as SEQ ID NO.3 and a primer ponA-R with the nucleotide sequence shown as SEQ ID NO.4; and the primer pair cfb comprises a primer cfb-F with the nucleotide sequence shown as SEQ ID NO.5 and a primer cfb-R with the nucleotide sequence shown as SEQ ID NO.6.
2. A detection kit for streptococcus agalactiae containing the primer set for detection of claim 1.
3. The detection kit for streptococcus agalactiae according to claim 2, characterized by further comprising a TE buffer, lysozyme, proteinase K, an SDS solution, phenol-chloroform isoamylol, isopropyl alcohol, ethanol with a volume concentration of 70%, a CTAB-NaCl solution, a positive control and PCR DsMix.
4. The detection kit for streptococcus agalactiae according to claim 3, characterized in that the volume ratio of phenol to chloroform to isoamylol in the phenol-chloroform isoamylol is 26-24:23.2-24.8:0.8-1.2.
5. The detection kit for streptococcus agalactiae according to claim 3, characterized in that the CTAB-NaCl solution is prepared by dissolving CTAB in a 0.5 mol/L NaCl solution, and the mass volume ratio of CTAB to the NaCl solution is 0.8-1.2:20.2-19.8.
6. The detection kit for streptococcus agalactiae according to claim 3, characterized in that the positive control is a DNA template of streptococcus agalactiae.
7. The detection kit for streptococcus agalactiae according to claim 2, characterized in that the concentration of a primer in the primer set is 10 M.
8. A detection method using the detection kit of any one of claims 3-7, characterized by comprising the following steps:

1) taking 50-100 mg of sample to be detected, adding 1000 L of TE buffer, fully homogenizing with a homogenizer, taking and transferring 180 L of tissue homogenate into a 1.5 ml centrifuge tube, adding 20 L of lysozyme with a concentration of 50 mg/mL, and incubating at 30°C for 10 min;

2) adding 10 L of SDS with a mass concentration of 10% and 5 L of 20 mg/mL proteinase K to the solution obtained in step 1), and incubating at 37°C for 1 h;

3) adding 50 L of 5 mol/L NaCl solution to the incubated solution in step 2), then adding 40 L of CTAB-NaCl solution after mixing fully, and incubating at 65°C for 20 min;

4) adding phenol-chloroform-isoamylol with the same volume as the incubated solution to the incubated solution in step 3), fully mixing, and centrifuging at 12000 g/min for 4-5 min;

5) transferring the supernatant obtained after centrifuging in step 4) into a new tube, adding 0.6-0.8 time volume of isopropyl alcohol to the supernatant, and centrifuging at 12000 g/min for 4-5 min;

6) removing the supernatant, washing precipitate with 1 mL of ethanol with a volume concentration of 70%, and centrifuging at 12000 g/min for 4-5 min;

7) removing the supernatant after centrifuging in step 6), drying precipitate at a normal temperature for 5-10 min, and redissolving in 30-50 L of TE buffer, thus obtaining a sample DNA template;

8) the prepared multiplex PCR reaction system for a sample group comprises: 12.5 L of 2xPCR DsMix, 0.5 L of primer hylB-F, 0.5 L of primer hylB-R, 0.6 L of primer ponA-F, 0.6 L of primer ponA-R, 0.5 L of primer cfb-F, 0.5 L of primer cfb-R, 1.0 L of sample DNA template obtained in step 7), and 8.3 L of sterile water;
9) the prepared multiplex PCR reaction system for a positive control group comprises: 12.5 L of 2xPCR DsMix, 0.5 L of primer hylB-F, 0.5 L of primer hylB-R, 0.6 L of primer ponA-F, 0.6 L of primer ponA-R, 0.5 L of primer cfb-F, 0.5 L of primer cfb-R, 1.0 L of positive control, and 8.3 L of sterile water;
10) after separately mixing the multiplex PCR reaction system for a sample group prepared in step 8) and the multiplex PCR reaction system for a positive control group prepared in step 9), centrifuging at 12000 g/min for 10 s, placing in a PCR amplifier, respectively pre-denaturing at 94°C for 5 min, denaturing at 94°C for 30 s, annealing at 57°C for 30 s and extending at 72°C for 45 s which are cycled for 30 times, and extending at 72°C for 10 min for PCR reaction;
11) performing electrophoresis detection on the PCR reaction result obtained in step 10), and observing the result under the gel imaging system; if the electrophoresis band of the sample well has a band with the same size as the positive control well, the sample to be detected contains streptococcus agalactiae.

9. The detection method using the detection kit according to claim 8, characterized in that in the electrophoresis detection in step 11), a sample well, a positive control well and a reference well are provided; the sample well is formed by mixing 5 L of the PCR reaction product of the sample group obtained in step 10) and 1 L of 6xLoading Buffer and then adding into a 1% agarose gel sample application well; the positive control well is formed by mixing 5 L of the PCR reaction product of the positive control group obtained in step 10) and 1 L of 6xLoading Buffer and then adding into a 1% agarose gel sample application well; the reference well is formed by adding 5 L of DL2000 DNA Marker into a 1% agarose gel sample application well; and electrophoresis is respectively carried out on the sample well, the positive control well and the reference well at a voltage of 120 V for 25 min.