CN112877459B - Probe for absolute quantification of pichia kudriavzevii - Google Patents

Probe for absolute quantification of pichia kudriavzevii Download PDF

Info

Publication number
CN112877459B
CN112877459B CN202110162970.1A CN202110162970A CN112877459B CN 112877459 B CN112877459 B CN 112877459B CN 202110162970 A CN202110162970 A CN 202110162970A CN 112877459 B CN112877459 B CN 112877459B
Authority
CN
China
Prior art keywords
sample
probe
pichia kudriavzevii
fermented
reaction
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110162970.1A
Other languages
Chinese (zh)
Other versions
CN112877459A (en
Inventor
吴群
徐岩
杜如冰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangnan University
Original Assignee
Jiangnan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangnan University filed Critical Jiangnan University
Priority to CN202110162970.1A priority Critical patent/CN112877459B/en
Publication of CN112877459A publication Critical patent/CN112877459A/en
Application granted granted Critical
Publication of CN112877459B publication Critical patent/CN112877459B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a probe for absolute quantification of pichia kudriavzevii, belonging to the fields of biology, fermentation and detection. The Pichia kudriavzevii quantitative probe and the kit can realize the total amount detection of Pichia kudriavzevii, and can rapidly complete the quantitative work within 2.5h without using expensive instruments when being used for detection and Pichia kudriavzevii quantification. Meanwhile, the sample used in the present invention does not have to be subjected to nucleic acid extraction. The probe and the detection kit based on the invention are used for Pichia kudriavzevii quantification and have the characteristics of rapidness, convenience, cheapness and accuracy.

Description

Probe for absolute quantification of pichia kudriavzevii
Technical Field
The invention relates to a probe for absolute quantification of pichia kudriavzevii, belonging to the fields of biology, fermentation and detection.
Background
Pichia kudriavzeviiPichia kudriavzevii) Is an important functional microorganism in traditional fermented food brewing systems, for example in white spirit brewing systems,Pichia kudriavzeviiis a high-abundance fungus microorganism which can metabolize to produce main components of white spirit, namely alcohol, and can regulate and control the interaction of microorganisms and the structure of fermentation microbial flora, thereby having important effect on normal fermentation of food. Thus real-time trackingPichia kudriavzeviiThe biomass of (2) has important guiding significance for judging the stability of fermentation batches, judging whether the fermentation process is normal or not and regulating and controlling the fermentation parameters in real time. However, most of the traditional fermentation food systems are multi-strain co-fermentation systems at present, and the sample cannot be judged by a simple OD colorimetric methodPichia kudriavzeviiAlthough the fluorescent quantitative PCR method combined with specific primers or probes can be implemented in a mixed bacterial systemPichia kudriavzeviiBut require high-volume equipment and a high-demand operating environment. Thus, for convenient, rapid and accurate tracking of the samplePichia kudriavzeviiIs necessary to change the growth trend of (a)Development of the correspondingPichia kudriavzeviiQuantitative methods and kits.
The principle of the G quadruplex/heme mimic enzyme activity detection is that the G quadruplex can form DNA mimic enzyme with catalase activity with heme, can catalyze hydrogen peroxide to oxidize ABTS to generate ABTS+, presents green color reaction, and can detect characteristic absorbance at the wavelength of 420 nm. The stability of the G quadruplex structure is critical to the whole detection process, if the design is improper, when the G quadruplex sequence forms a dimer with other bases, the G quadruplex sequence can not form the G quadruplex, and a quantitative method based on the principle can cause underestimation of the content of a target gene in a sample in use, and reduces the sensitivity and accuracy of the detection method.
At present, the principle based on G quadruplex/heme simulated enzyme activity detection has been reported to be used for specific detection of microorganisms; for example, in the literature Wang Y, li X, xi D, wang X. Visual detection of Fusarium proliferatum based on asymmetric recombinase polymerase amplification and hemin/G-quad DNAzyme, rsc Advances 2019;9:37144-37147, asymmetric specific primers (upstream primer adds reverse sequence modification of G quadruplex, downstream no modification) are used, and the method is only applicable to specific bacteria in a sampleFusarium proliferatumIs unable to realizePichia kudriavzeviiIs detected by the total amount of the (a); in addition, in the case of detection using the asymmetric specific primer, different concentrations of upstream and downstream primers (low concentration of upstream primer and high concentration of downstream primer) are added to a PCR system, and a double-stranded product is formed by Recombinant Polymerase Amplification (RPA) amplification, and as the PCR reaction proceeds, the upstream primer is consumed and the downstream primer is amplified using newly synthesized double-stranded DNA as a template to form single-stranded DNA having a G quadruplex end, thereby detecting the presence of a G quadruplex/heme-mimetic enzyme activity in a sampleFusarium proliferatum. However, this quantitative method still requires a PCR step to generate G quadruplexes, and the PCR process still requires high-volume PCR equipment and a strict operating environment.
Disclosure of Invention
One of the present invention is used forPichia kudriavzeviiAbsolute quantitative probes, kits and applications solve at least one of the following technical problems: (1) The existing method can not realize allPichia kudriavzeviiIs detected by the total amount of the (a); (2) The existing quantitative method has low species resolution and/or insufficient detection accuracy; (3) The existing quantitative method needs high-volume instruments and/or strict operation environment, and is not suitable for timely detection after production and sampling; (4) the existing quantitative method has complicated operation and the like.
It is a first object of the present invention to provide a set of probes, including signaling probes and quenching probes; the signal probe sequence is shown in SEQ ID NO.1 (GGGTGGGTGGGTGGGTGTTTGAGCGTCGTTTCCATC).
In one embodiment, the quenching probe sequence is shown in SEQ ID NO.2 (GATGGAAACGACGCTCAAACACCCA).
A second object of the present invention is to providePichia kudriavzeviiA method of quantification comprising the use of a probe of the invention.
The method comprises the following steps: melting DNA in the sample to be detected; adding excessive signal probes (with the sequence shown as SEQ ID NO. 1), and combining with a target nucleotide fragment of a sample to be detected to form double chains, so that G quadruplex is exposed outside the sequence; adding enough quenching probes (with the sequence shown as SEQ ID NO. 2) to form double chains with unbound signaling probes, and destroying the structure of the G quadruplex; g quadruplex with bare drain reacts with heme to form G quadruplex/heme mimetic enzyme with catalase activity, combined with activity characterization of catalasePichia kudriavzeviiIs a biomass of (a) and (b).
In one embodiment, the method is an absolute quantification method, further comprising: establishing the catalase activity (or an index correlating with the catalase activity, such as the absorbance of the solution at wavelength 420 nm after catalyzing the oxidation of ABTS by hydrogen peroxide to ABTS +)Pichia kudriavzeviiA standard curve of biomass of (2); when the sample to be detected is detected, the detected catalase activity is substituted into a standard curve, and the sample to be detected is obtainedPichia kudriavzeviiIs a biomass of (a) and (b).
In one embodiment, the method isThe relative quantification method further comprises: detecting a plurality of samples, and determining the relative ratio of the catalase activities detected by the different samplesPichia kudriavzeviiRelative values of biomass of (a).
In one embodiment, the sample to be tested is a sample containing a cell, genome, metagenome, or the like. Optionally, the sample to be detected is a finished fermented food or a sample obtained from the fermentation process of the fermented food; optionally, the sample to be measured is subjected to pretreatment such as centrifugation and bacterial cell collection, and then subjected to subsequent measurement. Preferably, the cells in the sample are collected and then subjected to DNA melting treatment directly without genome extraction.
In one embodiment, the sample is a fermented food product or a sample or environmental sample taken during fermentation of a fermented food product.
In one embodiment, the fermented food is any one or more of the following: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverage, alcoholic beverage, yoghurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd, fermented rice flour food and the like; the environmental sample is an environmental sample selected from intestinal tracts, soil and water bodies.
In one embodiment, the melting of the DNA in the sample to be tested is performed at an elevated temperature. Alternatively, the sample to be tested is treated at a temperature above 90 ℃. Can be any one of metal bath, water bath, oven, thermal insulation instrument and the like which can provide environment with corresponding temperature.
In one embodiment, the melting is performed in a buffer. Alternatively, the buffer may be Tris-HCl buffer, further containing KCl, NH 4 Cl, naCl, or any one or more thereof. Alternatively, the buffer is Tris-HCl, KCl, ph=7.9.
In one embodiment, the excess is an amount of signaling probe added above that required to fully bind to the target nucleotide fragment of the test sample to form a duplex. The specific amounts used may be determined by one of ordinary skill in the art, in combination with one or more specific samples to be tested, or by pre-experimentation.
In one embodiment, the excess is in excess of 10 10 And copies of the signaling probe.
In one embodiment, the binding of the signaling probe to the target nucleotide fragment of the test sample to form a double strand is performed at a temperature in the range of 50-60 ℃.
In one embodiment, the sufficient amount is an amount of quenching probe that is added in an amount sufficient to form a double strand with all unbound signaling probes. The specific amounts used may be determined by one of ordinary skill in the art in combination with the general knowledge in the art, or by specific samples to be tested, or by pre-experiments.
In one embodiment, the sufficient amount refers to a double amount of signaling probe.
In one embodiment, the adding a sufficient amount of the quenching probe to form a double strand with the unbound signaling probe is performed at a temperature that causes the quenching probe to form a double strand with the unbound signaling probe; the determination of a specific sample to be tested may be determined by a person skilled in the art in combination with the general knowledge in the art.
In one embodiment, the reaction of the G quadruplex with heme with the naked eye forms a G quadruplex/heme mimetic enzyme having catalase activity, coupled with characterization of catalase activityPichia kudriavzeviiThe biomass of (2) is that after heme is added into the system to react, ABTS and H are added 2 O 2 The catalase activity was then characterized by the absorbance of the reactant.
In one embodiment, the absorbance is at wavelength 420 nm.
In one embodiment, the quantification method specifically comprises:
(1) Carrying out DNA melting treatment on a sample to be detected;
(2) Adding a signal probe, and reacting for 30 min at 55 ℃;
(3) Adding a quenching probe, and reacting for 30 min at 55 ℃;
(4) Adding heme, and reacting at 37 ℃ for 30 min;
(5) Adding 2, 2-azino-bis- (3-ethylbenzodihydrothiazoline-6-sulphonic acid) diammonium salt (ABTS) and H 2 O 2 Reacting at 37 ℃ for 30 min;
(6) Detecting the absorbance of the reactant at wavelength 420 nm;
(7) Binding absorbance to the samplePichia kudriavzeviiQuantification was performed.
In one embodiment, the quantification method further comprises: with different known arrangementsPichia kudriavzeviiThe method comprises the steps of measuring the absorbance values of different samples after the samples are treated by the method; plotting absorbance versus timePichia kudriavzeviiA standard curve of content; substituting the absorbance value obtained by the sample to be tested after the treatment by the method into a standard curve to obtain the sample to be testedPichia kudriavzeviiThe content is as follows.
A third object of the present invention is to provide a method forPichia kudriavzeviiAn absolute quantitative detection kit contains the signal probe with the sequence shown as SEQ ID NO. 1.
In one embodiment, the detection kit further comprises a quenching probe having the sequence shown in SEQ ID NO. 2.
In one embodiment, the detection kit further comprises any one or more of the following: heme, buffer, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS), H 2 O 2 . These reagents may not be contained, and an operator may prepare the kit separately when using the kit.
In one embodiment, the detection kit may comprise a buffer solution of Tris-HCl, KCl, and NH 4 Cl, naCl, or any one or more thereof. Alternatively, the buffer is Tris-HCl, KCl, ph=7.9.
In one embodiment, the detection kit isPichia kudriavzeviiAn absolute quantification kit comprising simultaneously four reagents (reagent 1, reagent 2, reagent 3, reagent 4) and a set of reagentsPichia kudriavzeviiQuantitative probe (Signal probe, quench)A probe); the reagent 1 comprises heme; the reagent 2 comprises buffer (Tris-HCl, KCl, pH=7.9; wherein KCl can be replaced by NH) 4 Cl, naCl); the reagent 3 comprises 2, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS); the reagent 4 comprises H 2 O 2 。
In one embodiment, the reagents or probes in the assay kit may be in a liquid or solid state, and may be routinely adjusted to appropriate concentrations by those skilled in the art when in use.
A fourth object of the invention is to provide a method of using the kit.
In one embodiment, the method of use comprises: adding excessive signal probes into a sample to be detected of DNA melting for reacting for a period of time, so that the signal probes are combined with target fragments in the sample to be detected; then adding a sufficient amount of quenching probe to form double chains with the unbound signaling probe; adding heme, reacting for a period of time, adding ABTS and H 2 O 2 Reacting for a period of time, detecting the absorbance of the reactant, and combining the absorbance with the absorbance of the samplePichia kudriavzeviiQuantification was performed.
In one embodiment, the method includes adjusting the reagents and probes to a concentration suitable for use.
(1) Carrying out DNA melting treatment on a sample to be detected; (2) adding a signal probe, and reacting for 30 min at 55 ℃; (3) adding a quenching probe, and reacting for 30 min at 55 ℃; (4) adding heme, and reacting for 30 min at 37 ℃; (5) Adding 2, 2-azino-bis- (3-ethylbenzodihydrothiazoline-6-sulphonic acid) diammonium salt (ABTS) and H 2 O 2 Reacting at 37 ℃ for 30 min; (6) detecting absorbance of the reactant at wavelength 420 nm; (7) Binding absorbance to the samplePichia kudriavzeviiQuantification was performed.
It is a fifth object of the present invention to provide a kit of parts as described inPichia kudriavzeviiApplication in quantification.
In one embodiment, the application is for use in the field of fermented food technology or the field of the environment; optionally, the fermented food is any one or more of the following: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverage, alcoholic beverage, yoghurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd, fermented rice flour food and the like; the environmental sample is an environmental sample selected from intestinal tracts, soil and water bodies.
In one embodiment, the sample to be tested may be a sample containing a cell, genome, metagenome or the like. Optionally, the sample to be tested is a finished fermented food or a sample or an environmental sample obtained from the fermentation process of the fermented food; optionally, the sample to be measured is subjected to pretreatment such as centrifugation and bacterial cell collection, and then subjected to subsequent measurement. Preferably, the cells in the sample are collected and then subjected to DNA melting treatment directly without genome extraction.
The beneficial effects are that:
the invention combines the G quadruplex with the specificity sequence to form a signal probe, the signal probe is combined with the target sequence to enable the G quadruplex to be exposed outside the sequence, a sufficient amount of quenching probe and unreacted signal probe are added to form double chains, the structure of the G quadruplex is destroyed, the G quadruplex/heme mimic enzyme is formed by reacting with heme, the catalase activity is shown, and the catalase activity is used for representing the biomass of microorganisms. The invention is characterized in thatPichia kudriavzeviiQuantitative probes capable of realizingPichia kudriavzeviiIs detected by the total amount of the (a); further, a signaling probe was optimized with a sequence of GGGTGGGTGGGTGGGTGTTTGAGCGTCGTTTCCATC (SEQ ID NO. 1) and a quenching probe of GATGGAAACGACGCTCAAACACCCA (SEQ ID NO. 2). Compared with the signal sequence of SEQ ID NO.3, the G quadruplex sequence in the signal probe of SEQ ID NO.1 does not generate additional space structure with the specific sequence (figure 1), and the detection accuracy is higher and the minimum detection limit is improved.
The probe of the invention is used for detection andPichia kudriavzeviiin the quantitative process, the detection flow of expensive instruments is not needed. The absolute quantifying kit for the microorganisms is also provided for the first time, and can complete quantifying work within 2.5 h. The present invention is directed to avoiding the use of high-volume equipment such as PCR apparatusThe combination of the signaling probe and the quenching probe realizes the microbial quantification. The invention solves the problem that the existing microorganism quantitative means depend on expensive instruments and are very limited in practical use.
Further, the invention can realize quick speedPichia kudriavzeviiThe detection is carried out without extracting nucleic acid from the sample, and only the microorganisms in the sample are eluted in the buffer solution to directly carry out subsequent experiments. Meanwhile, compared with the quantitative result of fluorescent quantitative PCR, the quantitative result obtained by the method has no significant difference.
In conclusion, the probe and the detection kit provided by the invention are used forPichia kudriavzeviiThe quantitative method has the characteristics of rapidness, cheapness and accuracy.
Drawings
Fig. 1: signal probe dimer structure. (A) The G quadruplex sequence of SEQ ID NO.1 is not self-loop with the specific sequence; (B) SEQ ID NO.3 has been reported to self-loop G quadruplex sequences with specific sequences for microbial quantification.
Fig. 2:Pichia kudriavzeviispecificity of the probe.
Fig. 3: genome extraction-basedPichia kudriavzeviiStandard curve of quantitative probe.
Fig. 4: based on non-extraction of sample genomePichia kudriavzeviiStandard curve of quantitative probe.
Fig. 5: qPCR standard curve.
Fig. 6: comparison of genome extraction-basedPichia kudriavzeviiQuantitative experiments with probes based on non-extracted sample genomesPichia kudriavzeviiQuantitative experiments with probes and qPCRPichia kudriavzeviiQuantitative experiments; wherein (A) is based on not extracting the sample genomePichia kudriavzeviiQuantitative experiments with probes, (B) genome-based extractionPichia kudriavzeviiQuantitative experiments with probes, (C) qPCRPichia kudriavzeviiAnd (5) quantitative experiment.
Fig. 7: the stability of the detection results of the probe (A) based on SEQ ID NO.1/SEQ ID NO.2 and the probe (B) based on SEQ ID NO.3/SEQ ID NO.4 were compared.
The specific embodiment is as follows:
example 1:Pichia kudriavzeviiquantitative probe combination reagent
A probe combination reagent; containing separately packaged signaling probe reagents and quenching probe reagents; wherein the sequence of the signal probe is shown as SEQ ID NO.1, and the sequence of the quenching probe is shown as SEQ ID NO. 2.
The signal probe reagent and the quenching probe reagent are dry powder or liquid; in the case of dry powders, the solution may be diluted to a suitable concentration prior to the experiment, for example, 20. Mu.M using sterile water or buffer; in the case of liquid form, the concentration may be 20 to 200. Mu.M, and the reagent may be diluted before use or used directly.
Example 2:Pichia kudriavzeviiquantitative kit and use thereof
Pichia kudriavzeviiA quantification kit comprising a separately packaged signaling probe reagent and a quenching probe reagent; wherein the sequence of the signal probe is shown as SEQ ID NO.1, and the sequence of the quenching probe is shown as SEQ ID NO. 2.
The kit can be used together with heme, buffer solution, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS), H 2 O 2 Is matched with the components.
The using method is as follows:
(1) And (5) solution preparation. Preparing a heme solution (reagent 1) of 100 nM; preparing Tris-HCl with final concentration of 50 mM, KCl with final concentration of 50 mM and final pH of 7.9 (reagent 2); 7 mM 2, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS) (reagent 3) and 7 mM H 2 O 2 Solution (reagent 4); the solvents were all sterile water.
(2) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL, 4. Mu.L of the sample genomic DNA was added, and the mixture was treated in a water bath at 90℃for 10 minutes. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(3) The quenching probe forms a double strand with the unbound signaling probe. The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (2), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(4) Forming heme/G quadruplex structure. Reagent 1 with the final concentration of 100 nM is added into the system after the reaction in the step (3), and the reaction is treated for 30 min at 37 ℃.
(5) And (5) color reaction. To the system in which the reaction of (4) was completed, a reagent (ABTS) having a final concentration of 7 mM and a reagent 4 having a final concentration of 7 mM were added, and the mixture was treated at 37℃for 30 minutes to carry out a reaction (green).
Detecting the absorbance of the reactant at wavelength 420 nm; binding absorbance to the samplePichia kudriavzeviiQuantification was performed.
Of course, the absorbance and the absorbance can be plotted by themselves during absolute quantificationPichia kudriavzeviiThe standard curve of biomass or the standard curve is directly converted according to the recommended use method of the kitPichia kudriavzeviiIs a biomass of (a) and (b).
Example 3:Pichia kudriavzeviiquantitative reagent kit
Pichia kudriavzeviiA quantification kit comprising a separately packaged signaling probe reagent and a quenching probe reagent; wherein the sequence of the signal probe is shown as SEQ ID NO.1, and the sequence of the quenching probe is shown as SEQ ID NO. 2.
The kit also contains 100 nM heme solution (reagent 1), tris-HCL buffer solution, 7 mM 2, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS), 7 mM H 2 O 2 A solution.
Example 4:Pichia kudriavzeviispecificity of the quantitative kit
(1) Selection of sources from fermented cerealPichia kudriavzeviiAs positive controls, 36 bacterial species microorganisms and 6 fungal species microorganisms widely existing in the fermented food sample were selected as negative controls, and the bacterial microorganisms were respectivelyLactobacillus buchneri,Lactobacillus dioilvorans,Lactobacillus brevis,Lactobacillus crustorum,Lactobacillus plantarum,Lactobacillus harbinensis,Lactobacillus acidiliscis,Pediococcus ethanolidurans,Pediococcus acidilactici,Pediococcus pentosaceus,Lactobacillus murinus,Lactobacillus curvatus,Lactobacillus casei,Lactobacillus reuteri,Lactobacillus panis,Lactobacillus fermentum,Lactobacillus johnsonii,Lactobacillus delbrueckii,Lactococcus lactis,Weissella confusa,Weissella paramesenteroides,Weissella viridescens,Leuconostoc citreum,Leuconostoc lactis,Leuconostoc mesenteroides,Leuconostoc pseudomesenteroides,Enterococcus italicus,Enterococcus lactis,Enterococcus faecalis,Bacillus coagulans,Bacillus licheniformis,Bacillus tequilensis,Bacillus subtilis,Bacillus velezensis,Acetobacter pasteurianus,Enterococcus faecium. The fungus microorganisms are respectivelyAspergillus tubingensis，Mucor rouxianus，Schizosaccharomyces pombe，Zygosaccharomyces bailii，Saccharomycopsis fibuligera,Saccharomyces cerevisiae。
(2) The above microorganisms are cultured in different culture media, whereinLactobacillus buchneri,Lactobacillus dioilvorans,Lactobacillus brevis,Lactobacillus crustorum,Lactobacillus plantarum,Lactobacillus harbinensis,Lactobacillus acidiliscis,Pediococcus ethanolidurans,Pediococcus acidilactici,Pediococcus pentosaceus,Lactobacillus murinus,Lactobacillus curvatus,Lactobacillus casei,Lactobacillus reuteri,Lactobacillus panis,Lactobacillus fermentum,Lactobacillus johnsonii,Lactobacillus delbrueckii,Lactococcus lactis,Weissella confusa,Weissella paramesenteroides,Weissella viridescens,Leuconostoc citreum,Leuconostoc lactis,Leuconostoc mesenteroides,Leuconostoc pseudomesenteroidesUsing MRS culture medium, wherein the formula of the culture medium is tryptone 10.0 g/L, beef extract 8.0 g/L, yeast extract 4.0 g/L, glucose 18.0 g/L, anhydrous sorbitol oleate 0.8 mL/L, K 2 HPO 4 2.5 g/L, sodium acetate trihydrate 6.0 g/L, triammonium citrate 2.0 g/L, mgSO 4 ·7H 2 O 0.3 g/L，MnSO 4 ·4H 2 O0.08 g/L. The culture conditions were 48 and h at 30 ℃.Enterococcus italicus,Enterococcus lactis,Enterococcus faecalis,Bacillus coagulans,Bacillus licheniformis,Bacillus tequilensis,Bacillus subtilis,Bacillus velezensis,Acetobacter pasteurianus,Enterococcus faeciumLB culture medium is used, and the formula of the culture medium is peptone 10.0 g/L, yeast powder 5 g/L and sodium chloride 10 g/L. The culture conditions were 24℃and h.Aspergillus tubingensis，Mucor rouxianus，Schizosaccharomyces pombe，Zygosaccharomyces bailii，Pichia kudriavzevii，Saccharomycopsis fibuligera，Saccharomyces cerevisiaeYPD medium was used in the formulation of yeast extract 10 g/L, peptone 20 g/L, glucose 20 g/L. The culture conditions are as follows: the mold is cultured at 30 ℃ for 5 days, and the yeast is cultured at 30 ℃ for 2 days.
(3) And (5) extracting a single bacterial genome. The bacterial liquid was treated at 12000 rpm for 2 min, and the precipitate was collected. The genome of the 43 pure cultures of microorganisms was extracted using the gene extraction kit DNeasy Tissue Kit.
(4) The probe is selected asPichia kudriavzeviiSpecific probe, signaling probe sequence GGGTGGGTGGGTGGGTGTTTGAGCGTCGTTTCCATC (SEQ ID NO. 1) and quenching probe sequence GATGGAAACGACGCTCAAACACCCA (SEQ ID NO. 2).
(4) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9), 4. Mu.L of genomic DNA of different microorganisms was added, respectively, and the mixture was treated in a water bath at 90℃for 10 minutes. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(5) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (4), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(6) Forming heme/G quadruplex structure. Reagent 1 (heme) with a final concentration of 100 nM was added to the system after the reaction in the step (5), and the reaction was carried out at 37℃for 30 minutes.
(7) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction of (6) 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. As a result, as shown in FIG. 2, addPichia kudriavzeviiThe experimental group of genome has chromogenic reaction and is added with non-additivePichia kudriavzeviiThe experiment group and the blank control group of the kit have no chromogenic reaction, which proves that the detection in the kitPichia kudriavzeviiIs a specific factor of (2).
Example 5: quantitative method accuracy assessment
（1）Pichia kudriavzeviiBacterial solutions were obtained according to the culture method in example 4, and microbial concentrations were measured by plate count method, and genome extraction was the same as in example 4.
(2) Dilution by 10-fold gradientPichia kudriavzeviiGenomic DNA.
(3) UsingPichia kudriavzeviiAt different concentrationsPichia kudriavzeviiGenomic DNA was subjected to a chromogenic reaction. The sequence of the signaling probe was GGGTGGGTGGGTGGGTGTTTGAGCGTCGTTTCCATC (SEQ ID NO. 1) and the sequence of the quenching probe was GATGGAAACGACGCTCAAACACCCA (SEQ ID NO. 2).
(4) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, final pH of 7.9) was added 4. Mu.L of different dilutions of genomic DNA (no sample DNA added as a blank). Treating in water bath at 90deg.C for 10 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(5) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (4), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(6) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction in step (5) to a final concentration of 100 nM, and the reaction was carried out at 37℃for 30 minutes.
(7) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction of (6) 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420 and nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank.
(8) Constructing a standard curve by calculating the linear relation between the absorbance and the concentration of the bacterial liquid, as shown in figure 3, R 2 =0.99 (x is log10 CFU/mL, y is OD 420 A linear range of 10 3 ~10 7 ). The accuracy of the quantitative method of the kit provided by the invention is proved.
Example 6: in wine samplesPichia kudriavzeviiQuantitative experiments of (2)
(1) Reference is made to Gayevskiy, v., & Goddard, m. (2012) & Geographic delineations of yeast communities and populations associated with vines and wines in New zealand. ISME J, 6 (7), 1281-1290. Materials and methods, samples were collected from the shandong tobacco stand of a well known wine manufacturer. The genomic concentration was 658.39 ng/. Mu.L.
(2) UsingPichia kudriavzeviiThe probe of (2) is subjected to a color reaction. The sequence of the signaling probe was GGGTGGGTGGGTGGGTGTTTGAGCGTCGTTTCCATC (SEQ ID NO. 1) and the sequence of the quenching probe was GATGGAAACGACGCTCAAACACCCA (SEQ ID NO. 2).
(4) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, final pH of 7.9), 4. Mu.L of sample metagenomic DNA (no sample DNA added as a blank) was added. Treating in water bath at 90deg.C for 10 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(5) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (4), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(6) Forming heme/G quadruplex structure. Reagent 1 (heme) with a final concentration of 100 nM was added to the system after the reaction in the step (5), and the reaction was carried out at 37℃for 30 minutes.
(7) And (5) color reaction. Adding reagent 3 (ABTS) having a final concentration of 7 mM and reagent 4 (7 mM H) having a final concentration of 7 mM to the system at the end of the reaction of (6) 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420. 420 nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0.44 using the experimental group without the sample DNA as a blank.
(8) From the standard curve obtained in example 5, the sample was calculatedPichia kudriavzeviiTotal amount of 5.92 log 10 CFU/mL。
(9) The same sample was subjected to fluorescent quantitative PCR (quantitative procedure and materials are the same as in example 11 (6))Pichia kudriavzeviiQuantitative determination is carried out, and the result shows thatPichia kudriavzeviiTotal amount of 5.92 log 10 CFU/mL was substantially identical to the quantitative results measured by the method described above (coefficient of variation, cv=0.0005).
Example 7: in the fermented grain samplePichia kudriavzeviiAbsolute quantification of (2)
(1) Referring to the method in MATERIALS AND METHODS of Song Z W, du H, zhang Y, xu Y Unraveling core functional microbiota in traditional solid-state fermentation by high-throughput amplicons and metatranscriptomics sequencing Frontiers in microbiology 2017, 8:1294, metagenome from a fermented grain sample of Shandong province was extracted at a genome concentration of 100.02 ng/. Mu.L.
(2) UsingPichia kudriavzeviiThe probe of (2) is subjected to a color reaction. The sequence of the signaling probe was GGGTGGGTGGGTGGGTGTTTGAGCGTCGTTTCCATC (SEQ ID NO. 1) and the sequence of the quenching probe was GATGGAAACGACGCTCAAACACCCA (SEQ ID NO. 2).
(3) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, final pH of 7.9) was added 4. Mu.L of fermented grain metagenomic DNA (no sample DNA added as a blank). Treating in water bath at 90deg.C for 10 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(4) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (3), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(5) Forming heme/G quadruplex structure. Reagent 1 (heme) with a final concentration of 100 nM was added to the system after the reaction in the step (4), and the reaction was carried out at 37℃for 30 minutes.
(6) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction of (5) 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420. 420 nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0.612 using the experimental group without sample DNA as a blank.
(7) From the standard curve obtained in example 2, the sample was calculatedPichia kudriavzeviiIs 6.78 log of total microorganism 10 CFU/mL。
(8) The same fermented grain sample was subjected to a fluorogenic assay (assay step and material were the same as in example 11 (6))Pichia kudriavzeviiQuantitative determination is carried out, and the result shows thatPichia kudriavzeviiThe total amount of microorganisms was 6.71 log 10 CFU/mL, substantially consistent with the quantitative results measured by the method described above (coefficient of variation, cv=0.008).
Example 8: based on non-extraction of sample genomePichia kudriavzeviiAbsolute quantification method
（1）Pichia kudriavzeviiBacterial liquids were obtained according to the culture method in example 4, and microbial concentrations were determined by plate counting.
(2) Dilution by 10-fold gradient in (1)Pichia kudriavzeviiBacterial liquid
(3) UsingPichia kudriavzeviiThe probe of (2) is subjected to a color reaction. The sequence of the signaling probe was GGGTGGGTGGGTGGGTGTTTGAGCGTCGTTTCCATC (SEQ ID NO. 1) and the sequence of the quenching probe was GATGGAAACGACGCTCAAACACCCA (SEQ ID NO. 2).
(4) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9) was added 10. Mu.L of different dilutions of bacterial solution (no sample bacterial solution was added as a blank). Treating in boiling water bath for 20 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(5) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (4), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(6) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction in step (5) to a final concentration of 100 nM, and the reaction was carried out at 37℃for 30 minutes.
(7) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction of (6) 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420 and nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank.
(8) Constructing a standard curve by calculating the linear relation between the absorbance and the concentration of the bacterial liquid, as shown in figure 4, R 2 =0.99 (x is log10 CFU/mL, y is OD 420 A linear range of 10 3 ~10 7 ). Proved by the accuracy of the quantitative method of the kit
Example 9: method for determining absolute quantification of microorganisms in wine samples based on non-extraction of sample genomePichia kudriavzeviiContent of (3)
(1) The sample is collected in some known grape wine manufacturer of Shandong Jiedu, and the sample processing method is as follows: 1 mL sample was added with 5 mL phosphate buffer, 3000×gAnd (5) centrifuging for 10 min to collect the thalli.
(2) And (5) washing. To the cells obtained in (1), 5 mL phosphate buffer was added, and the cells were collected by centrifugation at 12000 Xg for 2 minutes and repeated.
(3) The cells were resuspended, and 1 mL reagent 2 (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9) was added to the cells obtained in (2), followed by air-aspiration and mixing.
(4) UsingPichia kudriavzeviiThe probe of (2) is subjected to a color reaction. The sequence of the signaling probe was GGGTGGGTGGGTGGGTGTTTGAGCGTCGTTTCCATC (SEQ ID NO. 1) and the sequence of the quenching probe was GATGGAAACGACGCTCAAACACCCA (SEQ ID NO. 2).
(5) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9), 10. Mu.L of grape fermentation broth (blank control without sample broth) was added. Treating in boiling water bath for 20 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(6) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (5), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(7) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction in step (6) to a final concentration of 100 nM, and the reaction was carried out at 37℃for 30 minutes.
(8) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction of (7) 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420. 420 nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0.512 using the experimental group without the sample DNA as a blank.
(9) From the standard curve obtained in example 8, the sample was calculatedPichia kudriavzeviiTotal amount of 5.89 log 10 CFU/mL。
(10) The above-mentioned procedures were carried out by fluorescence quantitative PCR (the quantitative procedure and materials are the same as in example 11 (6))In a samplePichia kudriavzeviiQuantitative determination is carried out, and the result shows thatPichia kudriavzeviiTotal amount of 5.92 log 10 CFU/mL was substantially identical to the quantitative results measured by the method described above (coefficient of variation, cv=0.003).
Example 10: absolute quantification method based on non-extraction sample genome for determining fermented grain samplesPichia kudriavzeviiContent of (3)
(1) The sample is derived from fermented grains of certain winery in Shandong, and the sample treatment method comprises the following steps: 5 mL phosphate buffer was added to the 1 g sample, and the cells were collected by centrifugation at 3000 Xg for 10 min.
(2) And (5) washing. To the cells obtained in (1), 5 mL phosphate buffer was added, and the cells were collected by centrifugation at 12000 Xg for 2 minutes and repeated.
(3) The cells were resuspended, and 1 mL reagent 2 (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9) was added to the cells obtained in (2), followed by air-aspiration and mixing.
(4) UsingPichia kudriavzeviiThe probe of (2) is subjected to a color reaction. The sequence of the signaling probe was GGGTGGGTGGGTGGGTGTTTGAGCGTCGTTTCCATC (SEQ ID NO. 1) and the sequence of the quenching probe was GATGGAAACGACGCTCAAACACCCA (SEQ ID NO. 2).
(5) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9), 10. Mu.L of fermented grain broth (no sample broth added as a blank) was added. Treating in boiling water bath for 20 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(6) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (5), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(7) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction in step (6) to a final concentration of 100 nM, and the reaction was carried out at 37℃for 30 minutes.
(8) And (5) color reaction. To the reaction (7) ended bodyReagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM are added into the system 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420. 420 nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0.592 using the experimental group without the sample DNA as a blank.
(9) From the standard curve obtained in example 8, the sample was calculatedPichia kudriavzeviiTotal 6.69 log 10 CFU/mL，
(10) The same sample was subjected to fluorescent quantitative PCR (quantitative procedure and materials are the same as in example 11 (6))Pichia kudriavzeviiQuantitative determination is carried out, and the result shows thatPichia kudriavzeviiTotal 6.71 log 10 CFU/mL was substantially identical to the two sets of data measured by the method described above (coefficient of variation, cv=0.0017).
Example 11: comparison of microorganism quantitative detection kit and fluorescent quantitative PCR detection result
(1) The samples were selected from three samples of fermented grains of white spirit from the end point of the fermentation in some winery in Shandong province.
(2) Sample processing:
(i) Total genomes in three samples were extracted at genome concentrations of 369 ng/. Mu.L, 590 ng/. Mu.L, 321.89 ng/. Mu.L, respectively.
(ii) 5 mL phosphate buffer was added to the 1 g sample, and the cells were collected by centrifugation at 3000 Xg for 10 min. To the obtained cells, 5 mL phosphate buffer was added, and the cells were collected by centrifugation at 12000 Xg for 2 min and repeated. The cells were resuspended, and 1 mL reagent 2 buffer was added to the obtained cells, followed by air-aspiration and mixing.
(3) UsingPichia kudriavzeviiThe probe of (2) is subjected to a color reaction. The sequence of the signaling probe was GGGTGGGTGGGTGGGTGTTTGAGCGTCGTTTCCATC (SEQ ID NO. 1) and the sequence of the quenching probe was GATGGAAACGACGCTCAAACACCCA (SEQ ID NO. 2).
(4) Assay based on kit quantification method without genome extraction.
(i) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9), 10. Mu.L of fermented grain broth (no sample broth added as a blank) was added. Treating in boiling water bath for 20 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(ii) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (i), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(iii) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction in step (ii) to a final concentration of 100 mM, and the reaction was carried out at 37℃for 30 minutes.
(iv) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction (iii) 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420 nm was measured using an ultraviolet spectrophotometer and the experimental group without sample DNA was used as a blank, showing that the absorbance was 0.598,0.595,0.620.
(v) From the standard curve obtained in example 8, the sample was calculatedPichia kudriavzeviiThe total amount is 6.82+ -0.14 log 10 CFU/mL。
(5) Kit quantitative method determination based on genome extraction
(i) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, final pH of 7.9) was added 4. Mu.L of fermented grain metagenomic DNA (no sample DNA added as a blank). Treating in water bath at 90deg.C for 10 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(ii) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (i), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(iii) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction in step (ii) to a final concentration of 100 nM, and the mixture was treated at 37℃for 30 minutes.
(iv) Display deviceThe color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction of (5) 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420 nm was measured using an ultraviolet spectrophotometer and the experimental group without sample DNA was used as a blank, showing that the absorbance was 0.613,0.625,0.612.
(v) From the standard curve obtained in example 5, the sample was calculatedPichia kudriavzeviiThe total amount was 6.83.+ -. 0.071 log 10 CFU/mL。
(6) quantitative qPCR in samplesPichia kudriavzeviiContent of
（i）Pichia kudriavzeviiBacterial solutions were obtained according to the culture method in example 4, and microbial concentrations were measured by plate count method, and genome extraction was the same as in example 4.
(ii) Dilution by 10-fold gradientPichia kudriavzeviiGenomic DNA.
(iii) The qPCR system was SYBR Green 10. Mu.L, upstream and downstream primers 20. Mu.M, template DNA 0.5. Mu.L, and sterile water supplemented 20. Mu.L.
(iv) Reaction procedure for qPCR: pre-denaturation at 95 ℃ for 5 min, cycle phase: 95. c5 s,60 ℃ 20 s; the cycle number 40, the dissolution profile increased from 65 ℃ to 95 ℃,0.5 ℃ per 5 s.
(v) UsingPichia kudriavzeviiThe extracted genome was qPCR-performed with specific primers, the primer sequence having a downstream sequence of GTTTGAGCGTCGTTTCCATC (SEQ ID NO. 5) and a downstream sequence of ATACCCTTCTTAACACCTGGC (SEQ ID NO. 6).
(vi) Establishment by 10-fold gradient dilution of genomic DNACTValue and value ofPichia kudriavzeviiThe standard curve of the fungus concentration is shown in FIG. 4, R 2 =0.99。
(vii) qPCR system and reaction conditions are the same as (iii), (iv). From the CT value of the end of the reaction, calculating by the established standard curvePichia kudriavzeviiThe concentration in the sample was 6.799.+ -. 0.122 log 10 CFU/g。
(7) The results are shown in FIG. 6 by the analysis of the significance differences, three assaysNo significant difference between the measuring methodsP<0.05）
Example 12: detection limit for detection by using two different sequence signal probes
（1）Pichia kudriavzeviiBacterial liquid was obtained according to the culture method in example 4, and microbial bacterial concentration was measured by plate count method and the genome at a concentration of 7.49 log10 CFU/mL was extracted as in example 4.
(2) Dilution by 10-fold gradientPichia kudriavzeviiGenomic DNA, 2.1 log10 CFU/mL of DNA template was obtained.
(3) The invention providesPichia kudriavzeviiThe sequence of the signaling probe was GGGTGGGTGGGTGGGTGTTTGAGCGTCGTTTCCATC (SEQ ID NO. 1) and the sequence of the quenching probe was GATGGAAACGACGCTCAAACACCCA (SEQ ID NO. 2). Adding 3.2 log of the product obtained in (2) 10 CFU/mLPichia kudriavzeviiGenomic DNA was subjected to a chromogenic reaction.
(4) By means ofPichia kudriavzeviiThe signal probe sequence was (SEQ ID NO. 3) GGGATTGGGATTGGGATTGGGGTTTGAGCGTCGTTTCCATC and the quenching probe sequence was GATGGAAACGACGCTCAAACCCCAA (SEQ ID NO. 4). Adding 3.2 log10 CFU/mL obtained in (2)Pichia kudriavzeviiGenomic DNA was subjected to a chromogenic reaction.
(5) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, final pH 7.9) was added 4. Mu.LPichia kudriavzeviiGenomic DNA (blank control without sample DNA). Treating in water bath at 90deg.C for 10 min. After adding 4. Mu.L of 20. Mu.M of different signaling probes, respectively, the reaction was carried out at 55℃for 30 min.
(6) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (5), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(7) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction in step (6) to a final concentration of 100 nM, and the reaction was carried out at 37℃for 30 minutes.
（8）And (5) color reaction. To the system in which the reaction of (7) was completed, reagent 3 (ABTS) having a final concentration of 7 mM and reagent 4 (H) having a final concentration of 7 mM were added, respectively 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420 and nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank.
(9) The steps (5), (6), (7) and (8) were repeated 9 times, and the stability of the detection results was compared as shown in fig. 7. The Coefficient of Variation (CV) of the quantitative result based on the signal sequence of SEQ ID NO.3 was 1.04; the quantitative result variation coefficient based on the signal sequence of SEQ ID NO.1 is 0.02, and the detection effect is stable.
While the invention has been described with reference to the preferred embodiments, it is not limited thereto, and various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
SEQUENCE LISTING
<110> university of Jiangnan
<120> probes for absolute quantification of Pichia kudriavzevii
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 36
<212> DNA
<213> Synthesis
<400> 1
gggtgggtgg gtgggtgttt gagcgtcgtt tccatc 36
<210> 2
<211> 25
<212> DNA
<213> Synthesis
<400> 2
gatggaaacg acgctcaaac accca 25
<210> 3
<211> 41
<212> DNA
<213> Synthesis
<400> 3
gggattggga ttgggattgg ggtttgagcg tcgtttccat c 41
<210> 4
<211> 25
<212> DNA
<213> Synthesis
<400> 4
gatggaaacg acgctcaaac cccaa 25

Claims (11)

1. A set of probes, comprising a signaling probe and a quenching probe; the sequence of the signal probe is shown as SEQ ID NO. 1; the sequence of the quenching probe is shown as SEQ ID NO. 2.
2. A detection kit comprising the signaling probe and the quenching probe according to claim 1.
3. The test kit of claim 2, further comprising any one or more of the following: heme, buffer, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt, H 2 O 2 。
4. The method comprises the following steps ofPichia kudriavzeviiA method for quantification, characterized in that the method uses the probe according to claim 1 or the detection kit according to any one of claims 2-3.
5. The method of quantification of claim 4, wherein the method comprises: melting DNA in the sample to be detected; adding excessive signal probes, and combining with target nucleotide fragments of a sample to be detected to form double chains, so that G quadruplex naked leakage is outside the sequence; adding enough quenching probes and unbound signaling probes to form double chains so as to destroy the G quadruplex structure; g quadruplex with bare drain reacts with heme to form G quadruplex/heme mimetic enzyme with catalase activity, combined with activity characterization of catalasePichia kudriavzeviiIs a biomass of (a) and (b).
6. The method of quantification of claim 4, wherein the method is absolute quantification or relative quantification; when the method is absolute quantification, the method further comprises: establishing the catalase activity or the index related to the catalase activity andPichia kudriavzeviia standard curve of biomass of (2); when the sample to be detected is detected, substituting the detected catalase activity or an index which is related to the catalase activity into a standard curve to obtain the sample to be detectedPichia kudriavzeviiIs a biomass of (a) and (b).
7. The method according to claim 5 or 6, wherein the sample to be measured is a sample containing a cell, a genome or a metagenome.
8. The method of claim 7, wherein the sample is a fermented food or a sample taken from the fermentation process of a fermented food, or an environmental sample.
9. The method of claim 8, wherein the fermented food product is any one or more of the following: soy sauce, table vinegar, cheese, fermented soya beans, fermented bean curd, traditional fermented vegetables, fermented beverages, alcoholic drinks, fermented rice flour foods; the environmental sample is an environmental sample selected from intestinal tracts, soil and water bodies.
10. A method of using the kit of any one of claims 2-3, comprising: adding excessive signal probes into a sample to be detected of DNA melting for reacting for a period of time, so that the signal probes are combined with target fragments in the sample to be detected; then adding enough quenching probes to form double chains with the unbound signaling probes; adding heme, reacting for a period of time, adding ABTS and H 2 O 2 Reacting for a period of time, detecting the absorbance of the reactant, and combining the absorbance with the absorbance of the samplePichia kudriavzeviiQuantification was performed.
11. Detecting fermented food or environmental samplePichia kudriavzeviiA method of content comprising using the probe of claim 1, or the kit of any one of claims 2-3; the fermented food is any one or more of the following: soy sauce, table vinegar, cheese, fermented soya beans, fermented bean curd, traditional fermented vegetables, fermented beverages, alcoholic drinks, fermented rice flour foods; the environmental sample is an environmental sample selected from intestinal tracts, soil and water bodies.
CN202110162970.1A 2021-02-05 2021-02-05 Probe for absolute quantification of pichia kudriavzevii Active CN112877459B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110162970.1A CN112877459B (en) 2021-02-05 2021-02-05 Probe for absolute quantification of pichia kudriavzevii

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110162970.1A CN112877459B (en) 2021-02-05 2021-02-05 Probe for absolute quantification of pichia kudriavzevii

Publications (2)

Publication Number Publication Date
CN112877459A CN112877459A (en) 2021-06-01
CN112877459B true CN112877459B (en) 2023-08-25

Family

ID=76055879

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110162970.1A Active CN112877459B (en) 2021-02-05 2021-02-05 Probe for absolute quantification of pichia kudriavzevii

Country Status (1)

Country Link
CN (1) CN112877459B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108588172A (en) * 2018-05-30 2018-09-28 贵州茅台酒股份有限公司 A kind of selective medium, preparation method and application for quantitatively detecting library Delhi A Ziweishi Pichia pastoris

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ZA200711038B (en) * 2005-06-02 2009-06-24 Cargill Inc Genetically modified yeast of the species Issatchenkia orientalis and closely related species and fermentation processes using same

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108588172A (en) * 2018-05-30 2018-09-28 贵州茅台酒股份有限公司 A kind of selective medium, preparation method and application for quantitatively detecting library Delhi A Ziweishi Pichia pastoris

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Development and validation of a TaqMan RT-PCR method for identification of mayonnaise spoilage yeast Pichia kudriavzevii;M. Y. Syromyatnikov等;AMB Express;第1-9页 *

Also Published As

Publication number Publication date
CN112877459A (en) 2021-06-01

Similar Documents

Publication Publication Date Title
Fang et al. Deciphering the succession patterns of bacterial community and their correlations with environmental factors and flavor compounds during the fermentation of Zhejiang rosy vinegar
Lv et al. Microbial diversity of traditional fermentation starters for Hong Qu glutinous rice wine as determined by PCR-mediated DGGE
Wang et al. Characterization and comparison of microbial community of different typical Chinese liquor Daqus by PCR–DGGE
Song et al. Effect of bioaugmentation on biochemical characterisation and microbial communities in Daqu using Bacillus, Saccharomycopsis and Absidia
CN112779349B (en) Probe for absolute quantification of schizosaccharomyces pombe, kit and application
CN112553362B (en) Absolute quantitative probe for saccharomyces cerevisiae and application thereof
CN112782145B (en) Aspergillus tubingensis absolute quantitative probe and application thereof
Nejati et al. Quantification of major bacteria and yeast species in kefir consortia by multiplex TaqMan qPCR
Shayevitz et al. Barrel-induced variation in the microbiome and mycobiome of aged sour ale and imperial porter beer
Riedl et al. Bavarian wheat beer, an example of a special microbe habitat–cultivation, detection, biofilm formation, characterization of selected lactic acid bacteria hygiene indicators and spoilers
CN112899381B (en) Absolute quantification probe, method and application thereof
Cremonesi et al. Development of quantitative real-time PCR and digital droplet-PCR assays for rapid and early detection of the spoilage yeasts Saccharomycopsis fibuligera and Wickerhamomyces anomalus in bread
Oldham et al. Methods for detection and identification of beer-spoilage microbes
CN105524921B (en) A kind of method of Rapid identification production urethanes yeast
Garcia-Garcia et al. Distribution of lactobacillus and pediococcus in a brewery environment
CN112877459B (en) Probe for absolute quantification of pichia kudriavzevii
CN112695120A (en) Primer, kit and method for rapid identification and quantification of saccharomyces cerevisiae
CN112458197B (en) Kit for absolute quantification of fungi and application thereof
CN112553353B (en) Probes, methods and kits for absolute quantification of lactobacillus and application of probes, methods and kits
CN112553352B (en) Probe, method and kit for absolute quantification of bacterial microorganisms and application of probe, method and kit
CN112501326B (en) Probe, method and kit for absolute quantification of bacillus and application of probe and method and kit
CN112924428B (en) Probe, method and application for absolute quantification of zygosaccharomyces bailii
CN112924429B (en) Absolute quantitative probe and kit for Lactobacillus jin Shini
CN112538520B (en) Absolute quantification method for microorganisms and application thereof
CN114317808A (en) Quantitative detection kit, detection method and application of thermophilic fungi

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant