CN112553353B - Probes, methods and kits for absolute quantification of lactobacillus and application of probes, methods and kits - Google Patents

Probes, methods and kits for absolute quantification of lactobacillus and application of probes, methods and kits Download PDF

Info

Publication number
CN112553353B
CN112553353B CN202011459574.7A CN202011459574A CN112553353B CN 112553353 B CN112553353 B CN 112553353B CN 202011459574 A CN202011459574 A CN 202011459574A CN 112553353 B CN112553353 B CN 112553353B
Authority
CN
China
Prior art keywords
lactobacillus
sample
probe
fermented
reaction
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202011459574.7A
Other languages
Chinese (zh)
Other versions
CN112553353A (en
Inventor
吴群
徐岩
杜如冰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangnan University
Original Assignee
Jiangnan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangnan University filed Critical Jiangnan University
Priority to CN202011459574.7A priority Critical patent/CN112553353B/en
Publication of CN112553353A publication Critical patent/CN112553353A/en
Application granted granted Critical
Publication of CN112553353B publication Critical patent/CN112553353B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a probe, a method and a kit for absolute quantification of lactobacillus and application thereof, belonging to the fields of biology, fermentation and detection. The quantitative probe and the kit for the microorganisms of the lactobacillus can realize the total detection of all the microorganisms of the lactobacillus, do not need expensive instruments when being used for detecting and quantifying the microorganisms of the lactobacillus, and can rapidly complete the quantitative work within 2.5 hours. Meanwhile, the sample used in the present invention does not have to be subjected to nucleic acid extraction. The probe and the detection kit based on the invention are used for quantifying the lactobacillus microorganisms and have the characteristics of rapidness, convenience, cheapness and accuracy.

Description

Probes, methods and kits for absolute quantification of lactobacillus and application of probes, methods and kits
Technical Field
The invention relates to an absolute quantification method of lactobacillus microorganisms, a kit and application thereof, belonging to the fields of biology, fermentation and detection.
Background
Lactobacillus genusLactobacillus) Is widely distributed in fermented foods such as yogurt, cheese, chinese liquor, pickle, etc. In the fermentation process, lactobacillus synthesizes a plurality of volatile and non-volatile organic components such as alcohol, acid, ester and the like through degrading nutrient substances such as carbon sources, nitrogen sources and the like in a fermentation mechanism, so that the product is rich in nutrition and unique in taste. Meanwhile, lactobacillus has the effect of regulating the microbial flora structure during fermentation, for example, lactobacillus can inhibit the growth of pathogenic bacteria by producing lactic acid. Therefore, tracking the dynamic change trend of lactobacillus microorganisms is an important index for judging the fermentation state. At present, quantitative tracking is mainly performed by a plate coating technology, a fluorescent quantitative PCR method and the like, but the defects exist, such as poor timeliness of the plate coating method, dependence of the fluorescent quantitative PCR method on high-volume instruments and a precise experimental operation environment. Therefore, it is necessary to develop a detection method or a quantitative kit which is highly time-efficient, does not depend on high-volume equipment, and is convenient and rapid.
The principle of the G quadruplex/heme mimic enzyme activity detection is that the G quadruplex can form DNA mimic enzyme with catalase activity with heme, can catalyze hydrogen peroxide to oxidize ABTS to generate ABTS+, presents green color reaction, and can detect characteristic absorbance at the wavelength of 420 nm. The stability of the G quadruplex structure is critical to the whole detection process, if the design is improper, when the G quadruplex sequence forms a dimer with other bases, the G quadruplex sequence can not form the G quadruplex, and a quantitative method based on the principle can cause underestimation of the content of a target gene in a sample in use, and reduces the sensitivity and accuracy of the detection method.
At present, the principle based on G quadruplex/heme simulated enzyme activity detection has been reported to be used for specific detection of microorganisms; for example, in the literature Wang Y, li X, xi D, wang X. Visual detection of Fusarium proliferatum based on asymmetric recombinase polymerase amplification and hemin/G-quad DNAzyme, rsc Advances 2019;9:37144-37147, asymmetric specific primers (upstream primer adds reverse sequence modification of G quadruplex, downstream no modification) are used, and the method is only applicable to specific bacteria in a sample Fusarium proliferatumThe detection of the total amount of all microorganisms of the genus lactobacillus cannot be realized; in addition, in the case of detection using the asymmetric specific primer, different concentrations of upstream and downstream primers (low concentration of upstream primer and high concentration of downstream primer) are added to a PCR system, and a double-stranded product is formed by Recombinant Polymerase Amplification (RPA) amplification, and as the PCR reaction proceeds, the upstream primer is consumed and the downstream primer is amplified using newly synthesized double-stranded DNA as a template to form single-stranded DNA having a G quadruplex end, thereby detecting the presence of a G quadruplex/heme-mimetic enzyme activity in a sampleFusarium proliferatum. However, this quantitative method still requires a PCR step to generate G quadruplexes, and the PCR process still requires high-volume PCR equipment and a strict operating environment.
Disclosure of Invention
The invention discloses a method, a kit and application for absolute quantification of microorganisms of lactobacillus, which solve at least one of the following technical problems: (1) The existing method can not realize the total detection of all lactobacillus microorganisms; (2) The existing quantitative method has low species resolution and/or insufficient detection accuracy; (3) The existing quantitative method needs high-volume instruments and/or strict operation environment, and is not suitable for timely detection after production and sampling; (4) the existing quantitative method has complicated operation and the like.
It is a first object of the present invention to provide a set of probes, including signaling probes and quenching probes; the signal probe sequence is shown in SEQ ID NO.1 (GGGTGGGTGGGTGGGTGGGTTAACAAGGTAGCCGTAG).
In one embodiment, the quenching probe sequence is shown in SEQ ID NO.2 (CTACGGCTACCTTGTTAACCCA).
It is a second object of the present invention to provide a method for quantifying a microorganism of the genus Lactobacillus, which comprises using the probe of the present invention.
The method comprises the following steps: melting DNA in the sample to be detected; adding excessive signal probes (with the sequence shown as SEQ ID NO. 1), and combining with a target nucleotide fragment of a sample to be detected to form double chains, so that G quadruplex is exposed outside the sequence; adding enough quenching probes (with the sequence shown as SEQ ID NO. 2) to form double chains with unbound signaling probes, and destroying the structure of the G quadruplex; the naked leakage is utilized to react with heme to form G quadruplex/heme mimic enzyme with catalase activity, and the activity of the mimic enzyme is combined to characterize the biomass of lactobacillus microorganisms.
In one embodiment, the method is an absolute quantification method, further comprising: establishing a standard curve of catalase activity (or an index correlated with catalase activity, such as absorbance of a solution at wavelength 420 nm after catalytic oxidation of ABTS by hydrogen peroxide to abts+) and biomass of a microorganism of the genus lactobacillus; when the sample to be detected is detected, substituting the detected catalase activity into a standard curve to obtain the biomass of the lactobacillus microorganisms in the sample to be detected.
In one embodiment, the method is a relative quantification method, further comprising: detecting a plurality of samples, and determining the relative value of the biomass of the lactobacillus microorganisms in the different samples according to the relative ratio of the catalase activities detected by the different samples.
In one embodiment, the sample to be tested is a sample containing a cell, genome, metagenome, or the like. Optionally, the sample to be detected is a finished fermented food or a sample obtained in the fermentation process of the fermented food, or an environmental sample such as intestinal tract, soil, water body and the like; optionally, the sample to be measured is subjected to pretreatment such as centrifugation and bacterial cell collection, and then subjected to subsequent measurement. Preferably, the cells in the sample are collected and then subjected to DNA melting treatment directly without genome extraction.
In one embodiment, the sample is a fermented food product or a sample taken from the fermentation process of a fermented food product.
In one embodiment, the fermented food is any one or more of the following: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverage, alcoholic beverage, yoghurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd, fermented rice flour food and the like.
In one embodiment, the melting of the DNA in the sample to be tested is performed at an elevated temperature. Alternatively, the sample to be tested is treated at a temperature above 90 ℃. Can be any one of metal bath, water bath, oven, thermal insulation instrument and the like which can provide environment with corresponding temperature.
In one embodiment, the melting is performed in a buffer. Alternatively, the buffer may be Tris-HCl buffer, further containing KCl, NH 4 Cl, naCl, or any one or more thereof. Alternatively, the buffer is Tris-HCl, KCl, ph=7.9.
In one embodiment, the excess is an amount of signaling probe added above that required to fully bind to the target nucleotide fragment of the test sample to form a duplex. The specific amounts used may be determined by one of ordinary skill in the art, in combination with one or more specific samples to be tested, or by pre-experimentation.
In one embodiment, the excess is in excess of 10 10 And copies of the signaling probe.
In one embodiment, the binding of the signaling probe to the target nucleotide fragment of the test sample to form a double strand is performed at a temperature in the range of 50-60 ℃.
In one embodiment, the sufficient amount is an amount of quenching probe that is added in an amount sufficient to form a double strand with all unbound signaling probes. The specific amounts used may be determined by one of ordinary skill in the art in combination with the general knowledge in the art, or by specific samples to be tested, or by pre-experiments.
In one embodiment, the sufficient amount refers to a double amount of signaling probe.
In one embodiment, the adding a sufficient amount of the quenching probe to form a double strand with the unbound signaling probe is performed at a temperature that causes the quenching probe to form a double strand with the unbound signaling probe; the determination of a specific sample to be tested may be determined by a person skilled in the art in combination with the general knowledge in the art.
In one embodiment, the reaction of G quadruplex with heme to form G quadruplex/heme mimic enzyme with catalase activity and the combination of catalase activity to characterize the biomass of lactobacillus microbe means that after heme reaction is added into the system, ABTS and H are added 2 O 2 The catalase activity was then characterized by the absorbance of the reactant.
In one embodiment, the absorbance is at wavelength 420 nm.
In one embodiment, the quantification method specifically comprises:
(1) Carrying out DNA melting treatment on a sample to be detected;
(2) Adding a signal probe, and reacting for 30 min at 55 ℃;
(3) Adding a quenching probe, and reacting for 30 min at 55 ℃;
(4) Adding heme, and reacting at 37 ℃ for 30 min;
(5) Adding 2, 2-azino-bis- (3-ethylbenzodihydrothiazoline-6-sulphonic acid) diammonium salt (ABTS) and H 2 O 2 Reacting at 37 ℃ for 30 min;
(6) Detecting the absorbance of the reactant at wavelength 420 nm;
(7) The Lactobacillus microorganisms in the sample were quantified in combination with absorbance.
In one embodiment, the quantification method further comprises: preparing samples with different known lactobacillus microorganism contents, and measuring absorbance values obtained by processing different samples by the method; drawing a standard curve of absorbance values and the contents of microorganisms of different lactobacillus species; substituting the absorbance value obtained after the sample to be measured is processed by the method into a standard curve to obtain the content of lactobacillus microorganisms in the sample to be measured.
The third object of the invention is to provide a detection kit for absolute quantification of microorganisms of the genus Lactobacillus, comprising the signaling probe of the invention with the sequence shown in SEQ ID NO. 1.
In one embodiment, the detection kit further comprises a quenching probe having the sequence shown in SEQ ID NO. 2.
In one embodiment, the detection kit further comprises any one or more of the following: heme, buffer, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS), H 2 O 2 . These reagents may not be contained, and an operator may prepare the kit separately when using the kit.
In one embodiment, the detection kit may comprise a buffer solution of Tris-HCl, KCl, and NH 4 Cl, naCl, or any one or more thereof. Alternatively, the buffer is Tris-HCl, KCl, ph=7.9.
In one embodiment, the detection kit is an absolute quantification kit of microorganisms of the genus lactobacillus, comprising simultaneously four reagents (reagent 1, reagent 2, reagent 3, reagent 4) and a set of quantitative probes (signaling probes, quenching probes) of microorganisms of the genus lactobacillus; the reagent 1 comprises heme; the reagent 2 comprises buffer (Tris-HCl, KCl, pH=7.9; wherein KCl can be replaced by NH) 4 Cl, naCl); the reagent 3 comprises 2, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS); the reagent 4 comprises H 2 O 2 。
In one embodiment, the reagents or probes in the assay kit may be in a liquid or solid state, and may be routinely adjusted to appropriate concentrations by those skilled in the art when in use.
A fourth object of the invention is to provide a method of using the kit.
In one embodiment, the method of use comprises: adding excessive signal probes into a sample to be detected of DNA melting for reacting for a period of time, so that the signal probes are combined with target fragments in the sample to be detected; then adding a sufficient amount of quenching probe to form double chains with the unbound signaling probe; adding heme, reacting for a period of time, adding ABTS and H 2 O 2 And (3) reacting for a period of time, detecting the absorbance value of the reactant, and quantifying the lactobacillus microorganisms in the sample by combining the absorbance value.
In one embodiment, the method includes adjusting the reagents and probes to a concentration suitable for use.
(1) Carrying out DNA melting treatment on a sample to be detected; (2) adding a signal probe, and reacting for 30 min at 55 ℃; (3) adding a quenching probe, and reacting for 30 min at 55 ℃; (4) adding heme, and reacting for 30 min at 37 ℃; (5) Adding 2, 2-azino-bis- (3-ethylbenzodihydrothiazoline-6-sulphonic acid) diammonium salt (ABTS) and H 2 O 2 Reacting at 37 ℃ for 30 min; (6) detecting absorbance of the reactant at wavelength 420 nm; (7) The Lactobacillus microorganisms in the sample were quantified in combination with absorbance.
It is a fifth object of the present invention to provide the use of said kit for quantification of microorganisms of the genus Lactobacillus.
In one embodiment, the application is in the technical field of fermented foods or in the field of detection of environmental microorganisms such as intestinal tracts, soil, water bodies and the like; optionally, the fermented food is any one or more of the following: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverage, alcoholic beverage, yoghurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd, fermented rice flour food and the like.
In one embodiment, the sample to be tested may be a sample containing a cell, genome, metagenome or the like. Optionally, the sample to be detected is a finished fermented food or a sample obtained from the fermentation process of the fermented food; optionally, the sample to be measured is subjected to pretreatment such as centrifugation and bacterial cell collection, and then subjected to subsequent measurement. Preferably, the cells in the sample are collected and then subjected to DNA melting treatment directly without genome extraction.
The beneficial effects are that:
the invention combines the G quadruplex with the specific sequence to form a signal probe, the signal probe is combined with the target sequence to enable the G quadruplex to be exposed outside the sequence, a sufficient amount of quenching probe and unreacted signal probe are added to form double chains, the structure of the G quadruplex is destroyed, the G quadruplex/heme mimic enzyme is formed by reacting with heme, the catalase activity is shown, and the catalase activity is used for representing the biomass of microorganisms. The quantitative probe for the microorganisms of the lactobacillus can realize the detection of the total amount of all the microorganisms of the lactobacillus; further, a signaling probe was optimized with a sequence of GGGTGGGTGGGTGGGTGGGTTAACAAGGTAGCCGTAG (SEQ ID NO. 1) and a quenching probe with a sequence of CTACGGCTACCTTGTTAACCCA (SEQ ID NO. 2). Compared with the signal sequence of SEQ ID NO.3, the G quadruplex sequence in the signal probe of SEQ ID NO.1 does not generate additional space structure with the specific sequence (figure 1), and the detection accuracy is higher and the minimum detection limit is improved.
The probe of the invention is used for detecting and quantifying lactobacillus microorganisms without expensive instrument detection flow. The absolute quantifying kit for the microorganisms is also provided for the first time, and can complete quantifying work within 2.5 h. The invention realizes microorganism quantification by combining a signal probe and a quenching probe in order to avoid using high-volume equipment such as a PCR instrument. The invention solves the problem that the existing microorganism quantitative means depend on expensive instruments and are very limited in the practical application process.
Furthermore, the invention can realize rapid lactobacillus microorganism detection, the sample does not need to be subjected to nucleic acid extraction, and only the microorganisms in the sample need to be eluted in the buffer solution to directly carry out subsequent experiments. Meanwhile, compared with the quantitative result of fluorescent quantitative PCR, the quantitative result obtained by the method has no significant difference.
In conclusion, the probe and the detection kit provided by the invention are used for quantifying the microorganisms of the genus lactobacillus, and have the characteristics of rapidness, cheapness and accuracy.
Drawings
Fig. 1: signal probe dimer structure. (A) The G quadruplex sequence of SEQ ID NO.1 is not self-loop with the specific sequence; (B) SEQ ID NO.3 has been reported to self-loop G quadruplex sequences with specific sequences for microbial quantification.
Fig. 2: and (5) specificity verification of lactobacillus probes.
Fig. 3: based on a standard curve of genome-extracted Lactobacillus microbial probes. (A) To be used forLactobacillus buchneriThe genome is a gradient dilution standard; (B) To be used forLactobacillus plantarumGenome is a gradient dilution standard
Fig. 4: based on standard curves of lactobacillus microbial probes that do not extract the sample genome. (A) To be used forLactobacillus buchneriThe genome is a gradient dilution standard; (B) To be used forLactobacillus plantarumGenome is a gradient dilution standard
Fig. 5: qPCR standard curve.
Fig. 6: comparing the quantitative experiments of the lactobacillus microorganism probes based on genome extraction, the quantitative experiments of the lactobacillus microorganism probes based on no sample genome extraction and the quantitative experiments of the qPCR lactobacillus microorganism; wherein, (A) a quantitative test based on a genome-extracted Lactobacillus microorganism probe, (B) a quantitative test based on a Lactobacillus microorganism probe not extracting a sample genome, and (C) a quantitative test based on a qPCR Lactobacillus microorganism probe.
Fig. 7: the stability of the detection results of the probe (A) based on SEQ ID NO.1/SEQ ID NO.2 and the probe (B) based on SEQ ID NO.3/SEQ ID NO.4 were compared.
The specific embodiment is as follows:
example 1: quantitative probe combination reagent for lactobacillus microorganism
A probe combination reagent; containing separately packaged signaling probe reagents and quenching probe reagents; wherein the sequence of the signal probe is shown as SEQ ID NO.1, and the sequence of the quenching probe is shown as SEQ ID NO.2.
The signal probe reagent and the quenching probe reagent are dry powder or liquid; in the case of dry powders, the solution may be diluted to a suitable concentration prior to the experiment, for example, 20. Mu.M using sterile water or buffer; in the case of liquid form, the concentration may be 20 to 200. Mu.M, and the reagent may be diluted before use or used directly.
Example 2: lactobacillus microorganism quantitative kit and use thereof
A lactobacillus microorganism quantification kit comprising a signal probe reagent and a quenching probe reagent which are independently packaged; wherein, the sequence of the signal probe is shown as SEQ ID NO.1, and the sequence of the quenching probe is shown as SEQ ID NO.2.
The kit can be used together with heme, buffer solution, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS), H 2 O 2 Is matched with the components.
The using method is as follows:
(1) And (5) solution preparation. Preparing a heme solution (reagent 1) of 100 nM; preparing Tris-HCl with final concentration of 50 mM, KCl with final concentration of 50 mM and final pH of 7.9 (reagent 2); 7 mM 2, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS) (reagent 3) and 7 mM H 2 O 2 Solution (reagent 4); the solvents were all sterile water.
(2) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL, 4. Mu.L of the sample genomic DNA was added, and the mixture was treated in a water bath at 90℃for 10 minutes. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(3) The quenching probe forms a double strand with the unbound signaling probe. The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (2), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(4) Forming heme/G quadruplex structure. Reagent 1 with the final concentration of 100 nM is added into the system after the reaction in the step (3), and the reaction is treated for 30 min at 37 ℃.
(5) And (5) color reaction. To the system in which the reaction of (4) was completed, a reagent (ABTS) having a final concentration of 7 mM and a reagent 4 having a final concentration of 7 mM were added, and the mixture was treated at 37℃for 30 minutes to carry out a reaction (green).
Detecting the absorbance of the reactant at wavelength 420 nm; the Lactobacillus microorganisms in the sample were quantified in combination with absorbance.
Naturally, when absolute quantification is performed, a standard curve of absorbance and the biomass of the microorganism of the genus lactobacillus can be drawn by itself, or the biomass of the microorganism of the genus lactobacillus can be directly converted according to the recommended use method of the kit and the standard curve.
Example 3: lactobacillus microorganism quantitative kit
A lactobacillus microorganism quantification kit comprising a signal probe reagent and a quenching probe reagent which are independently packaged; wherein the sequence of the signal probe is shown as SEQ ID NO.1, and the sequence of the quenching probe is shown as SEQ ID NO. 2.
The kit also contains 100 nM heme solution (reagent 1), tris-HCL buffer solution, 7 mM 2, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS), 7 mM H 2 O 2 A solution.
Example 4: specificity of the Lactobacillus microorganism quantification kit
(1) 15 microorganisms of Lactobacillus widely present in the fermented food sample were selected as positive controls, respectivelyLactobacillus buchneri,Lactobacillus dioilvorans,Lactobacillus brevis,Lactobacillus crustorum,Lactobacillus plantarum,Lactobacillus harbinensis,Lactobacillus acidiliscis,Lactobacillus murinus,Lactobacillus curvatus,Lactobacillus casei,Lactobacillus reuteri,Lactobacillus panis,Lactobacillus fermentum,Lactobacillus johnsonii,Lactobacillus delbrueckii. Selection of 21 widely present samples of fermented foodAs negative controls, non-lactobacillus bacterial microorganisms and 7 fungal microorganisms, 21 non-lactobacillus bacterial microorganisms includingPediococcus ethanolidurans,Pediococcus acidilactici,Pediococcus pentosaceus,Weissella confusa,Weissella paramesenteroides,Weissella viridescens,Leuconostoc citreum,Leuconostoc lactis,Leuconostoc mesenteroides,Leuconostoc pseudomesenteroides,Enterococcus italicus,Enterococcus lactis,Enterococcus faecalis,Bacillus coagulans,Bacillus licheniformis,Bacillus tequilensis,Bacillus subtilis,Bacillus velezensis,Acetobacter pasteurianus,Enterococcus faecium,Lactococcus lactis.7 fungal species includeAspergillus tubingensis，Mucor rouxianus，Schizosaccharomyces pombe，Zygosaccharomyces bailii，Pichia kudriavzevii，Saccharomycopsis fibuligera，Saccharomyces cerevisiae。
(2) The above microorganisms are cultured in different culture media, whereinLactobacillus buchneri,Lactobacillus dioilvorans,Lactobacillus brevis,Lactobacillus crustorum,Lactobacillus plantarum,Lactobacillus harbinensis,Lactobacillus acidiliscis,Pediococcus ethanolidurans,Pediococcus acidilactici,Pediococcus pentosaceus,Lactobacillus murinus,Lactobacillus curvatus,Lactobacillus casei,Lactobacillus reuteri,Lactobacillus panis,Lactobacillus fermentum,Lactobacillus johnsonii,Lactobacillus delbrueckii,Lactococcus lactis,Weissella confusa,Weissella paramesenteroides,Weissella viridescens,Leuconostoc citreum,Leuconostoc lactis,Leuconostoc mesenteroides,Leuconostoc pseudomesenteroidesUsing MRS culture medium, wherein the formula of the culture medium is tryptone 10.0 g/L, beef extract 8.0 g/L, yeast extract 4.0 g/L, glucose 18.0 g/L, and anhydrous sorbitolOleic acid ester 0.8 mL/L, K 2 HPO 4 2.5 g/L, sodium acetate trihydrate 6.0 g/L, triammonium citrate 2.0 g/L, mgSO 4 ·7H 2 O 0.3 g/L，MnSO 4 ·4H 2 O0.08 g/L. The culture conditions were 48 and h at 30 ℃.Enterococcus italicus,Enterococcus lactis,Enterococcus faecalis,Bacillus coagulans,Bacillus licheniformis,Bacillus tequilensis,Bacillus subtilis,Bacillus velezensis,Acetobacter pasteurianus,Enterococcus faecium，Escherichia coliLB culture medium is used, and the formula of the culture medium is peptone 10.0 g/L, yeast powder 5 g/L and sodium chloride 10 g/L. The culture conditions were 24℃and h.Aspergillus tubingensis，Mucor rouxianus，Schizosaccharomyces pombe，Zygosaccharomyces bailii，Pichia kudriavzevii，Saccharomycopsis fibuligera，Saccharomyces cerevisiaeYPD medium was used in the formulation of yeast extract 10 g/L, peptone 20 g/L, glucose 20 g/L. The culture conditions are as follows: the mold is cultured at 30 ℃ for 5 days, and the yeast is cultured at 30 ℃ for 2 days.
(3) Extracting genome DNA of the microorganism pure culture. The bacterial liquid was treated at 12000 rpm for 2 min, and the precipitate was collected. The genome of the 43 pure cultures of microorganisms was extracted using the gene extraction kit DNeasy Tissue Kit.
(4) The probe was selected as Lactobacillus probe, the sequence of the signaling probe was GGGTGGGTGGGTGGGTGGGTTAACAAGGTAGCCGTAG (SEQ ID NO. 1), and the sequence of the quenching probe was CTACGGCTACCTTGTTAACCCA (SEQ ID NO. 2).
(4) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9), 4. Mu.L of genomic DNA of different microorganisms was added, respectively, and the mixture was treated in a water bath at 90℃for 10 minutes. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(5) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (4), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(6) Forming heme/G quadruplex structure. Reagent 1 (heme) with a final concentration of 100 nM was added to the system after the reaction in the step (5), and the reaction was carried out at 37℃for 30 minutes.
(7) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction of (6) 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. As shown in FIG. 2, the test group added with the Lactobacillus genome DNA showed a color development reaction, and the test group added with the non-Lactobacillus genome DNA and the blank control group showed no color development reaction, thus proving the specificity of the detection of Lactobacillus microorganisms in the kit.
Example 5: quantitative method accuracy assessment
1. For a pair ofLactobacillus buchneriQuantitative accuracy of (2)
（1）Lactobacillus buchneriBacterial solutions were obtained according to the culture method in example 4, and microbial concentrations were measured by plate count method, and genome extraction was the same as in example 4.
(2) Dilution by 10-fold gradientLactobacillus buchneriGenomic DNA.
(3) Using probes of the genus Lactobacillus at different concentrations Lactobacillus buchneriGenomic DNA was subjected to a chromogenic reaction. The sequence of the signaling probe was GGGTGGGTGGGTGGGTGGGTTAACAAGGTAGCCGTAG (SEQ ID NO. 1) and the sequence of the quenching probe was CTACGGCTACCTTGTTAACCCA (SEQ ID NO. 2).
(4) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, final pH of 7.9) was added 4. Mu.L of different dilutions of genomic DNA (no sample DNA added as a blank). Treating in water bath at 90deg.C for 10 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(5) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (4), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(6) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction in step (5) to a final concentration of 100 nM, and the reaction was carried out at 37℃for 30 minutes.
(7) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction of (6) 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420 and nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank.
(8) Constructing a standard curve by calculating the linear relation between the absorbance and the concentration of the bacterial liquid, as shown in figure 3A, R 2 =0.99 (x is log 10 CFU/mL, y is OD 420 A linear range of 10 3 ~10 7 ). The accuracy of the quantitative method of the kit provided by the invention is proved.
2. For a pair ofLactobacillus plantarumQuantitative accuracy of (2)
（1）Lactobacillus plantarumBacterial solutions were obtained according to the culture method in example 4, and the concentration of Lactobacillus was measured by plate count method, and genome was extracted as in example 4.
(2) Dilution by 10-fold gradientLactobacillus plantarumGenomic DNA.
(3) Using probes of the genus Lactobacillus at different concentrationsLactobacillus plantarumGenomic DNA was subjected to a chromogenic reaction. The sequence of the signaling probe was GGGTGGGTGGGTGGGTGGGTTAACAAGGTAGCCGTAG (SEQ ID NO. 1) and the sequence of the quenching probe was CTACGGCTACCTTGTTAACCCA (SEQ ID NO. 2).
(4) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, final pH of 7.9) was added 4. Mu.L of different dilutions of genomic DNA (no sample DNA added as a blank). Treating in water bath at 90deg.C for 10 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(5) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (4), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(6) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction in step (5) to a final concentration of 100 nM, and the reaction was carried out at 37℃for 30 minutes.
(7) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction of (6) 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420 and nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank.
(8) Constructing a standard curve by calculating the linear relation between the absorbance and the bacterial liquid concentration, as shown in figure 3B, R 2 =0.99 (x is log 10 (CFU/mL), y is the OD 420 A linear range of 10 3 ~10 7 ). The accuracy of the quantitative method of the kit provided by the invention is proved.
Example 6: quantitative experiment of Lactobacillus in Yoghurt sample
(1) Reference is made to Achilleos C, berthier F. Quantitative PCR for the specific quantification ofLactococcus lactisandLactobacillus paracaseiand its interest forLactococcus lactisThe genome from a commercially available yoghurt sample was extracted by the method of section 2.6 of in cheese samples, food Microbiology 2013;36:286-295. The genomic concentration was 205.89 ng/. Mu.L.
(2) The color reaction was performed using a probe of Lactobacillus. The sequence of the signaling probe was GGGTGGGTGGGTGGGTGGGTTAACAAGGTAGCCGTAG (SEQ ID NO. 1) and the sequence of the quenching probe was CTACGGCTACCTTGTTAACCCA (SEQ ID NO. 2).
(4) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, final pH of 7.9) was added 4. Mu.L of yogurt metagenomic DNA (no sample DNA was added as a blank). Treating in water bath at 90deg.C for 10 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(5) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (4), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(6) Forming heme/G quadruplex structure. Reagent 1 (heme) with a final concentration of 100 nM was added to the system after the reaction in the step (5), and the reaction was carried out at 37℃for 30 minutes.
(7) And (5) color reaction. Adding reagent 3 (ABTS) having a final concentration of 7 mM and reagent 4 (7 mM H) having a final concentration of 7 mM to the system at the end of the reaction of (6) 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420. 420 nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0.65 using the experimental group without the sample DNA as a blank.
(8) Based on the standard curve obtained in example 5 (one), the total amount of microorganisms of the genus Lactobacillus in the sample was calculated to be 5.81 log 10 CFU/mL, calculated from the standard curve obtained in example 5 (II), the total amount of Lactobacillus microorganisms in the sample was 6.08 log 10 CFU/mL。
(9) The same yogurt sample was quantified for Lactobacillus by fluorescence quantification (quantification procedure and material same as in example 13 (6)), and the result showed that the total amount of microorganisms of Lactobacillus was 6.06 log 10 CFU/mL was substantially identical to the two sets of data measured by the method described above (coefficient of variation, cv=0.019).
Example 7: absolute quantification of Lactobacillus microorganisms in fermented grain samples
(1) Referring to the method in MATERIALS AND METHODS of Song Z W, du H, zhang Y, xu Y Unraveling core functional microbiota in traditional solid-state fermentation by high-throughput amplicons and metatranscriptomics sequencing Frontiers in microbiology 2017;8:1294, metagenome from fermented grain samples of Jingzhizhen, shandong province was extracted at a genome concentration of 632.50 ng/. Mu.L.
(2) The color reaction was performed using a probe of Lactobacillus. The sequence of the signaling probe was GGGTGGGTGGGTGGGTGGGTTAACAAGGTAGCCGTAG (SEQ ID NO. 1) and the sequence of the quenching probe was CTACGGCTACCTTGTTAACCCA (SEQ ID NO. 2).
(3) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, final pH of 7.9) was added 4. Mu.L of fermented grain metagenomic DNA (no sample DNA added as a blank). Treating in water bath at 90deg.C for 10 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(4) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (3), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(5) Forming heme/G quadruplex structure. Reagent 1 (heme) with a final concentration of 100 nM was added to the system after the reaction in the step (4), and the reaction was carried out at 37℃for 30 minutes.
(6) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction of (5) 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420. 420 nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0.62 using the experimental group without the sample DNA as a blank.
(7) Based on the standard curve obtained in example 5 (one), the total amount of Lactobacillus microorganisms in the sample was calculated to be 5.53 log 10 CFU/mL, calculated from the standard curve obtained in example 5 (II), the total amount of Lactobacillus microorganisms in the sample was 5.78 log 10 CFU/mL。
(8) The same fermented grain sample was quantified for Lactobacillus by fluorescence quantification (quantification step and material same as in example 13 (6)), and the result showed that the total amount of Lactobacillus microorganisms was 5.62 log 10 CFU/mL, substantially identical to the two sets of data measured by the method described above (coefficient of variation, cv=0.016).
Example 8: absolute quantification of Lactobacillus microorganisms in cheese samples
(1) Reference is made to Achilleos C, berthier F. Quantitative PCR for the specific quantification ofLactococcus lactisandLactobacillus paracaseiand its interest forLactococcus lactisMetagenome from commercially available cheese samples was extracted by the method of section 2.6 of in cheese samples, food Microbiology 2013;36:286-295. Metagenomic concentration was 20.18 ng/. Mu.L.
(2) The color reaction was performed using a probe of Lactobacillus. The sequence of the signaling probe was GGGTGGGTGGGTGGGTGGGTTAACAAGGTAGCCGTAG (SEQ ID NO. 1) and the sequence of the quenching probe was CTACGGCTACCTTGTTAACCCA (SEQ ID NO. 2).
(3) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, final pH of 7.9) was added 4. Mu.L of cheese metagenomic DNA (no sample DNA added as a blank). Treating in water bath at 90deg.C for 10 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(4) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (3), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(5) Forming heme/G quadruplex structure. Reagent 1 (heme) with a final concentration of 100 nM was added to the system after the reaction in the step (4), and the reaction was carried out at 37℃for 30 minutes.
(6) And (5) color reaction. Adding reagent 3 (ABTS) with a final concentration of 7 mM and reagent 4 (7 mM H) with a final concentration of 7 mM to the system at the end of the reaction of (5) 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420. 420 nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0.45 using the experimental group without the sample DNA as a blank.
(7) Based on the standard curve obtained in example 5 (one), the total amount of Lactobacillus microorganisms in the sample was calculated to be 3.93 log 10 CFU/mL, calculated from the standard curve obtained in example 5 (II), the total amount of Lactobacillus microorganisms in the sample was 4.13 log 10 CFU/mL。
(8) The above-mentioned method was carried out by fluorescence quantitative method (quantitative procedure and materials are the same as in example 13 (6))Quantification of Lactobacillus in a cheese sample showed a total of 4.02 log of Lactobacillus microorganisms 10 CFU/mL, substantially identical to the two sets of data determined by the method described above (coefficient of variation, cv=0.018).
Example 9: absolute quantification method of lactobacillus microorganism based on non-extracted sample genome
1. For a pair ofLactobacillus buchneriQuantitative accuracy of (2)
（1）Lactobacillus buchneriBacterial liquids were obtained according to the culture method in example 4, and microbial concentrations were determined by plate counting.
(2) Dilution by 10-fold gradient in (1)Lactobacillus buchneriBacterial liquid
(3) The chromogenic reaction was carried out using probes of the lactobacillus domain. The sequence of the signaling probe was GGGTGGGTGGGTGGGTGGGTTAACAAGGTAGCCGTAG (SEQ ID NO. 1) and the sequence of the quenching probe was CTACGGCTACCTTGTTAACCCA (SEQ ID NO. 2).
(4) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9) was added 10. Mu.L of different dilutions of bacterial solution (no sample bacterial solution was added as a blank). Treating in boiling water bath for 20 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(5) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (4), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(6) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction in step (5) to a final concentration of 100 nM, and the reaction was carried out at 37℃for 30 minutes.
(7) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction of (6) 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420 and nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank.
(8) Constructing a standard curve by calculating the linear relation between the absorbance and the concentration of the bacterial liquid, as shown in FIG. 4A, R 2 =0.99 (x is log10 CFU/mL, y is OD 420 A linear range of 10 3 ~10 7 ). Proved by the accuracy of the quantitative method of the kit
2. For a pair ofLactobacillus plantarumQuantitative accuracy of (2)
（1）Lactobacillus plantarumBacterial liquids were obtained according to the culture method in example 4, and microbial concentrations were determined by plate counting.
(2) Dilution by 10-fold gradient in (1)Lactobacillus plantarumBacterial liquid
(3) The color reaction was performed using a probe of Lactobacillus. The sequence of the signaling probe was GGGTGGGTGGGTGGGTGGGTTAACAAGGTAGCCGTAG (SEQ ID NO. 1) and the sequence of the quenching probe was CTACGGCTACCTTGTTAACCCA (SEQ ID NO. 2).
(4) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9) was added 10. Mu.L of different dilutions of bacterial solution (no sample bacterial solution was added as a blank). Treating in boiling water bath for 20 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(5) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (4), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(6) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction in step (5) to a final concentration of 100 nM, and the reaction was carried out at 37℃for 30 minutes.
(7) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction of (6) 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420 and nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank.
(8) Constructing a standard curve by calculating the linear relation between the absorbance and the concentration of the bacterial liquid, as shown in FIG. 4B, R 2 =0.99 (x is log10 CFU/mL, y is OD 420 A linear range of 10 3 ~10 7 ). The accuracy of the quantitative method of the kit provided by the invention is proved.
Example 10: method for determining content of lactobacillus microorganisms in yoghurt sample based on absolute quantification method of lactobacillus microorganisms without extracting sample genome
(1) The sample is yoghurt purchased in a local supermarket, and the sample treatment method comprises the following steps: 1 mL sample was added with 5 mL phosphate buffer, 3000×gAnd (5) centrifuging for 10 min to collect the thalli.
(2) And (5) washing. To the cells obtained in (1), 5 mL phosphate buffer was added, and the cells were collected by centrifugation at 12000 Xg for 2 minutes and repeated.
(3) The cells were resuspended, and 1 mL reagent 2 (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9) was added to the cells obtained in (2), followed by air-aspiration and mixing.
(4) The color reaction was performed using a probe of Lactobacillus. The sequence of the signaling probe was GGGTGGGTGGGTGGGTGGGTTAACAAGGTAGCCGTAG (SEQ ID NO. 1) and the sequence of the quenching probe was CTACGGCTACCTTGTTAACCCA (SEQ ID NO. 2).
(5) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9) was added 10. Mu.L of yogurt bacteria (no sample bacteria was added as a blank). Treating in boiling water bath for 20 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(6) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (5), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(7) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction in step (6) to a final concentration of 100 nM, and the reaction was carried out at 37℃for 30 minutes.
(8) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction of (7) 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420. 420 nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0.66 using the experimental group without the sample DNA as a blank.
(9) Based on the standard curve obtained in example 9 (one), the total amount of Lactobacillus in the sample was calculated to be 6.05 log 10 CFU/mL, calculated from the standard curve obtained in example 9 (II), the total amount of Lactobacillus in the sample was 6.26 log 10 CFU/mL。
(10) The same yogurt sample was quantified for Lactobacillus by fluorescence quantification (quantification procedure and material same as in example 13 (6)), and the total amount of Lactobacillus was 6.12 log 10 CFU/mL was substantially identical to the two sets of data measured by the method described above (coefficient of variation, cv=0.013).
Example 11: method for determining content of lactobacillus microorganisms in fermented grain samples based on absolute quantification method of lactobacillus microorganisms without extracting sample genome
(1) The sample is derived from fermented grains of certain winery in Shandong Jing Zhizhen, and the sample treatment method is as follows: 5 mL phosphate buffer was added to the 1 g sample, and the cells were collected by centrifugation at 3000 Xg for 10 min.
(2) And (5) washing. To the cells obtained in (1), 5 mL phosphate buffer was added, and the cells were collected by centrifugation at 12000 Xg for 2 minutes and repeated.
(3) The cells were resuspended, and 1 mL reagent 2 (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9) was added to the cells obtained in (2), followed by air-aspiration and mixing.
(4) The color reaction was performed using a probe of Lactobacillus. The sequence of the signaling probe was GGGTGGGTGGGTGGGTGGGTTAACAAGGTAGCCGTAG (SEQ ID NO. 1) and the sequence of the quenching probe was CTACGGCTACCTTGTTAACCCA (SEQ ID NO. 2).
(5) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9), 10. Mu.L of fermented grain broth (no sample broth added as a blank) was added. Treating in boiling water bath for 20 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(6) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (5), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(7) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction in step (6) to a final concentration of 100 nM, and the reaction was carried out at 37℃for 30 minutes.
(8) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction of (7) 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420. 420 nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0.61 using the experimental group without the sample DNA as a blank.
(9) Based on the standard curve obtained in example 9 (one), the total amount of Lactobacillus in the sample was calculated to be 5.57 log 10 CFU/mL, calculated from the standard curve obtained in example 9 (II), the total amount of Lactobacillus in the sample was 5.77 log 10 CFU/mL。
(10) The total amount of lactobacillus was 5.86 log as shown by the quantification of lactobacillus in the same fermented grain sample by the fluorescent quantitation method (quantitation step and material same as in example 13 (6)) 10 CFU/mL was substantially identical to the two sets of data measured by the method described above (coefficient of variation, cv=0.019).
Example 12: method for determining content of lactobacillus microorganisms in cheese sample based on absolute quantification method of lactobacillus microorganisms without extracting sample genome
(1) The sample is cheese purchased in a local supermarket, and the sample treatment method is as follows: 5 mL phosphate buffer was added to the 1 g sample, and the cells were collected by centrifugation at 3000 Xg for 10 min.
(2) And (5) washing. To the cells obtained in (1), 5 mL phosphate buffer was added, and the cells were collected by centrifugation at 12000 Xg for 2 minutes and repeated.
(3) The cells were resuspended, and 1 mL reagent 2 (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9) was added to the cells obtained in (2), followed by air-aspiration and mixing.
(4) The color reaction was performed using a probe of Lactobacillus. The sequence of the signaling probe was GGGTGGGTGGGTGGGTGGGTTAACAAGGTAGCCGTAG (SEQ ID NO. 1) and the sequence of the quenching probe was CTACGGCTACCTTGTTAACCCA (SEQ ID NO. 2).
(5) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9) was added 10. Mu.L of cheese bacteria solution (blank control without sample bacteria solution). Treating in boiling water bath for 20 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(6) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (5), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(7) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction in step (6) to a final concentration of 100 nM, and the reaction was carried out at 37℃for 30 minutes.
(8) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction of (7) 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420. 420 nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0.44 using the experimental group without the sample DNA as a blank.
(9) The total amount of microorganisms of the genus Lactobacillus in the sample was calculated to be 3.95 log based on the standard curve obtained in example 9 (one) 10 CFU/mL, calculated from the standard curve obtained in example 9 (II), the total amount of Lactobacillus microorganisms in the sample was 4.12 log 10 CFU/mL。
(10) By fluorescence quantification (quantification step andthe same materials as in example 13 (6)) were used to quantify Lactobacillus in the same cheese sample, and the results showed that the total amount of Lactobacillus was 4.02 log 10 CFU/mL, substantially identical to the two sets of data measured by the method described above (coefficient of variation, cv=0.015).
Example 13: comparison of microorganism quantitative detection kit and fluorescent quantitative PCR detection result
(1) The samples are three white spirit fermented grain samples from the fermentation end point of a certain winery of Shandong Jing Zhi.
(2) Sample processing:
(i) Total genomes in three samples were extracted at genome concentrations of 369 ng/. Mu.L, 590 ng/. Mu.L, 321.89 ng/. Mu.L, respectively.
(ii) 5 mL phosphate buffer was added to the 1 g sample, and the cells were collected by centrifugation at 3000 Xg for 10 min. To the obtained cells, 5 mL phosphate buffer was added, and the cells were collected by centrifugation at 12000 Xg for 2 min and repeated. The cells were resuspended, and 1 mL reagent 2 buffer was added to the obtained cells, followed by air-aspiration and mixing.
(3) The color reaction was performed using a probe of Lactobacillus. The sequence of the signaling probe was GGGTGGGTGGGTGGGTGGGTTAACAAGGTAGCCGTAG (SEQ ID NO. 1) and the sequence of the quenching probe was CTACGGCTACCTTGTTAACCCA (SEQ ID NO. 2).
(4) Assay based on kit quantification method without genome extraction.
(i) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, and final pH of 7.9), 10. Mu.L of fermented grain broth (no sample broth added as a blank) was added. Treating in boiling water bath for 20 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(ii) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (i), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(iii) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction in step (ii) to a final concentration of 100 mM, and the reaction was carried out at 37℃for 30 minutes.
(iv) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction (iii) 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420 nm was measured using an ultraviolet spectrophotometer and the experimental group without sample DNA was used as a blank, showing that the absorbance was 0.716,0.753,0.73.
(v) Based on the standard curve obtained in example 9 (one), the total amount of Lactobacillus microorganisms in the sample was calculated to be 6.74.+ -. 0.178 log 10 CFU/mL。
(5) Kit quantitative method determination based on genome extraction
(i) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, final pH of 7.9) was added 4. Mu.L of fermented grain metagenomic DNA (no sample DNA added as a blank). Treating in water bath at 90deg.C for 10 min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30 min.
(ii) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (i), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(iii) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction in step (ii) to a final concentration of 100 nM, and the mixture was treated at 37℃for 30 minutes.
(iv) And (5) color reaction. Adding reagent 3 (ABTS) with final concentration of 7 mM and reagent 4 (H) with final concentration of 7 mM to the system with the end of the reaction (iii) 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420 nm was measured using an ultraviolet spectrophotometer and the experimental group without sample DNA was used as a blank, showing that the absorbance was 0.73,0.742,0.726.
(v) Based on the standard curve obtained in example 5 (one), the total amount of Lactobacillus microorganisms in the sample was calculated to be 6.60.+ -. 0.079 log 10 CFU/mL。
(6) qPCR quantitative sample for content of Lactobacillus microorganism
（i）Lactobacillus buchneriBacterial solutions were obtained according to the culture method in example 4, and microbial concentrations were measured by plate count method, and genome extraction was the same as in example 4.
(ii) Dilution by 10-fold gradientLactobacillus buchneriGenomic DNA.
(iii) The qPCR system was SYBR Green 10. Mu.L, upstream and downstream primers 20. Mu.M, template DNA 0.5. Mu.L, and sterile water supplemented 20. Mu.L.
(iv) Reaction procedure for qPCR: pre-denaturation at 95 ℃ for 5 min, cycle phase: 95. c5 s,60 ℃ 20 s; the cycle number 40, the dissolution profile increased from 65 ℃ to 95 ℃, 0.5 ℃ per 5 s.
(v) qPCR was performed on the extracted genome using Lactobacillus specific primers with an upstream sequence of CGTAACAAGGTAGCCGTAGG (SEQ ID NO. 5) and a downstream sequence of GTYVCGTCCTTCWTCGSC (SEQ ID NO. 6).
(vi) Establishment by 10-fold gradient dilution of genomic DNACTValue and value ofLactobacillus buchneriAs shown in FIG. 5, the standard curve of the fungus concentration, R 2 =0.99。
(vii) qPCR system and reaction conditions are the same as (iii), (iv). Based on the CT value of the end of the reaction, the concentration of Lactobacillus microorganisms in the sample was calculated to be 6.60.+ -. 0.08 Lg (CFU/g) by the established standard curve.
(7) The result is shown in figure 6, and the three quantitative methods have no significant differenceP<0.05）
Example 14: detection limit for detection by using two different sequence signal probes
（1）Lactobacillus buchneriThe bacterial liquid was obtained according to the culture method in example 4, and the Lactobacillus concentration was determined by plate counting and found to be 7.45 log 10 Extraction of CFU/mL genome was the same as in example 4.
(2) Dilution by 10-fold gradient Lactobacillus buchneriGenomic DNA, 2.45 log was obtained 10 CFU/mL DNA template.
(3) The sequence of the signal probe of lactobacillus provided by the invention is GGGTGGGTGGGTGGGTGGGTTAACAAGGTAGCCGTAG (SEQ ID NO. 1), and the sequence of the quenching probe is CTACGGCTACCTTGTTAACCCA (SEQ ID NO. 2). 2.45 log of the product obtained in (2) was added 10 CFU/mLLactobacillus buchneriGenomic DNA was subjected to a chromogenic reaction
(4) The sequence of the quenching probe was CTACGGCTACCTTGTTACCCAA (SEQ ID NO. 4) using Lactobacillus signaling probe sequence GGGATTGGGATTGGGATTGGGTAACAAGGTAGCCGTAG (SEQ ID NO. 3). 2.45 log of the product obtained in (2) was added 10 CFU/mLLactobacillus buchneriGenomic DNA was subjected to a chromogenic reaction.
(5) The signaling probe forms a double strand with the sample DNA. To reagent 2 of 2 mL (including Tris-HCl at a final concentration of 50 mM, KCl at a final concentration of 50 mM, final pH 7.9) was added 4. Mu.LLactobacillus buchneriGenomic DNA (blank control without sample DNA). Treating in water bath at 90deg.C for 10 min. After adding 4. Mu.L of 20. Mu.M of different signaling probes, respectively, the reaction was carried out at 55℃for 30 min.
(6) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (5), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(7) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction in step (6) to a final concentration of 100 nM, and the reaction was carried out at 37℃for 30 minutes.
(8) And (5) color reaction. To the system in which the reaction of (7) was completed, reagent 3 (ABTS) having a final concentration of 7 mM and reagent 4 (H) having a final concentration of 7 mM were added, respectively 2 O 2 ) The treatment is carried out at 37 ℃ for 30 min. The absorbance at wavelength 420 and nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank.
(9) The steps (5), (6), (7) and (8) were repeated 9 times, and the stability of the detection results was compared as shown in fig. 7. The Coefficient of Variation (CV) of the quantitative result of the signal sequence based on SEQ ID NO.3 was 58.6%; the variation coefficient of the quantitative result based on the signal sequence of SEQ ID NO.1 is 5.42%, and the detection effect is stable.
While the invention has been described with reference to the preferred embodiments, it is not limited thereto, and various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
SEQUENCE LISTING
<110> university of Jiangnan
<120> an absolute quantitative probe of Lactobacillus, method, kit and use thereof
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 37
<212> DNA
<213> Synthesis
<400> 1
gggtgggtgg gtgggtgggt taacaaggta gccgtag 37
<210> 2
<211> 22
<212> DNA
<213> Synthesis
<400> 2
ctacggctac cttgttaacc ca 22
<210> 3
<211> 38
<212> DNA
<213> Synthesis
<400> 3
gggattggga ttgggattgg gtaacaaggt agccgtag 38
<210> 4
<211> 22
<212> DNA
<213> Synthesis
<400> 4
ctacggctac cttgttaccc aa 22
<210> 5
<211> 20
<212> DNA
<213> Synthesis
<400> 5
cgtaacaagg tagccgtagg 20
<210> 6
<211> 18
<212> DNA
<213> Synthesis
<400> 6
gtyvcgtcct tcwtcgsc 18

Claims (13)

1. A set of probes, comprising a signaling probe and a quenching probe; the sequence of the signal probe is shown as SEQ ID NO. 1; the sequence of the quenching probe is shown as SEQ ID NO. 2.
2. A detection kit comprising the signaling probe and the quenching probe according to claim 1.
3. The test kit of claim 2, further comprising any one or more of the following: heme, buffer, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt, H 2 O 2 。
4. A method for quantifying a microorganism belonging to the genus lactobacillus, characterized in that the method uses the probe according to claim 1 or the detection kit according to any one of claims 2 to 3.
5. The method of quantification of claim 4, wherein the method comprises: melting DNA in the sample to be detected; adding excessive signal probes, and combining with target nucleotide fragments of a sample to be detected to form double chains, so that G quadruplex naked leakage is outside the sequence; adding enough quenching probes and unbound signaling probes to form double chains so as to destroy the G quadruplex structure; the naked leakage is utilized to react with heme to form G quadruplex/heme mimic enzyme with catalase activity, and the activity of the mimic enzyme is combined to characterize the biomass of lactobacillus microorganisms.
6. The method of quantification of claim 4, wherein the method is absolute quantification or relative quantification.
7. The method of quantification according to claim 6, wherein when the method is absolute quantification, further comprising: establishing a standard curve of the catalase activity or an index related to the catalase activity and biomass of the lactobacillus microorganism; when the sample to be detected is detected, substituting the detected catalase activity or an index which is related to the catalase activity into a standard curve to obtain the biomass of the lactobacillus microorganism in the sample to be detected.
8. The method according to claim 5 or 7, wherein the sample to be measured is a sample containing a cell or a genome.
9. The method according to claim 5 or 7, wherein the sample to be measured is a sample containing a metagenome.
10. The method according to claim 5 or 7, wherein the sample is a fermented food or a sample obtained during fermentation of a fermented food or an intestinal, soil, water environment sample.
11. The method of claim 10, wherein the fermented food is any one or more of the following: soy sauce, table vinegar, cheese, fermented soya beans, fermented bean curd, traditional fermented vegetables, fermented beverages, and fermented rice and flour food.
12. A method of using the kit of any one of claims 2-3, comprising: adding excessive signal probe into the sample to be tested with DNA melting to react for a period of time to enable the signal probe to react with the target in the sample to be testedBinding of target fragments; then adding enough quenching probes to form double chains with unbound signaling probes; adding heme, reacting for a period of time, adding ABTS and H 2 O 2 And (3) reacting for a period of time, detecting the absorbance value of the reactant, and quantifying the lactobacillus microorganisms in the sample by combining the absorbance value.
13. A method for detecting the content of microorganisms of the genus lactobacillus in a fermented food product, intestinal tract, soil or water body, comprising using the probe of claim 1, or the kit of any of claims 2 to 3; the fermented food is any one or more of the following: soy sauce, table vinegar, cheese, fermented soya beans, fermented bean curd, traditional fermented vegetables, fermented beverages, and fermented rice and flour food.
CN202011459574.7A 2020-12-11 2020-12-11 Probes, methods and kits for absolute quantification of lactobacillus and application of probes, methods and kits Active CN112553353B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202011459574.7A CN112553353B (en) 2020-12-11 2020-12-11 Probes, methods and kits for absolute quantification of lactobacillus and application of probes, methods and kits

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202011459574.7A CN112553353B (en) 2020-12-11 2020-12-11 Probes, methods and kits for absolute quantification of lactobacillus and application of probes, methods and kits

Publications (2)

Publication Number Publication Date
CN112553353A CN112553353A (en) 2021-03-26
CN112553353B true CN112553353B (en) 2023-08-25

Family

ID=75062128

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202011459574.7A Active CN112553353B (en) 2020-12-11 2020-12-11 Probes, methods and kits for absolute quantification of lactobacillus and application of probes, methods and kits

Country Status (1)

Country Link
CN (1) CN112553353B (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102994644A (en) * 2012-12-31 2013-03-27 光明乳业股份有限公司 Lactobacillus plantarum quantitative detection method and detection kit and application thereof
CN107153052A (en) * 2016-03-03 2017-09-12 朱泽策 Raolical polymerizable and detection application that enzyme triggers
CN109971822A (en) * 2019-04-23 2019-07-05 江南大学 A kind of flora absolute quantification method and the application in China white wine fermentation process
CN110468181A (en) * 2019-08-16 2019-11-19 中国人民解放军国防科技大学 A kind of method that dual amplification detects DNA or protein

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102994644A (en) * 2012-12-31 2013-03-27 光明乳业股份有限公司 Lactobacillus plantarum quantitative detection method and detection kit and application thereof
CN107153052A (en) * 2016-03-03 2017-09-12 朱泽策 Raolical polymerizable and detection application that enzyme triggers
CN109971822A (en) * 2019-04-23 2019-07-05 江南大学 A kind of flora absolute quantification method and the application in China white wine fermentation process
CN110468181A (en) * 2019-08-16 2019-11-19 中国人民解放军国防科技大学 A kind of method that dual amplification detects DNA or protein

Also Published As

Publication number Publication date
CN112553353A (en) 2021-03-26

Similar Documents

Publication Publication Date Title
Fang et al. Deciphering the succession patterns of bacterial community and their correlations with environmental factors and flavor compounds during the fermentation of Zhejiang rosy vinegar
Lv et al. Microbial diversity of traditional fermentation starters for Hong Qu glutinous rice wine as determined by PCR-mediated DGGE
Sekwati-Monang et al. Microbiological and chemical characterisation of ting, a sorghum-based sourdough product from Botswana
Kern et al. Optimization of Matrix-assisted-laser-Desorption–Ionization-Time-Of-Flight Mass Spectrometry for the identification of bacterial contaminants in beverages
Song et al. Effect of bioaugmentation on biochemical characterisation and microbial communities in Daqu using Bacillus, Saccharomycopsis and Absidia
CN112553362B (en) Absolute quantitative probe for saccharomyces cerevisiae and application thereof
CN112779349B (en) Probe for absolute quantification of schizosaccharomyces pombe, kit and application
Yang et al. Effects of Lactobacillus curvatus and Leuconostoc mesenteroides on suan cai fermentation in Northeast China
CN112782145B (en) Aspergillus tubingensis absolute quantitative probe and application thereof
Wang et al. Evaluation of the bacterial diversity of inner Mongolian acidic gruel using Illumina MiSeq and PCR-DGGE
Nejati et al. Quantification of major bacteria and yeast species in kefir consortia by multiplex TaqMan qPCR
Cremonesi et al. Development of quantitative real-time PCR and digital droplet-PCR assays for rapid and early detection of the spoilage yeasts Saccharomycopsis fibuligera and Wickerhamomyces anomalus in bread
Oldham et al. Methods for detection and identification of beer-spoilage microbes
CN112899381B (en) Absolute quantification probe, method and application thereof
Garcia-Garcia et al. Distribution of lactobacillus and pediococcus in a brewery environment
Chao et al. The diversity of lactic acid bacteria in a traditional Taiwanese millet alcoholic beverage during fermentation
Baek et al. A species-specific qPCR method for enumeration of Lactobacillus sanfranciscensis, Lactobacillus brevis, and Lactobacillus curvatus during cocultivation in sourdough
CN112695120A (en) Primer, kit and method for rapid identification and quantification of saccharomyces cerevisiae
CN112553353B (en) Probes, methods and kits for absolute quantification of lactobacillus and application of probes, methods and kits
CN112553352B (en) Probe, method and kit for absolute quantification of bacterial microorganisms and application of probe, method and kit
CN112458197B (en) Kit for absolute quantification of fungi and application thereof
CN112877459B (en) Probe for absolute quantification of pichia kudriavzevii
CN112501326B (en) Probe, method and kit for absolute quantification of bacillus and application of probe and method and kit
CN112924428B (en) Probe, method and application for absolute quantification of zygosaccharomyces bailii
CN112538520B (en) Absolute quantification method for microorganisms and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant