CN112779349B - Probe for absolute quantification of schizosaccharomyces pombe, kit and application - Google Patents

Probe for absolute quantification of schizosaccharomyces pombe, kit and application Download PDF

Info

Publication number
CN112779349B
CN112779349B CN202110162990.9A CN202110162990A CN112779349B CN 112779349 B CN112779349 B CN 112779349B CN 202110162990 A CN202110162990 A CN 202110162990A CN 112779349 B CN112779349 B CN 112779349B
Authority
CN
China
Prior art keywords
sample
probe
schizosaccharomyces pombe
fermented
reaction
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110162990.9A
Other languages
Chinese (zh)
Other versions
CN112779349A (en
Inventor
吴群
徐岩
杜如冰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangnan University
Original Assignee
Jiangnan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangnan University filed Critical Jiangnan University
Priority to CN202110162990.9A priority Critical patent/CN112779349B/en
Publication of CN112779349A publication Critical patent/CN112779349A/en
Application granted granted Critical
Publication of CN112779349B publication Critical patent/CN112779349B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a probe and a kit for absolute quantification of schizosaccharomyces pombe and application thereof, belonging to the fields of biology, fermentation and detection. The schizosaccharomyces pombe quantitative probe and the kit can realize total quantity detection of the schizosaccharomyces pombe, and can rapidly complete quantitative work within 2.5 hours without using expensive instruments when being used for detecting and quantifying the schizosaccharomyces pombe. Meanwhile, the sample used in the present invention does not have to be subjected to nucleic acid extraction. The probe and the detection kit based on the invention are used for quantifying schizosaccharomyces pombe, and have the characteristics of rapidness, convenience, cheapness and accuracy.

Description

Probe for absolute quantification of schizosaccharomyces pombe, kit and application
Technical Field
The invention relates to a probe and a kit for absolute quantification of schizosaccharomyces pombe and application thereof, belonging to the fields of biology, fermentation and detection.
Background
Schizosaccharomyces pombe (Schizosaccharomyces pombe) is a functional microorganism that is widely found in traditional brewing systems, such as white spirit, wine, etc. In white spirit research, schizosaccharomyces pombe has stronger acid-resistant capability, and can reduce the accumulation of acetic acid and regulate and control the flora structure, so that the real-time tracking of the biomass of Schizosaccharomyces pombe has important guiding significance for judging the stability of fermentation batches and regulating and controlling fermentation parameters. However, most of the traditional fermentation food systems are multi-strain co-fermentation systems at present, the content of Schizosaccharomyces pombe in a sample cannot be judged by a simple OD colorimetric method, and the fluorescent quantitative PCR method combined with a specific primer or probe can realize the quantification of Schizosaccharomyces pombe in a bacteria mixing system, but high-volume equipment and high-requirement operation environment are required. Therefore, in order to conveniently, rapidly and accurately track the growth trend of Schizosaccharomyces pombe in a sample, it is necessary to develop a corresponding Schizosaccharomyces pombe quantification method and kit.
The principle of the G quadruplex/heme mimic enzyme activity detection is that the G quadruplex can form DNA mimic enzyme with catalase activity with heme, can catalyze hydrogen peroxide to oxidize ABTS to generate ABTS+, presents green color reaction, and can detect characteristic absorbance at the wavelength of 420 nm. The stability of the G quadruplex structure is critical to the whole detection process, if the design is improper, when the G quadruplex sequence forms a dimer with other bases, the G quadruplex sequence can not form the G quadruplex, and a quantitative method based on the principle can cause underestimation of the content of a target gene in a sample in use, and reduces the sensitivity and accuracy of the detection method.
At present, the principle based on G quadruplex/heme simulated enzyme activity detection has been reported to be used for specific detection of microorganisms; for example, literature Wang Y, li X, xi D, wang X.visual detection of Fusarium proliferatum based on asymmetric recombinase polymerase amplification and hemin/G-quad DNAzyme.Rsc Advances 2019;9:37144-37147, asymmetric specific primers are used (upstream primer added with reverse sequence modification of G quadruplex, downstream not modification), and the method is only applicable to detection of specific bacteria Fusarium proliferatum in a sample, and cannot realize total amount detection of Schizosaccharomyces pombe; in addition, in the case of detection using this asymmetric specific primer, different concentrations of the upstream primer and the downstream primer (the concentration of the upstream primer is low and the concentration of the downstream primer is high) are added to a PCR system, and a double-stranded product is formed by Recombinant Polymerase Amplification (RPA) amplification, and as the PCR reaction proceeds, the upstream primer is consumed and the downstream primer is amplified using newly synthesized double-stranded DNA as a template, thereby forming single-stranded DNA with a G quadruplex end, and Fusarium proliferatum in a sample is detected using G quadruplex/heme-mimetic enzyme activity detection. However, this quantitative method still requires a PCR step to generate G quadruplexes, and the PCR process still requires high-volume PCR equipment and a strict operating environment.
Disclosure of Invention
The invention discloses a probe, a kit and application for absolute quantification of schizosaccharomyces pombe, which solve at least one of the following technical problems: (1) The existing method can not realize the total amount detection of all schizosaccharomyces pombe; (2) The existing quantitative method has low species resolution and/or insufficient detection accuracy; (3) The existing quantitative method needs high-volume instruments and/or strict operation environment, and is not suitable for timely detection after production and sampling; (4) the existing quantitative method has complicated operation and the like.
It is a first object of the present invention to provide a set of probes, including signaling probes and quenching probes; the signal probe sequence is shown in SEQ ID NO.1 (GGGTGGGTGGGTGGGTATCGAGCAAAGACGGGGTTC).
In one embodiment, the quenching probe sequence is shown in SEQ ID NO.2 (GAACCCCGTCTTTGCTCGATACCCA).
A second object of the invention is to provide a method for quantifying schizosaccharomyces pombe, comprising the use of the probe of the invention.
The method comprises the following steps: melting DNA in the sample to be detected; adding excessive signal probes (with the sequence shown as SEQ ID NO. 1), and combining with a target nucleotide fragment of a sample to be detected to form double chains, so that G quadruplex is exposed outside the sequence; adding enough quenching probes (with the sequence shown as SEQ ID NO. 2) to form double chains with unbound signaling probes, and destroying the structure of the G quadruplex; the naked leakage is utilized to react with heme to form G quadruplex/heme mimic enzyme with catalase activity, and the activity of the mimic enzyme is combined to characterize biomass of schizosaccharomyces pombe.
In one embodiment, the method is an absolute quantification method, further comprising: establishing a standard curve of catalase activity (or an index related to catalase activity, such as absorbance of a solution at a wavelength of 420nm after catalyzing oxidation of ABTS by hydrogen peroxide to generate ABTS+) and biomass of schizosaccharomyces pombe; when the sample to be detected is detected, substituting the detected catalase activity into a standard curve to obtain the biomass of the schizosaccharomyces pombe in the sample to be detected.
In one embodiment, the method is a relative quantification method, further comprising: a plurality of samples are tested, and the relative value of biomass of schizosaccharomyces pombe in the plurality of different samples is determined according to the relative ratio of the catalase activities detected by the different samples.
In one embodiment, the sample to be tested is a sample containing a cell, genome, metagenome, or the like. Optionally, the sample to be detected is a finished fermented food or a sample obtained from the fermentation process of the fermented food; optionally, the sample to be measured is subjected to pretreatment such as centrifugation and bacterial cell collection, and then subjected to subsequent measurement. Preferably, the cells in the sample are collected and then subjected to DNA melting treatment directly without genome extraction.
In one embodiment, the sample is a fermented food product or a sample or environmental sample taken during fermentation of a fermented food product.
In one embodiment, the fermented food is any one or more of the following: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverage, alcoholic beverage, yoghurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd, fermented rice flour food and the like; the environmental sample is selected from intestinal tract, soil, water body, etc.
In one embodiment, the melting of the DNA in the sample to be tested is performed at an elevated temperature. Alternatively, the sample to be tested is treated at a temperature above 90 ℃. Can be any one of metal bath, water bath, oven, thermal insulation instrument and the like which can provide environment with corresponding temperature.
In one embodiment, the melting is performed in a buffer. Alternatively, the buffer may be Tris-HCl buffer, further containing KCl, NH 4 Cl, naCl, or any one or more thereof. Alternatively, the buffer is Tris-HCl, KCl, ph=7.9.
In one embodiment, the excess is an amount of signaling probe added above that required to fully bind to the target nucleotide fragment of the test sample to form a duplex. The specific amounts used may be determined by one of ordinary skill in the art, in combination with one or more specific samples to be tested, or by pre-experimentation.
In one embodiment, the excess is in excess of 10 10 And copies of the signaling probe.
In one embodiment, the binding of the signaling probe to the target nucleotide fragment of the test sample to form a double strand is performed at a temperature in the range of 50-60 ℃.
In one embodiment, the sufficient amount is an amount of quenching probe that is added in an amount sufficient to form a double strand with all unbound signaling probes. The specific amounts used may be determined by one of ordinary skill in the art in combination with the general knowledge in the art, or by specific samples to be tested, or by pre-experiments.
In one embodiment, the sufficient amount refers to a double amount of signaling probe.
In one embodiment, the adding a sufficient amount of the quenching probe to form a double strand with the unbound signaling probe is performed at a temperature that causes the quenching probe to form a double strand with the unbound signaling probe; the determination of a specific sample to be tested may be determined by a person skilled in the art in combination with the general knowledge in the art.
In one embodiment, the reaction of G quadruplex with heme to form G quadruplex/heme mimic enzyme with catalase activity and the combination of catalase activity to characterize the biomass of schizosaccharomyces pombe means that after heme reaction is added into the system, ABTS and H are added 2 O 2 The catalase activity was then characterized by the absorbance of the reactant.
In one embodiment, the absorbance is at a wavelength of 420 nm.
In one embodiment, the quantification method specifically comprises:
(1) Carrying out DNA melting treatment on a sample to be detected;
(2) Adding a signal probe, and reacting for 30min at 55 ℃;
(3) Adding a quenching probe, and reacting for 30min at 55 ℃;
(4) Adding heme, and reacting at 37 ℃ for 30min;
(5) Adding 2, 2-azino-bis- (3-ethylbenzodihydrothiazoline-6-sulphonic acid) diammonium salt (ABTS) and H 2 O 2 Reacting at 37 ℃ for 30min;
(6) Detecting the absorbance value of the reactant at the wavelength of 420 nm;
(7) The merozoite of the wine in the sample is quantified by combining the absorbance value.
In one embodiment, the quantification method further comprises: preparing samples with different known schizosaccharomyces pombe contents, and measuring absorbance values obtained by processing different samples by the method; drawing a standard curve of the absorbance value and the content of different schizosaccharomyces pombe; substituting the absorbance value obtained by the sample to be tested after the treatment by the method into a standard curve to obtain the schizosaccharomyces pombe content in the sample to be tested.
The third object of the invention is to provide a detection kit for absolute quantification of schizosaccharomyces pombe, which contains the signaling probe with the sequence shown as SEQ ID NO. 1.
In one embodiment, the detection kit further comprises a quenching probe having the sequence shown in SEQ ID NO. 2.
In one embodiment, the detection kit further comprises any one or more of the following: heme, buffer, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS), H 2 O 2 . These reagents may not be contained, and an operator may prepare the kit separately when using the kit.
In one embodiment, the detection kit may comprise a buffer solution of Tris-HCl, KCl, and NH 4 Cl, naCl, or any one or more thereof. Alternatively, the buffer is Tris-HCl, KCl, ph=7.9.
In one embodiment, the detection kit is an absolute quantification kit for schizosaccharomyces pombe, which comprises four reagents (reagent 1, reagent 2, reagent 3, reagent 4) and a set of quantitative probes (signaling probes, quenching probes) for schizosaccharomyces pombe; the reagent 1 comprises heme; the reagent 2 comprises buffer (Tris-HCl, KCl, pH=7.9; wherein KCl can be replaced by NH) 4 Cl, naCl); the reagent 3 comprises 2, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS); the reagent 4 comprises H 2 O 2 。
In one embodiment, the reagents or probes in the assay kit may be in a liquid or solid state, and may be routinely adjusted to appropriate concentrations by those skilled in the art when in use.
A fourth object of the invention is to provide a method of using the kit.
In one embodiment, the method of use comprises: adding excessive signal probes into a sample to be detected of DNA melting for reacting for a period of time, so that the signal probes are combined with target fragments in the sample to be detected; then adding a sufficient amount of quenching probe to form double chains with the unbound signaling probe; adding heme, reacting for a period of time, adding ABTS and H 2 O 2 And (3) reacting for a period of time, detecting the absorbance value of the reactant, and quantifying the schizosaccharomyces pombe in the sample by combining the absorbance value.
In one embodiment, the method includes adjusting the reagents and probes to a concentration suitable for use.
(1) Carrying out DNA melting treatment on a sample to be detected; (2) adding a signal probe, and reacting for 30min at 55 ℃; (3) adding a quenching probe, and reacting for 30min at 55 ℃; (4) adding heme, and reacting for 30min at 37 ℃; (5) Adding 2, 2-azino-bis- (3-ethylbenzodihydrothiazoline-6-sulphonic acid) diammonium salt (ABTS) and H 2 O 2 Reacting at 37 ℃ for 30min; (6) detecting the absorbance of the reactant at a wavelength of 420 nm; (7) The merozoite of the wine in the sample is quantified by combining the absorbance value.
A fifth object of the invention is to provide the use of said kit for quantification of schizosaccharomyces pombe.
In one embodiment, the use is in the field of fermented food technology; optionally, the fermented food is any one or more of the following: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverage, alcoholic beverage, yoghurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd, fermented rice flour food and the like.
In one embodiment, the sample to be tested may be a sample containing a cell, genome, metagenome or the like. Optionally, the sample to be tested is a finished fermented food or a sample or an environmental sample obtained from the fermentation process of the fermented food; optionally, the sample to be measured is subjected to pretreatment such as centrifugation and bacterial cell collection, and then subjected to subsequent measurement. Preferably, the cells in the sample are collected and then subjected to DNA melting treatment directly without genome extraction.
The beneficial effects are that:
the invention combines the G quadruplex with the specificity sequence to form a signal probe, the signal probe is combined with the target sequence to enable the G quadruplex to be exposed outside the sequence, a sufficient amount of quenching probe and unreacted signal probe are added to form double chains, the structure of the G quadruplex is destroyed, the G quadruplex/heme mimic enzyme is formed by reacting with heme, the catalase activity is shown, and the catalase activity is used for representing the biomass of microorganisms. The schizosaccharomyces pombe Schizosaccharomyces pombe quantitative probe can realize the total detection of Schizosaccharomyces pombe; further, a signaling probe was optimized with a sequence of GGGTGGGTGGGTGGGTATCGAGCAAAGACGGGGTTC (SEQ ID NO. 1) and a quenching probe of GAACCCCGTCTTTGCTCGATACCCA (SEQ ID NO. 2). Compared with the signal sequence of SEQ ID NO.3, the G quadruplex sequence in the signal probe of SEQ ID NO.1 does not generate additional space structure with the specific sequence (figure 1), and the detection accuracy is higher and the minimum detection limit is improved.
The probe of the invention is used for detecting and quantifying the schizosaccharomyces pombe Schizosaccharomyces pombe without a detection flow of expensive instruments. The absolute quantitative kit for the microorganisms is also provided for the first time, and can finish quantitative work within 2.5 hours. The invention realizes microorganism quantification by combining a signal probe and a quenching probe in order to avoid using high-volume equipment such as a PCR instrument. The invention solves the problem that the existing microorganism quantitative means depend on expensive instruments and are very limited in practical use.
Furthermore, the method can realize rapid schizosaccharomyces pombe Schizosaccharomyces pombe detection, the sample does not need to be subjected to nucleic acid extraction, and only the microorganisms in the sample need to be eluted in the buffer solution to directly carry out subsequent experiments. Meanwhile, compared with the quantitative result of fluorescent quantitative PCR, the quantitative result obtained by the method has no significant difference.
In conclusion, the probe and the detection kit provided by the invention are used for quantifying the schizosaccharomyces pombe Schizosaccharomyces pombe, and have the characteristics of rapidness, cheapness and accuracy.
Drawings
Fig. 1: signal probe dimer structure. (A) The G quadruplex sequence of SEQ ID NO.1 is not self-loop with the specific sequence; (B) SEQ ID NO.3 has been reported to self-loop G quadruplex sequences with specific sequences for microbial quantification.
Fig. 2: specificity of Schizosaccharomyces pombe probe.
Fig. 3: a standard curve for Schizosaccharomyces pombe quantitative probes based on genome extraction.
Fig. 4: a standard curve based on Schizosaccharomyces pombe quantitative probes that did not extract the sample genome.
Fig. 5: qPCR standard curve.
Fig. 6: comparing the Schizosaccharomyces pombe probe quantification assay based on genome extraction, the Schizosaccharomyces pombe probe quantification assay based on no sample genome extraction, and the qPCRSchizosaccharomyces pombe quantification assay; wherein, (a) is based on Schizosaccharomyces pombe probe quantification experiments without extracting sample genome, (B) is based on Schizosaccharomyces pombe probe quantification experiments with genome extraction, (C) qPCRSchizosaccharomyces pombe quantification experiments.
Fig. 7: the stability of the detection results of the probe (A) based on SEQ ID NO.1/SEQ ID NO.2 and the probe (B) based on SEQ ID NO.3/SEQ ID NO.4 were compared.
The specific embodiment is as follows:
example 1: schizosaccharomyces pombe quantitative probe combination reagent
A probe combination reagent; containing separately packaged signaling probe reagents and quenching probe reagents; wherein the sequence of the signal probe is shown as SEQ ID NO.1, and the sequence of the quenching probe is shown as SEQ ID NO. 2.
The signal probe reagent and the quenching probe reagent are dry powder or liquid; in the case of dry powders, the solution may be diluted to a suitable concentration prior to the experiment, for example, 20. Mu.M using sterile water or buffer; in the case of liquid form, the concentration may be 20 to 200. Mu.M, and the reagent may be diluted before use or used directly.
Example 2: schizosaccharomyces pombe quantitative kit and use thereof
Schizosaccharomyces pombe quantitative kit containing separately packaged signaling probe reagent and quenching probe reagent; wherein the sequence of the signal probe is shown as SEQ ID NO.1, and the sequence of the quenching probe is shown as SEQ ID NO. 2.
The kit can be used together with heme, buffer solution, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS), H 2 O 2 Is matched with the components.
The using method is as follows:
(1) And (5) solution preparation. Preparing a 100nM heme solution (reagent 1); preparing Tris-HCl with a final concentration of 50mM, KCl with a final concentration of 50mM and final pH of 7.9 (reagent 2); 7mM 2, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS) (reagent 3) and 7mM H 2 O 2 Solution (reagent 4); the solvents were all sterile water.
(2) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 was added 4. Mu.L of the sample genomic DNA, and the mixture was treated in a water bath at 90℃for 10 minutes. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.
(3) The quenching probe forms a double strand with the unbound signaling probe. The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (2), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(4) Forming heme/G quadruplex structure. Reagent 1 with a final concentration of 100nM is added to the system after the reaction in step (3) and the reaction is carried out at 37℃for 30min.
(5) And (5) color reaction. To the system at the end of the reaction of (4), a reagent (ABTS) having a final concentration of 7mM and a reagent 4 having a final concentration of 7mM were added, and the reaction was carried out at 37℃for 30 minutes to carry out the reaction (green).
Detecting the absorbance value of the reactant at the wavelength of 420 nm; the Schizosaccharomyces pombe in the sample was quantified in combination with absorbance.
Of course, in absolute quantification, a standard curve of absorbance and Schizosaccharomyces pombe biomass can be drawn by itself, or Schizosaccharomyces pombe biomass can be directly converted according to the recommended use method of the kit and the standard curve.
Example 3: schizosaccharomyces pombe quantitative kit
Schizosaccharomyces pombe quantitative kit containing separately packaged signaling probe reagent and quenching probe reagent; wherein the sequence of the signal probe is shown as SEQ ID NO.1, and the sequence of the quenching probe is shown as SEQ ID NO. 2.
The kit also contains 100nM heme solution (reagent 1), tris-HCl buffer, 7mM 2, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS), 7mM H 2 O 2 A solution.
Example 4: specificity of Schizosaccharomyces pombe quantitative kit
(1) Schizosaccharomyces pombe from fermented cereal was selected as positive control and 36 bacterial species microorganisms and 6 fungal species microorganisms, which were widely present in the fermented food sample, were selected as negative controls, bacterial microorganisms Lactobacillus buchneri, lactobacillus dioilvorans, lactobacillus brevis, lactobacillus crustorum, lactobacillus plantarum, lactobacillus harbinensis, lactobacillus acidiliscis, pediococcus ethanolidurans, pediococcus acidilactici, pediococcus pentosaceus, lactobacillus murinus, lactobacillus curvatus, lactobacillus casei, lactobacillus reuteri, lactobacillus panis, lactobacillus fermentum, lactobacillus johnsonii, lactobacillus delbrueckii, lactococcus lactis, weissella confusa, weissella paramesenteroides, weissella viridescens, leuconostoc citreum, leuconostoc lactis, leuconostoc mesenteroides, leuconostoc pseudomesenteroides, enterococcus italicus, enterococcus lactis, enterococcus faecalis, bacillus coagulans, bacillus licheniformis, bacillus tequilensis, bacillus subtilis, bacillus velezensis, acetobacter pasteurianus, enterococcus faecium, respectively. The fungal microorganisms are Aspergillus tubingensis, mucor rouxianius, saccharomyces cerevisiae, zygosaccharomyces bailii, pichia kudriavzevii, saccharomycopsis fibuligera, respectively.
(2) The above microorganisms were cultured by selecting different culture media, wherein MRS culture media was used for Lactobacillus buchneri, lactobacillus dioilvorans, lactobacillus brevis, lactobacillus crustorum, lactobacillus plantarum, lactobacillus harbinensis, lactobacillus acidiliscis, pediococcus ethanolidurans, pediococcus acidilactici, pediococcus pentosaceus, lactobacillus murinus, lactobacillus curvatus, lactobacillus casei, lactobacillus reuteri, lactobacillus panis, lactobacillus fermentum, lactobacillus johnsonii, lactobacillus delbrueckii, lactococcus lactis, weissella confusa, weissella paramesenteroides, weissella viridescens, leuconostoc citreum, leuconostoc lactis, leuconostoc mesenteroides, leuconostoc pseudomesenteroides, and the culture media were prepared from tryptone 10.0g/L, beef extract 8.0g/L, yeast extract 4.0g/L, glucose 18.0g/L, and sorbitan oleate 0.8mL/L, K 2 HPO 4 2.5g/L, sodium acetate trihydrate 6.0g/L, triammonium citrate 2.0g/L, mgSO 4 ·7H 2 O 0.3g/L，MnSO 4 ·4H 2 O0.08 g/L. The culture conditions were 30℃for 48 hours. Enterococcus italicus, enterococcus lactis, enterococcus faecalis, bacillus coagulans, bacillus licheniformis, bacillus tequilensis, bacillus subtilis, bacillus velezensis, acetobacter pasteurianus, enterococcus faecium and Escherichia coli were cultured in LB medium comprising peptone 10.0g/L, yeast powder 5g/L and sodium chloride 10g/L. The culture conditions were 37℃for 24 hours. Aspergillus tubingensis Mucor rouxianus, schizosaccharomyces pombe, zygosaccharomyces bailii, pichia kudriavzevii, saccharomycopsis fibuligera, saccharomyces cerevisiae YPD medium was used, the medium formulation being 10g/L yeast extract, 20g/L peptone, 20g/L glucose. The culture conditions are as follows: the mold is cultured at 30 ℃ for 5 days, and the yeast is cultured at 30 ℃ for 2 days.
(3) And (5) extracting a single bacterial genome. The bacterial liquid was treated at 12000rpm for 2min, and the precipitate was collected. The genome of the 43 pure cultures of microorganisms was extracted using the gene extraction kit DNeasy Tissue Kit.
(4) The probe was selected as Schizosaccharomyces pombe specific probe, the sequence of the signaling probe was GGGTGGGTGGGTGGGTATCGAGCAAAGACGGGGTTC (SEQ ID NO. 1), and the sequence of the quenching probe was GAACCCCGTCTTTGCTCGATACCCA (SEQ ID NO. 2).
(4) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9), 4. Mu.L of genomic DNA of different microorganisms was added, and the mixture was treated in a water bath at 90℃for 10 minutes. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.
(5) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (4), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(6) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (5) at a final concentration of 100nM and the reaction was treated at 37℃for 30min.
(7) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (6) 2 O 2 ) The treatment is carried out at 37 ℃ for 30min. As shown in FIG. 2, the test group added with Schizosaccharomyces pombe genome showed no color reaction, and the test group added with non-Schizosaccharomyces pombe and the blank group showed no color reaction, thus demonstrating the specificity of detection Schizosaccharomyces pombe in the present kit.
Example 5: quantitative method accuracy assessment
(1) Schizosaccharomyces pombe the microbial inoculum was obtained by the culture method in example 4, and the microbial concentration was measured by plate count method, and the genome extraction was the same as in example 4.
(2) Schizosaccharomyces pombe genomic DNA was diluted by 10-fold gradient.
(3) The color reaction was performed with Schizosaccharomyces pombe genomic DNA at different concentrations using the probe of Schizosaccharomyces pombe. The sequence of the signal probe is
GGGTGGGTGGGTGGGTATCGAGCAAAGACGGGGTTC (SEQ ID NO. 1), the sequence of the quenching probe is GAACCCCGTCTTTGCTCGATACCCA (SEQ ID NO. 2).
(4) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, final pH of 7.9) was added 4. Mu.L of genomic DNA at different dilutions (no sample DNA added as a blank). Treating in water bath at 90deg.C for 10min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.
(5) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (4), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(6) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (5) to a final concentration of 100nM, and the reaction was treated at 37℃for 30min.
(7) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (6) 2 O 2 ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank.
(8) Constructing a standard curve by calculating the linear relation between the absorbance and the concentration of the bacterial liquid, as shown in figure 3, R 2 =0.99 (x is log10 CFU/mL, y is OD 420 A linear range of 10 3 ～10 7 ). The accuracy of the quantitative method of the kit provided by the invention is proved.
Example 6: quantitative experiments of Schizosaccharomyces pombe in wine samples
(1) Samples were collected from Shandong tobacco stand, a well known wine manufacturer, by the Materials and methods method of Gayevskiy, V., & Goddard, M. (2012) Geographic delineations of yeast communities and populations associated with vines and wines in New Zealand. ISME J,6 (7), 1281-1290. The genomic concentration was 658.39 ng/. Mu.L. (2) The color reaction was performed using a probe of Schizosaccharomyces pombe. The sequence of the signaling probe was GGGTGGGTGGGTGGGTATCGAGCAAAGACGGGGTTC (SEQ ID NO. 1) and the sequence of the quenching probe was GAACCCCGTCTTTGCTCGATACCCA (SEQ ID NO. 2).
(4) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9), 4. Mu.L of sample metagenomic DNA (no sample DNA added as a blank) was added. Treating in water bath at 90deg.C for 10min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.
(5) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (4), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(6) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (5) at a final concentration of 100nM and the reaction was treated at 37℃for 30min.
(7) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (7 mM H) at a final concentration of 7mM to the system at the end of the reaction of (6) 2 O 2 ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured by an ultraviolet spectrophotometer, and the experimental group without adding sample DNA was used as a blank, showing that the absorbance was 0.
(8) Based on the standard curve obtained in example 5, the total Schizosaccharomyces pombe content in the sample was calculated to be 0log 10 CFU/mL。
(9) The Schizosaccharomyces pombe in the same sample was quantified by fluorescent quantitative PCR (quantitative procedure and materials same as in example 11 (6)), which showed Schizosaccharomyces pombe in total to be 0log 10 CFU/mL, consistent with the quantitative results determined by the method described above.
Example 7: absolute quantification of Schizosaccharomyces pombe in a sample of fermented grains
(1) Reference is made to Song Z W, du H, zhang Y, xu Y. Unraveling core functional microbiota in traditional solid-state fermentation by high-throughput amplicons and metatranscriptomics sequencing. Front in microbiology 2017; the method in MATERIALS AND METHODS of 8:1294, extracting metagenome from fermented grains sample of Shandong province, and the genome concentration is 100.02 ng/. Mu.L.
(2) The color reaction was performed using a probe of Schizosaccharomyces pombe. The sequence of the signaling probe was GGGTGGGTGGGTGGGTATCGAGCAAAGACGGGGTTC (SEQ ID NO. 1) and the sequence of the quenching probe was GAACCCCGTCTTTGCTCGATACCCA (SEQ ID NO. 2).
(3) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9), 4. Mu.L of fermented grain metagenomic DNA (no sample DNA added as a blank) was added. Treating in water bath at 90deg.C for 10min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.
(4) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (3), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(5) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (4) at a final concentration of 100nM and the reaction was treated at 37℃for 30min.
(6) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (5) 2 O 2 ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured using an ultraviolet spectrophotometer, and the experimental group without adding sample DNA was used as a blank, showing that the absorbance was 0.602.
(7) Based on the standard curve obtained in example 2, the total microorganism count of Schizosaccharomyces pombe in the sample was calculated to be 7.65log 10 CFU/mL。
(8) Schizosaccharomyces pombe in the same fermented grain sample was quantified by a fluorescent quantitation method (quantitation step and material same as in example 11 (6)), and the result showed that Schizosaccharomyces pombe had a total microorganism amount of 7.62log 10 CFU/mL was substantially identical to the quantitative results determined by the method described above (coefficient of variation, cv=0.0029).
Example 8: schizosaccharomyces pombe absolute quantification method based on non-extracted sample genome
(1) Schizosaccharomyces pombe the microbial inoculum was obtained according to the cultivation method in example 4, and the microbial concentration was determined by plate counting.
(2) Diluting Schizosaccharomyces pombe bacterial liquid in (1) by 10-time gradient
(3) The color reaction was performed using a probe of Schizosaccharomyces pombe. The sequence of the signaling probe was GGGTGGGTGGGTGGGTATCGAGCAAAGACGGGGTTC (SEQ ID NO. 1) and the sequence of the quenching probe was GAACCCCGTCTTTGCTCGATACCCA (SEQ ID NO. 2).
(4) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9) was added 10. Mu.L of different dilutions of bacterial solution (no sample bacterial solution was added as a blank). Treating in boiling water bath for 20min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min. (5) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (4), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(6) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (5) to a final concentration of 100nM, and the reaction was treated at 37℃for 30min.
(7) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (6) 2 O 2 ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank.
(8) Constructing a standard curve by calculating the linear relation between the absorbance and the concentration of the bacterial liquid, as shown in figure 4, R 2 =0.99 (x is log10 CFU/mL, y is OD 420 A linear range of 10 3 ～10 7 ). Proved by the accuracy of the quantitative method of the kit
Example 9: determination of Schizosaccharomyces pombe content in wine samples based on absolute quantification method of microorganisms without extracting sample genome
(1) The sample is collected in some known grape wine manufacturer of Shandong Jiedu, and the sample processing method is as follows: to 1mL of the sample, 5mL of phosphate buffer was added, and the cells were collected by centrifugation at 3000 Xg for 10 min.
(2) And (5) washing. To the cells obtained in (1), 5mL of phosphate buffer was added, and the cells were collected by centrifugation at 12000 Xg for 2min and repeated.
(3) The cells were resuspended, and 1mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and pH 7.9) was added to the cells obtained in (2), followed by air-aspiration and mixing.
(4) The color reaction was performed using a probe of Schizosaccharomyces pombe. The sequence of the signaling probe was GGGTGGGTGGGTGGGTATCGAGCAAAGACGGGGTTC (SEQ ID NO. 1) and the sequence of the quenching probe was GAACCCCGTCTTTGCTCGATACCCA (SEQ ID NO. 2).
(5) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9) was added 10. Mu.L of a grape fermentation broth (no sample broth was added as a blank). Treating in boiling water bath for 20min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.
(6) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (5), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(7) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (6) at a final concentration of 100nM, and the reaction was carried out at 37℃for 30min.
(8) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (7) 2 O 2 ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured by an ultraviolet spectrophotometer, and the experimental group without adding sample DNA was used as a blank, showing that the absorbance was 0.
(9) Based on the standard curve obtained in example 8, the total Schizosaccharomyces pombe content in the sample was calculated to be 0log 10 CFU/mL。
(10) The Schizosaccharomyces pombe in the same sample was quantified by fluorescent quantitative PCR (quantitative procedure and material same as in example 11 (6)), and as a resultExhibits a total of Schizosaccharomyces pombe of 0log 10 CFU/mL, consistent with the quantitative results determined by the method described above.
Example 10: determination of Schizosaccharomyces pombe content in fermented grain sample based on absolute quantification method without extracting sample genome
(1) The sample is derived from fermented grains of certain winery in Shandong, and the sample treatment method comprises the following steps: to 1g of the sample, 5mL of phosphate buffer was added, and the cells were collected by centrifugation at 3000 Xg for 10 min.
(2) And (5) washing. To the cells obtained in (1), 5mL of phosphate buffer was added, and the cells were collected by centrifugation at 12000 Xg for 2min and repeated.
(3) The cells were resuspended, and 1mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and pH 7.9) was added to the cells obtained in (2), followed by air-aspiration and mixing.
(4) The color reaction was performed using a probe of Schizosaccharomyces pombe. The sequence of the signaling probe was GGGTGGGTGGGTGGGTATCGAGCAAAGACGGGGTTC (SEQ ID NO. 1) and the sequence of the quenching probe was GAACCCCGTCTTTGCTCGATACCCA (SEQ ID NO. 2).
(5) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9), 10. Mu.L of fermented grain bacterial liquid (no sample bacterial liquid was added as a blank) was added. Treating in boiling water bath for 20min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.
(6) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (5), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(7) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (6) at a final concentration of 100nM, and the reaction was carried out at 37℃for 30min.
(8) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (7) 2 O 2 ) The treatment is carried out at 37 ℃ for 30min. Determination of absorbance at 420nm Using ultraviolet Spectrophotometer to test without addition of sample DNAThe group served as a blank and showed an absorbance of 0.612.
(9) Based on the standard curve obtained in example 8, the total Schizosaccharomyces pombe in the sample was calculated to be 7.41log 10 CFU/mL，
(10) Quantification of Schizosaccharomyces pombe in the same sample described above was performed by fluorescent quantitative PCR (quantitative procedure and materials same as in example 11 (6)), which showed Schizosaccharomyces pombe total amount to be 7.62log 10 CFU/mL, substantially identical to the two sets of data measured by the method described above (coefficient of variation, cv=0.020).
Example 11: comparison of microorganism quantitative detection kit and fluorescent quantitative PCR detection result
(1) The samples were selected from three samples of fermented grains of white spirit from the end point of the fermentation in some winery in Shandong province.
(2) Sample processing:
(i) Total genomes in three samples were extracted at genome concentrations of 369 ng/. Mu.L, 590 ng/. Mu.L, 321.89 ng/. Mu.L, respectively.
(ii) To 1g of the sample, 5mL of phosphate buffer was added, and the cells were collected by centrifugation at 3000 Xg for 10 min. To the obtained cells, 5mL of phosphate buffer was added, and the cells were collected by centrifugation at 12000 Xg for 2min and repeated. The cells were resuspended, and 1mL of the buffer solution of reagent 2 was added to the obtained cells, followed by air-aspiration and mixing.
(3) The color reaction was performed using a probe of Schizosaccharomyces pombe. The sequence of the signaling probe was GGGTGGGTGGGTGGGTATCGAGCAAAGACGGGGTTC (SEQ ID NO. 1) and the sequence of the quenching probe was GAACCCCGTCTTTGCTCGATACCCA (SEQ ID NO. 2).
(4) Assay based on kit quantification method without genome extraction.
(i) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9), 10. Mu.L of fermented grain bacterial liquid (no sample bacterial liquid was added as a blank) was added. Treating in boiling water bath for 20min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.
(ii) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (i), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(iii) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (ii) to a final concentration of 100mM, and the reaction was treated at 37℃for 30 minutes.
(iv) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (iii) 2 O 2 ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank, showing that the absorbance was 0.553,0.542,0.533.
(v) Based on the standard curve obtained in example 8, the total Schizosaccharomyces pombe in the sample was calculated to be 6.81.+ -. 0.09log 10 CFU/mL。
(5) Kit quantitative method determination based on genome extraction
(i) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH of 7.9), 4. Mu.L of fermented grain metagenomic DNA (no sample DNA added as a blank) was added. Treating in water bath at 90deg.C for 10min. After adding 4. Mu.L of 20. Mu.M signaling probe, the reaction was carried out at 55℃for 30min.
(ii) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (i), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(iii) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (ii) at a final concentration of 100nM and treated at 37℃for 30min.
(iv) And (5) color reaction. Adding reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM to the system at the end of the reaction of (5) 2 O 2 ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank, showing that the absorbance was 0.535,0.524,2.523.
(v) Based on the standard curve obtained in example 5, schizosac was calculated in the samplesThe total amount of the charomyces pombe is 6.96+/-0.06 log 10 CFU/mL。
(6) The Schizosaccharomyces pombe content (i) Schizosaccharomyces pombe bacterial liquid in the qPCR quantitative sample was obtained according to the culture method in example 4, and the microbial concentration was measured by plate count method, and the genome extraction was the same as in example 4.
(ii) Schizosaccharomyces pombe genomic DNA was diluted by 10-fold gradient.
(iii) The qPCR system was SYBR Green 10. Mu.L, upstream and downstream primers 20. Mu.M, template DNA 0.5. Mu.L, and sterile water supplemented 20. Mu.L.
(iv) Reaction procedure for qPCR: pre-denaturation at 95 ℃ for 5min, cyclic stage: 95 ℃ for 5s and 60 ℃ for 20s; the cycle number was 40, and the dissolution profile was raised from 65℃to 95℃by 0.5℃every 5 seconds.
(v) qPCR was performed on the extracted genome using Schizosaccharomyces pombe specific primers with a downstream sequence of ATCGAGCAAAGACGGGGTTC (SEQ ID NO. 5) and a downstream sequence of
AGTGAAGCGGGAAAAGCTCA(SEQ ID NO.6)。
(vi) The genomic DNA was diluted 10-fold, and a standard curve of CT values and Schizosaccharomyces pombe strain concentration was established, as shown in FIG. 4, R 2 ＝0.99。
(vii) qPCR system and reaction conditions are the same as (iii), (iv). According to the CT value of the end of the reaction, the concentration of Schizosaccharomyces pombe in the sample is calculated to be 6.85+/-0.14 log through the established standard curve 10 CFU/g。
(7) By significance difference analysis, the results are shown in fig. 6, example 12 with no significance difference (P < 0.05) between the three quantification methods: detection limit for detection by using two different sequence signal probes
(1) Schizosaccharomyces pombe the microbial inoculum was obtained according to the cultivation method in example 4, and the microbial concentration was determined by plate count method, and the genome was extracted at a concentration of 7.49log10 CFU/mL as in example 4.
(2) The Schizosaccharomyces pombe genomic DNA was diluted by a 10-fold gradient to give a DNA template of 2.49log10 CFU/mL.
(3) The Schizosaccharomyces pombe signal probe provided by the invention has the sequence of
GGGTGGGTGGGTGGGTATCGAGCAAAGACGGGGTTC (SEQ ID NO. 1), the sequence of the quenching probe is GAACCCCGTCTTTGCTCGATACCCA (SEQ ID NO. 2). Adding 3.2log of the product obtained in (2) 10 CFU/mL Schizosaccharomyces pombe genomic DNA was subjected to a chromogenic reaction.
(4) Using the Schizosaccharomyces pombe signaling probe sequence (SEQ ID NO. 3)
GGGATTGGGATTGGGATTGGGATCGAGCAAAGACGGGGTTC, the quenching probe sequence is GAACCCCGTCTTTGCTCGATCCCAA (SEQ ID NO. 4). The 3.2log10 CFU/mL Schizosaccharomyces pombe genomic DNA obtained in (2) was added to carry out a color reaction.
(5) The signaling probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, final pH of 7.9) was added 4. Mu. L Schizosaccharomyces pombe genomic DNA (no sample DNA was added as a blank). Treating in water bath at 90deg.C for 10min. After adding 4. Mu.L of 20. Mu.M of different signaling probes, respectively, the reaction was carried out at 55℃for 30min.
(6) The quenching probe forms double chains with the unbound signaling probe, disrupting the G quadruplex structure. To the system after the reaction of step (5), 8. Mu.L of 20. Mu.M quenching probe was added, and the reaction was carried out at 55℃for 30 minutes.
(7) Forming heme/G quadruplex structure. Reagent 1 (heme) was added to the system after the reaction of step (6) at a final concentration of 100nM, and the reaction was carried out at 37℃for 30min.
(8) And (5) color reaction. To the system at the end of the reaction of (7), reagent 3 (ABTS) at a final concentration of 7mM and reagent 4 (H) at a final concentration of 7mM were added, respectively 2 O 2 ) The treatment is carried out at 37 ℃ for 30min. The absorbance at 420nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank.
(9) The steps (5), (6), (7) and (8) were repeated 9 times, and the stability of the detection results was compared as shown in fig. 7. A Coefficient of Variation (CV) of the quantitative result based on the signal sequence of SEQ ID NO.3 was 0.80; the quantitative result variation coefficient based on the signal sequence of SEQ ID NO.1 is 0.06, and the detection effect is stable.
While the invention has been described with reference to the preferred embodiments, it is not limited thereto, and various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
SEQUENCE LISTING
<110> university of Jiangnan
<120> probe and kit for absolute quantification of schizosaccharomyces pombe and application thereof
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 36
<212> DNA
<213> Synthesis
<400> 1
gggtgggtgg gtgggtatcg agcaaagacg gggttc 36
<210> 2
<211> 25
<212> DNA
<213> Synthesis
<400> 2
gaaccccgtc tttgctcgat accca 25
<210> 3
<211> 41
<212> DNA
<213> Synthesis
<400> 3
gggattggga ttgggattgg gatcgagcaa agacggggtt c 41
<210> 4
<211> 25
<212> DNA
<213> Synthesis
<400> 4
gaaccccgtc tttgctcgat cccaa 25

Claims (12)

1. A set of probes comprising a signaling probe and a quenching probe; the sequence of the signal probe is shown as SEQ ID NO. 1; the sequence of the quenching probe is shown as SEQ ID NO. 2.
2. A detection kit comprising the signaling probe and the quenching probe according to claim 1.
3. The test kit of claim 2, further comprising any one or more of the following: heme, buffer, 2-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt, H 2 O 2 。
4. A method for quantifying schizosaccharomyces pombe, characterized in that the method uses the probe according to claim 1 or the detection kit according to any one of claims 2-3.
5. The method of quantification of claim 4, wherein the method comprises: melting DNA in the sample to be detected; adding excessive signal probes, and combining with target nucleotide fragments of a sample to be detected to form double chains, so that G quadruplex naked leakage is outside the sequence; adding enough quenching probes and unbound signaling probes to form double chains so as to destroy the G quadruplex structure; the naked leakage is utilized to react with heme to form G quadruplex/heme mimic enzyme with catalase activity, and the activity of the mimic enzyme is combined to characterize biomass of schizosaccharomyces pombe.
6. The method of quantification of claim 4, wherein the method is absolute quantification or relative quantification.
7. The method of quantification according to claim 6, wherein when the method is absolute quantification, further comprising: establishing a standard curve of the catalase activity or an index related to the catalase activity and biomass of schizosaccharomyces pombe; when the sample to be detected is detected, substituting the detected catalase activity or an index which is related to the catalase activity into a standard curve to obtain the biomass of the schizosaccharomyces pombe in the sample to be detected.
8. The method according to any one of claims 5 to 7, wherein the sample to be measured is a sample containing a cell, a genome or a metagenome.
9. The method of claim 8, wherein the sample is a fermented food product or a sample taken from the fermentation process of a fermented food product, or an environmental sample.
10. The method of claim 9, wherein the fermented food product is any one or more of the following: white wine, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, yogurt, cheese, fruit vinegar, fermented glutinous rice, fermented soybean, fermented bean curd, and fermented rice flour food; the environmental sample is selected from intestinal tract, soil and water body.
11. A method of using the kit of any one of claims 2-3, comprising: adding excessive signal probes into a sample to be detected of DNA melting for reacting for a period of time, so that the signal probes are combined with target fragments in the sample to be detected; then adding enough quenching probes to form double chains with the unbound signaling probes; adding heme, reacting for a period of time, adding ABTS and H 2 O 2 And (3) reacting for a period of time, detecting the absorbance value of the reactant, and quantifying the schizosaccharomyces pombe in the sample by combining the absorbance value.
12. A method for detecting the amount of schizosaccharomyces pombe in a fermented food or environmental sample, comprising using the probe of claim 1, or the kit of claims 2-3; the fermented food is any one or more of the following: white wine, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, yogurt, cheese, fruit vinegar, fermented glutinous rice, fermented soybean, fermented bean curd, and fermented rice flour food; the environmental sample is selected from intestinal tract, soil and water body.
CN202110162990.9A 2021-02-05 2021-02-05 Probe for absolute quantification of schizosaccharomyces pombe, kit and application Active CN112779349B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110162990.9A CN112779349B (en) 2021-02-05 2021-02-05 Probe for absolute quantification of schizosaccharomyces pombe, kit and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110162990.9A CN112779349B (en) 2021-02-05 2021-02-05 Probe for absolute quantification of schizosaccharomyces pombe, kit and application

Publications (2)

Publication Number Publication Date
CN112779349A CN112779349A (en) 2021-05-11
CN112779349B true CN112779349B (en) 2023-08-08

Family

ID=75761054

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110162990.9A Active CN112779349B (en) 2021-02-05 2021-02-05 Probe for absolute quantification of schizosaccharomyces pombe, kit and application

Country Status (1)

Country Link
CN (1) CN112779349B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113215153A (en) * 2021-05-31 2021-08-06 江南大学 Aspergillus oryzae absolute quantitative primer, probe and kit
CN113215152A (en) * 2021-05-31 2021-08-06 江南大学 Primer, probe and kit for absolute quantification of Rhizopus oryzae

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107523625A (en) * 2017-09-20 2017-12-29 贵州茅台酒股份有限公司 The quantitative analysis method of producing and ethanol and lactic acid producing key microorganisms in more micro- solid state fermentation

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9902997B2 (en) * 2014-11-11 2018-02-27 National Taiwan University Kit comprising a polynucleotide probe for detecting a target nucleic acid

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107523625A (en) * 2017-09-20 2017-12-29 贵州茅台酒股份有限公司 The quantitative analysis method of producing and ethanol and lactic acid producing key microorganisms in more micro- solid state fermentation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
辣根过氧化物酶同功酶C3基因在毕赤酵母中的表达;邵金辉;朱有名;韩金祥;吴围屏;吴坚美;;生物技术(第06期);第10-12页 *

Also Published As

Publication number Publication date
CN112779349A (en) 2021-05-11

Similar Documents

Publication Publication Date Title
Lv et al. Microbial diversity of traditional fermentation starters for Hong Qu glutinous rice wine as determined by PCR-mediated DGGE
Fang et al. Deciphering the succession patterns of bacterial community and their correlations with environmental factors and flavor compounds during the fermentation of Zhejiang rosy vinegar
Zheng et al. Complex microbiota of a Chinese “Fen” liquor fermentation starter (Fen-Daqu), revealed by culture-dependent and culture-independent methods
CN112779349B (en) Probe for absolute quantification of schizosaccharomyces pombe, kit and application
CN112553362B (en) Absolute quantitative probe for saccharomyces cerevisiae and application thereof
CN112782145B (en) Aspergillus tubingensis absolute quantitative probe and application thereof
Song et al. Effect of bioaugmentation on biochemical characterisation and microbial communities in Daqu using Bacillus, Saccharomycopsis and Absidia
Nejati et al. Quantification of major bacteria and yeast species in kefir consortia by multiplex TaqMan qPCR
CN112899381B (en) Absolute quantification probe, method and application thereof
Riedl et al. Bavarian wheat beer, an example of a special microbe habitat–cultivation, detection, biofilm formation, characterization of selected lactic acid bacteria hygiene indicators and spoilers
CN105524921B (en) A kind of method of Rapid identification production urethanes yeast
Garcia-Garcia et al. Distribution of lactobacillus and pediococcus in a brewery environment
CN112458197B (en) Kit for absolute quantification of fungi and application thereof
CN112877459B (en) Probe for absolute quantification of pichia kudriavzevii
CN112501326B (en) Probe, method and kit for absolute quantification of bacillus and application of probe and method and kit
CN112924428B (en) Probe, method and application for absolute quantification of zygosaccharomyces bailii
CN112553353B (en) Probes, methods and kits for absolute quantification of lactobacillus and application of probes, methods and kits
CN106591491A (en) Method for increasing loop-mediated isothermal amplification efficiency and application thereof
CN112553352B (en) Probe, method and kit for absolute quantification of bacterial microorganisms and application of probe, method and kit
CN112924429B (en) Absolute quantitative probe and kit for Lactobacillus jin Shini
CN112538520B (en) Absolute quantification method for microorganisms and application thereof
CN112646923A (en) Primer, kit and method for rapidly identifying and quantifying saccharomyces cerevisiae
CN112695120A (en) Primer, kit and method for rapid identification and quantification of saccharomyces cerevisiae
CN113215152A (en) Primer, probe and kit for absolute quantification of Rhizopus oryzae
CN112608985A (en) Primer and method for quickly identifying and quantifying schizosaccharomyces pombe

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant