CN113215152A

CN113215152A - Primer, probe and kit for absolute quantification of Rhizopus oryzae

Info

Publication number: CN113215152A
Application number: CN202110600715.0A
Authority: CN
Inventors: 吴群; 徐岩; 杜如冰
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2021-05-31
Filing date: 2021-05-31
Publication date: 2021-08-06

Abstract

The invention discloses a primer, a probe and a kit for absolute quantification of Rhizopus oryzae, and belongs to the fields of biology, food and detection. In the invention, a large amount of specific fragments of Rhizopus oryzae are obtained through screening, and are used for constructing a signal probe reagent and a quenching probe, so that a quantitative probe and a kit of Rhizopus oryzae are designed. The method can realize the total amount detection of the Rhizopus oryzae, does not need expensive instruments when used for detection and Rhizopus oryzae quantification, and can quickly finish the quantification work within 2.5 h. Meanwhile, the sample used in the present invention does not have to be subjected to nucleic acid extraction. The probe and the detection kit based on the invention are used for Rhizopus oryzae quantification, and have the characteristics of rapidness, convenience, cheapness and accuracy.

Description

Primer, probe and kit for absolute quantification of Rhizopus oryzae

Technical Field

The invention relates to a primer, a probe and a kit for absolute quantification of Rhizopus oryzae, belonging to the fields of biology, food and detection.

Background

Rhizopus oryzae exists widely in food, especially traditional fermented food, and the biological reaction process involved in the fermentation process includes white spirit, Pu' er tea, etc. For example, during the fermentation process of white spirit, Rhizopus oryzae can secrete a plurality of amylases and proteases, and the proteases are used for hydrolyzing starch and protein and are important for the metabolism of ethanol and flavor components. Therefore, it is necessary to track the biomass of Rhizopus oryzae in real time, and the method has important guiding significance for judging the stability of fermentation batches and regulating and controlling fermentation parameters. However, most of the conventional fermented food systems are multi-strain co-fermentation systems, the content of Rhizopus oryzae in a sample cannot be judged by a simple OD colorimetric method, and although the fluorescence quantitative PCR method can be combined with a specific primer or probe to realize the quantification of Rhizopus oryzae in a mixed bacteria system, high-equipment and high-requirement operating environment are required. Therefore, in order to conveniently, rapidly and accurately track the growth variation trend of Rhizopus oryzae in a sample, a corresponding Rhizopus oryzae quantitative method and a kit need to be developed.

The principle of enzyme activity detection of the G quadruplex/heme analogue is that the G quadruplex can form DNA mimic enzyme with catalase activity with heme, can catalyze hydrogen peroxide to oxidize ABTS to generate ABTS +, presents green color development reaction, and can detect characteristic light absorption value under the wavelength of 420 nm. The stability of the structure of the G quadruplex is crucial to the whole detection process, if the design is not proper, when the G quadruplex sequence and other bases form a dimer, the G quadruplex sequence cannot form the G quadruplex, and a quantitative method based on the principle can underestimate the content of a target gene in a sample in use and reduce the sensitivity and the accuracy of the detection method.

At present, the inventor group has designed a microorganism quantification method based on the detection principle of G quadruplex/heme mimetic enzyme activity in earlier studies for Pichia kudriavzevii, Lactobacillus acetolerans, Lactobacillus jinshani, Zygosaccharomyces bailii, Aspergillus tubingensis, and Schizosaccharomyces pombe, but a quantification method for Rhizopus oryzae has not been developed yet. The difficulty is mainly reflected in two aspects: no available specific sequence is used for distinguishing target species and other species with similar evolutionary relationship; ② the Rhizopus oryzae has diversity in strain species, 45 strains have been reported by NCBI at present, in the search of interspecific specific sequences, how to ensure the coverage of the sequences in the strains is the key to develop the quantitative method of Rhizopus oryzae with universality.

Disclosure of Invention

The probe, the kit and the application for the absolute quantification of Rhizopus oryzae solve at least one technical problem as follows: (1) no specific sequence of Rhizopus oryzae reported at present exists; (2) the existing method can not realize the total amount detection of all Rhizopus oryzae; (3) the existing quantitative method has low species resolution and/or insufficient detection accuracy; (4) the existing quantitative method needs high-volume instruments and equipment and/or strict operation environment, and is not suitable for timely detection after production sampling; (5) the existing quantitative method has complicated operation and the like.

The first object of the present invention is to provide a set of primer pairs comprising SEQ ID NO.5 and SEQ ID NO. 6.

Based on the primer pair, a group of probes with high specificity among species and high coverage in the species are designed, and the probes comprise a signal probe and a quenching probe; the sequence of the signal probe is shown as SEQ ID NO.1 (GGGTGGGTGGGTGGGTAAGGCATAAAACTCTTCC).

In one embodiment, the quenching probe has the sequence shown in SEQ ID NO.2 (GGAAGAGTTTTATGCCTTACCCA).

It is a second object of the present invention to provide a method for Rhizopus oryzae quantification, which comprises using the primer pair or probe of the present invention.

The method comprises the following steps: melting DNA in a sample to be detected; adding excessive signal probe (sequence shown as SEQ ID NO.1), and combining with target nucleotide fragment of the sample to be detected to form double chains, so that the G quadruplex is exposed outside the sequence; adding sufficient quenching probe (with sequence shown as SEQ ID NO.2) to form double chains with the unbound signal probe, and destroying the structure of the G quadruplex; the biomass of Rhizopus oryzae was characterized by using the naked-leak in the outer G quadruplex to react with heme to form a G quadruplex/heme mimic enzyme with catalase activity in combination with catalase activity.

In one embodiment, the method is an absolute quantitative method, further comprising: establishing a standard curve of catalase activity (or an index which is correlated with the catalase activity, such as an absorbance value of a solution at a wavelength of 420nm after ABTS + is generated by catalyzing hydrogen peroxide oxidation ABTS) and biomass of Rhizopus oryzae; and when a sample to be detected is detected, substituting the detected catalase activity into the standard curve to obtain the biomass of the Rhizopus oryzae in the sample to be detected.

In one embodiment, the method is a relative quantification method, further comprising: a plurality of samples were examined, and the relative amount of the biomass of Rhizopus oryzae in the plurality of samples was determined based on the relative ratio of the catalase activities measured in the different samples.

In one embodiment, the sample to be tested is a sample containing bacteria, genome, metagenome, or the like. Optionally, the sample to be detected is a finished fermented food product or a sample obtained in a fermentation process of fermented food; optionally, the sample to be tested is subjected to pretreatment such as centrifugation and collection of bacteria, and then subsequent measurement is performed. Preferably, the cells in the sample are collected and subjected to DNA melting directly without genome extraction.

In one embodiment, the sample is a food product or a sample taken from a food production process or an environmental sample.

In one embodiment, the food product is any one or more of: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverages, alcoholic drinks, yogurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd, fermented rice and flour food, preserved fruits, aquatic products, beverages, candies, biscuits, instant noodles and the like; the environmental sample is selected from intestinal tract, soil, water body and the like.

In one embodiment, the melting of the DNA in the sample to be tested is performed at a high temperature. Optionally, the sample to be tested is treated at a temperature above 90 ℃. Can be any one of metal bath, water bath, oven, heat preservation instrument and the like which can provide the environment with corresponding temperature.

In one embodiment, the melting is performed in a buffer. Alternatively, the buffer may be Tris-HCl buffer and further contain KCl、NH₄Any one or more of Cl and NaCl. Optionally, the buffer is Tris-HCl, KCl, pH 7.9.

In one embodiment, the excess is an amount that is greater than the amount of signaling probe required to form a duplex with all of the target nucleotide fragments of the sample to be tested. The specific amount can be determined by one skilled in the art by combining with common knowledge in the art or a specific sample to be tested, or by pre-experiment.

In one embodiment, the excess is in excess of 10¹⁰Copies of the signal probe.

In one embodiment, the binding of the signaling probe to the target nucleotide fragment of the sample to be tested to form a duplex is performed at a temperature in the range of 50-60 ℃.

In one embodiment, the sufficient amount is an amount of quenching probe that is required to form a double strand with all unbound signaling probes. The specific amount can be determined by one skilled in the art by combining with common knowledge in the art or by a specific sample to be tested, or by preliminary experiments.

In one embodiment, the sufficient amount is a double amount of signaling probe.

In one embodiment, the addition of a sufficient amount of quenching probe to form a duplex with the unbound signaling probe is at a temperature such that the quenching probe forms a duplex with the unbound signaling probe; one skilled in the art can determine or determine the specific sample to be tested in combination with common knowledge in the art.

In one embodiment, the step of using the naked-leakage-outside G quadruplex to react with heme to form G quadruplex/heme mimic enzyme with catalase activity and the characterization of the biomass of Rhizopus oryzae in combination with the catalase activity means adding ABTS and H after heme reaction in the system₂O₂The catalase activity was then characterized by the absorbance of the reaction.

In one embodiment, the absorbance is at a wavelength of 420 nm.

In one embodiment, the quantification method is, in particular:

(1) carrying out DNA unzipping treatment on a sample to be detected;

(2) adding a signal probe, and reacting at 55 ℃ for 30 min;

(3) adding a quenching probe, and reacting at 55 ℃ for 30 min;

(4) adding heme, and reacting at 37 deg.C for 30 min;

(5) adding 2, 2-azino-bis- (3-ethylbenzodihydropyrazoline-6-sulfonic acid) diammonium salt (ABTS) and H₂O₂Reacting at 37 ℃ for 30 min;

(6) detecting the light absorption value of the reactant at the wavelength of 420 nm;

(7) rhizopus oryzae was quantified in the sample in combination with absorbance.

In one embodiment, the quantification method further comprises: preparing samples with different known Rhizopus oryzae contents, and measuring the light absorption values of the different samples after the different samples are treated by the method; drawing a standard curve of the light absorption value and different Rhizopus oryzae contents; substituting the light absorption value obtained after the sample to be detected is processed by the method into the standard curve to obtain the Rhizopus oryzae content in the sample to be detected.

The third purpose of the invention is to provide a detection kit for absolute quantification of Rhizopus oryzae, which contains the primer pair of the invention or a signal probe with the sequence shown as SEQ ID NO. 1.

In one embodiment, the detection kit further comprises a quenching probe with a sequence shown in SEQ ID NO. 2.

In one embodiment, the test kit further comprises any one or more of: heme, buffer solution, 2-azino-bis- (3-ethylbenzodihydropyrazoline-6-sulfonic acid) diammonium salt (ABTS), and H₂O₂. These reagents may not be contained, and an operator may prepare the reagent kit separately when the reagent kit is used.

In one embodiment, in the detection kit, the buffer solution can be Tris-HCl buffer solution, and also contains KCl and NH₄Any one or more of Cl and NaCl. Optionally, the slowingThe washing solution is Tris-HCl, KCl, and the pH value is 7.9.

In one embodiment, the detection kit is a Rhizopus oryzae absolute quantification kit comprising four reagents (reagent 1, reagent 2, reagent 3, reagent 4) and a set of Rhizopus oryzae quantification probes (signaling probe, quenching probe); the reagent 1 comprises heme; the reagent 2 comprises a buffer solution (Tris-HCl, KCl, pH 7.9; wherein KCl can be replaced by NH)₄Cl, NaCl); the reagent 3 comprises 2, 2-azino-bis- (3-ethylbenzodihydropyrazoline-6-sulfonic acid) diammonium salt (ABTS); the reagent 4 comprises H₂O₂。

In one embodiment, the reagent or probe in the test kit may be in a liquid state or a solid state, and may be adjusted to a suitable concentration by those skilled in the art in use.

The fourth purpose of the invention is to provide a using method of the kit.

In one embodiment, the method of use comprises: adding excessive signal probes into a sample to be detected after the DNA is unzipped, and reacting for a period of time to enable the signal probes to be combined with target fragments in the sample to be detected; then adding a sufficient amount of quenching probe to form a double strand with the unbound signaling probe; adding heme, reacting for a while, adding ABTS and H₂O₂Reacting for a period of time, detecting the absorbance of the reactant, and quantifying Rhizopus oryzae in the sample by combining the absorbance.

In one embodiment, the method comprises adjusting the reagents and probes to concentrations suitable for use.

(1) Carrying out DNA unzipping treatment on a sample to be detected; (2) adding a signal probe, and reacting at 55 ℃ for 30 min; (3) adding a quenching probe, and reacting at 55 ℃ for 30 min; (4) adding heme, and reacting at 37 deg.C for 30 min; (5) adding 2, 2-azino-bis- (3-ethylbenzodihydropyrazoline-6-sulfonic acid) diammonium salt (ABTS) and H₂O₂Reacting at 37 ℃ for 30 min; (6) detecting the light absorption value of the reactant at the wavelength of 420 nm; (7) rhizopus oryzae was quantified in the sample in combination with absorbance.

The fifth purpose of the invention is to provide the application of the kit in Rhizopus oryzae quantification.

In one embodiment, the application is for the food technology field or the environmental field; optionally, the food is any one or more of the following: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverages, alcoholic drinks, yogurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd, fermented rice and flour food, preserved fruits, aquatic products, beverages, candies, biscuits, instant noodles and the like; the environmental sample is selected from intestinal tract, soil, water body, etc.

In one embodiment, the sample to be tested may be a sample containing bacteria, genome, metagenome, or the like. Optionally, the sample to be detected is a food finished product or a sample taken from a food production process or an environmental sample; optionally, the sample to be tested is subjected to pretreatment such as centrifugation and collection of bacteria, and then subsequent measurement is performed. Preferably, the cells in the sample are collected and subjected to DNA melting directly without genome extraction.

Has the advantages that:

the invention combines the G quadruplex with a specific sequence to form a signal probe, the signal probe is combined with a target sequence to ensure that the G quadruplex is barely leaked outside the sequence, a sufficient amount of quenching probe is added to form a double chain with an unreacted signal probe, the structure of the G quadruplex is damaged, a G quadruplex/heme mimic enzyme is formed by reaction with heme, catalase activity is shown, and the biomass of microorganisms is represented by the catalase activity. The Rhizopus oryzae quantitative probe can realize the total amount detection of the Rhizopus oryzae; further, the signal probe is optimized, and the sequence of the signal probe is

GGGTGGGTGGGTGGGTAAGGCATAAAACTCTTCC (SEQ ID NO.1), and the quenching probe is

GGAAGAGTTTTATGCCTTACCCA (SEQ ID NO. 2). Compared with the signal sequence of SEQ ID NO.3, the G quadruplex sequence in the signal probe of SEQ ID NO.1 does not generate an additional spatial structure with a specific sequence (FIG. 1), the detection accuracy is higher, and the minimum detection limit is improved.

When the probe is used for detection and Rhizopus oryzae quantification, the detection process of expensive instruments is not needed. The kit for absolutely quantifying the microorganisms is also provided for the first time, and the quantification work can be completed within 2.5 hours. The invention aims to avoid using high-cost equipment such as a PCR instrument and realize the quantification of microorganisms by combining a signal probe and a quenching probe. The invention solves the problem that the prior microorganism quantitative means all depend on expensive instruments and are very limited in the practical application process.

Furthermore, the rapid Rhizopus oryzae detection method can realize rapid Rhizopus oryzae detection, and a sample does not need to be subjected to nucleic acid extraction, and only needs to be eluted into a buffer solution for directly carrying out subsequent experiments. Meanwhile, compared with the fluorescent quantitative PCR quantitative result, the quantitative result obtained by the method has no significant difference.

In conclusion, the probe and the detection kit provided by the invention are used for Rhizopus oryzae quantification, and have the characteristics of rapidness, cheapness and accuracy.

Drawings

FIG. 1: a dimeric structure of a signaling probe. (A) The G quadruplex sequence of SEQ ID No.1 does not form a loop with the specific sequence; (B) the reported G quadruplex sequence of SEQ ID NO.3 is used for microbial quantification.

FIG. 2: specificity of Rhizopus oryzae Probe.

FIG. 3: standard curve for genomic extracted Rhizopus oryzae quantitative probes.

FIG. 4: standard curve based on Rhizopus oryzae quantitative probe without sample genome extraction.

FIG. 5: qPCR standard curve.

FIG. 6: comparing the Rhizopus oryzae probe quantification experiment based on genome extraction, the Rhizopus oryzae probe quantification experiment based on not extracting sample genome and the qPCR Rhizopus oryzae quantification experiment; wherein, (A) is based on the Rhizopus oryzae probe quantitative experiment without extracting the sample genome, (B) is based on the Rhizopus oryzae probe quantitative experiment with extracting the genome, and (C) is based on the quantitative experiment of the Rhizopus oryzae by qPCR.

FIG. 7: the stability of the results of the detection based on the probe (A) of SEQ ID NO.1/SEQ ID NO.2 and the probe (B) of SEQ ID NO.3/SEQ ID NO.4 is compared.

The specific implementation mode is as follows:

example 1: screening of Rhizopus oryzae-specific fragment based on conserved house keeping gene

In order to develop specific fragments with high interspecific specificity and intraspecies coverage, specific fragments including 26S, ITS and 18S are selected from marker gene sequences with high coverage, and the results of homologous alignment are shown in Table 1, so that the similarity of Rhizopus oryzae and housekeeping genes of other species of Rhizopus is extremely high (the similarity is higher than 99 percent), and the screening of the specific fragments cannot be realized.

TABLE 1 interspecies similarity of Rhizopus oryzae housekeeping genes to other species

Example 2: screening of Rhizopus oryzae-specific fragments based on comparative genomics

(1) Screening for specific genes

98 of the Rhizopus genomic information included in NCBI was collected, 5 species including Rhizopus oryzae. 10,608 Rhizopus oryzae-specific genes were obtained by gene prediction and similarity homology clustering.

(2) Screening of specific gene interspecies specificity and intraspecies coverage fragment

10,102 pairs of specific primers were designed from 10,608 specific genes. The specificity and coverage of 10,102 pairs of specific primers were calculated and screened, respectively. Through a large amount of screening, the specific primer with the highest coverage degree in Rhizopus oryzae species is finally obtained, as shown in Table 2, the specificity and the coverage degree are both 100%, and the primer sequence (SEQ ID NO.5 and SEQ ID NO.6) can be used as a specific fragment of Rhizopus oryzae and is used for constructing a signal probe reagent and a quenching probe.

TABLE 2 Rhizopus oryzae specific primer information

Example 3: rhizopus oryzae quantitative probe combined reagent

A probe combination reagent; comprises a signaling probe reagent and a quenching probe reagent which are packaged separately; wherein, the sequence of the signal probe is shown as SEQ ID NO.1, and the sequence of the quenching probe is shown as SEQ ID NO. 2.

The signal probe reagent and the quenching probe reagent are in a dry powder or liquid state; in the case of dry powder, it may be diluted to an appropriate concentration prior to the experiment, for example, to a concentration of 20. mu.M using sterile water or buffer; in the case of liquid, the concentration may be 20 to 200. mu.M, and the reagent may be diluted before use or may be used as it is.

Example 4: rhizopus oryzae quantification kit and use thereof

A Rhizopus oryzae quantification kit comprising separately packaged signaling probe reagent and quenching probe reagent; wherein, the sequence of the signal probe is shown as SEQ ID NO.1, and the sequence of the quenching probe is shown as SEQ ID NO. 2.

When the kit is used, the kit can be mixed with heme, buffer solution, 2-azino-bis- (3-ethylbenzodihydro-thiazoline-6-sulfonic acid) diammonium salt (ABTS), and H₂O₂Can be used in combination.

The using method comprises the following steps:

(1) and (4) solution preparation. Prepare 100nM heme solution (reagent 1); Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and a final pH of 7.9 (reagent 2); 7mM of 2, 2-azino-bis- (3-ethylbenzodithiazoline-6-sulfonic acid) diammonium salt (ABTS) (reagent 3) and 7mM of H₂O₂Solution (reagent 4); the solvent is sterile water.

(2) The signal probe forms a double strand with the sample DNA. To 2mL of

reagent

2, 4. mu.L of the sample genomic DNA was added, and the mixture was treated with a water bath at 90 ℃ for 10 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(3) The quenching probe forms a double strand with the unbound signaling probe. The quenching probe forms a double chain with the unbound signal probe, and the G quadruplex structure is damaged. To the system after the reaction in step (4), 8. mu.L of 20. mu.M quenching probe was added and the reaction was carried out at 55 ℃ for 30 min.

(4) Forming a heme/G quadruplex structure. To the system after the reaction in step (5), a reagent 1 was added to a final concentration of 100nM and treated at 37 ℃ for 30 min.

(5) And (4) color reaction. To the reaction-terminated system of (4), a reagent (ABTS) having a final concentration of 7mM and a reagent 4 having a final concentration of 7mM were added, and the mixture was treated at 37 ℃ for 30min to effect a revealing reaction (green).

Detecting the light absorption value of the reactant at the wavelength of 420 nm; rhizopus oryzae was quantified in the sample in combination with absorbance.

Of course, when absolute quantification is performed, a standard curve of absorbance and Rhizopus oryzae biomass may be automatically plotted, or directly converted to Rhizopus oryzae biomass according to the recommended method of use of the kit and the standard curve.

Example 5: rhizopus oryzae quantitative kit

The kit further comprises 100nM heme solution (reagent 1), Tris-HCl buffer, 7mM 2, 2-azino-bis- (3-ethylbenzodihydrophthaloline-6-sulfonic acid) diammonium salt (ABTS), and 7mM H₂O₂And (3) solution.

Example 6: specificity of Rhizopus oryzae quantitation kit

(1) Rhizopus oryzae derived from fermented cereals was selected as a positive control, 36 microorganisms of bacterial species and 6 microorganisms of fungal species widely present in fermented food samples were selected as negative controls, and the bacterial microorganisms were Lactobacillus buchneri, Lactobacillus diovorans, Lactobacillus brevis, Lactobacillus crustorum, Lactobacillus plantarum, Lactobacillus acidophilus, Pediococcus Acetobacter, Pediococcus pectobacterium, Lactobacillus sanus, Lactobacillus sanctus, Lactobacillus curvatus, Lactobacillus casei, Lactobacillus reuteri, Lactobacillus acidophilus, Lactobacillus strain, Lactobacillus, Bacillus strain, Lactobacillus strain, Lestrain, Lactobacillus strain, Lestrain, Bacillus strain, Lestrain, strain, Bacillus strain, strain, strain, strain, strain, strain, strain, strain, strain, strain. The fungal microorganisms are Saccharomyces cerevisiae, Mucor rouxianus, Schizosaccharomyces pombe, Zygosaccharomyces bailii, Pichia kudriavzevii, Saccharomyces fibuligera, respectively.

(2) The above microorganisms were cultured by selecting different media, wherein Lactobacillus buchneri, Lactobacillus dioillorans, Lactobacillus brevis, Lactobacillus crustorum, Lactobacillus plantarum, Lactobacillus harbinensis, Lactobacillus acidophilus, Pediococcus ethanolidus, Pediococcus acidilactici, Pediococcus pendaces, Lactobacillus sartorius, Lactobacillus murinus, Lactobacillus curvatus, Lactobacillus casei, Lactobacillus reuteri, Lactobacillus panis, Lactobacillus fermentum, Lactobacillus johnsonii, Lactobacillus buckii, Lactobacillus brevis, Lactobacillus plantarum, Lactobacillus jessi, Lactobacillus plantarum, Lactobacillus strain L8, Lactobacillus L8, L8₂HPO₄2.5g/L, 6.0g/L of sodium acetate trihydrate, 2.0g/L of ammonium citrate tribasic, MgSO₄·7H₂O 0.3g/L，MnSO₄·4H₂O is 0.08 g/L. The culture conditions were 30 ℃ for 48 h. Enterococcus italicus, Enterococcus lactis, Enterococcus faecalis, Bacillus coagulons, Bacillus licheniformis, Bacillus tequilensis, Bacillus subtilis, Bacillus velezensis, Acetobacter passaturinus, Enterococcus faecalis using LB medium with a formulation of peptone 10.0g/L5g/L of yeast powder and 10g/L of sodium chloride. The culture conditions were 37 ℃ for 24 h. Rhizopus oryzae, Mucor rouxianus, Schizosaccharomyces pombe, Zygosaccharomyces bailii, Pichia kudriavzevii, Saccharomyces fibuligera, Saccharomyces cerevisiae, YPD medium was used, and yeast extract was 10g/L, peptone was 20g/L, and glucose was 20 g/L. The culture conditions were: the mold is cultured for 5 days at 30 ℃, and the yeast is cultured for 2 days at 30 ℃.

(3) Extracting the genome of a single bacterium. The bacterial liquid is treated for 2min under the condition of 12000rpm, and precipitates are collected. The genomes of the pure cultures of 43 microorganisms were extracted using the DNeasy Tissue Kit.

(4) The probe is selected from Rhizopus oryzae specific probe, and the sequence of the signal probe is

GGGTGGGTGGGTGGGTAAGGCATAAAACTCTTCC (SEQ ID NO.1), and the sequence of the quenching probe is GGAAGAGTTTTATGCCTTACCCA (SEQ ID NO. 2).

(5) The signal probe forms a double strand with the sample DNA. To 2mL of each of the reagents 2 (including Tris-HCl of 50mM final concentration, KCl of 50mM final concentration, final pH 7.9) was added 4. mu.L of genomic DNA of different microorganisms, and treated in a water bath at 90 ℃ for 10 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(6) The quenching probe forms a double chain with the unbound signal probe, and the G quadruplex structure is damaged. To the system after the reaction in step (5), 8. mu.L of 20. mu.M quenching probe was added and the reaction was carried out at 55 ℃ for 30 min.

(7) Forming a heme/G quadruplex structure. To the system after the reaction in step (6), reagent 1 (heme) was added to a final concentration of 100nM and treated at 37 ℃ for 30 min.

(8) And (4) color reaction. To the reaction-terminated system of (7), reagent 3(ABTS) was added at a final concentration of 7mM, and reagent 4 (H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. As shown in FIG. 2, the results show that the group to which the Rhizopus oryzae genome was added developed, and the group to which the non-Rhizopus oryzae was added and the blank control group did not develop a color reaction, which confirmed that the kit detects the specificity of the Rhizopus oryzae.

Example 7: quantitative method accuracy assessment

(1) The Rhizopus oryzae solution was obtained according to the culture method in example 6, the microbial concentration was measured by plate counting method, and the genome was extracted as in example 6.

(2) The Rhizopus oryzae genomic DNA was diluted by a 10-fold gradient.

(3) The chromogenic reaction was carried out with different concentrations of Rhizopus oryzae genomic DNA using a probe for Rhizopus oryzae. The sequence of the signaling probe is GGGTGGGTGGGTGGGTAAGGCATAAAACTCTTCC (SEQ ID NO.1), and the sequence of the quenching probe is GGAAGAGTTTTATGCCTTACCCA (SEQ ID NO. 2).

(4) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, final pH 7.9) was added 4. mu.L of genomic DNA at different dilutions (blank control without sample DNA). Treating with water bath at 90 deg.C for 10 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(5) The quenching probe forms a double chain with the unbound signal probe, and the G quadruplex structure is damaged. To the system after the reaction in step (4), 8. mu.L of 20. mu.M quenching probe was added and the reaction was carried out at 55 ℃ for 30 min.

(6) Forming a heme/G quadruplex structure. To the system after the reaction in step (5), reagent 1 (heme) was added at a final concentration of 100nM and treated at 37 ℃ for 30 min.

(7) And (4) color reaction. To the reaction-terminated system of (6), reagent 3(ABTS) was added at a final concentration of 7mM, and reagent 4 (H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance at a wavelength of 420nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank.

(8) A standard curve is constructed by calculating the linear relationship between the absorbance and the concentration of the bacteria liquid, as shown in FIG. 3, R²0.99(x is log10 CFU/mL, y is OD₄₂₀Linear range of 10³～10⁷). The accuracy of the quantitative method of the kit provided by the invention is proved.

Example 8: quantitative assay for Rhizopus oryzae in wine samples

(1) Reference is made to the Materials and methods of Gayevsky, V., & Goddard, M. (2012), GeogrAN _ SNhic deletions of yeast communities and publications associated with videos and with in New Zealand. ISME J,6(7),1281 and 1290, samples were collected from a known wine manufacturer at the Shandong tobacco station. The genome concentration was 658.39 ng/. mu.L. (2) The chromogenic reaction was carried out using a probe of Rhizopus oryzae. The sequence of the signal probe is

(4) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, final pH 7.9) was added 4. mu.L of sample metagenomic DNA (blank control without sample DNA). Treating with water bath at 90 deg.C for 10 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(6) Forming a heme/G quadruplex structure. To the system after the reaction in step (5), reagent 1 (heme) was added to a final concentration of 100nM and treated at 37 ℃ for 30 min.

(7) And (4) color reaction. To the reaction-terminated system of (6), reagent 3(ABTS) was added at a final concentration of 7mM and reagent 4(7mM H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance at a wavelength of 420nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0 as a blank control using the test group without the sample DNA.

(8) According to the standard curve obtained in example 7, the total quantity of Rhizopus oryzae in the sample was calculated to be 0log₁₀CFU/mL. (9) The total amount of Rhizopus oryzae in the same sample was quantified by the fluorescent quantitative PCR method (the quantification step and materials were the same as those in example 13(6)), and the results showed that the total amount of Rhizopus oryzae was 0log₁₀CFU/mL, consistent with the quantitative results determined by the methods described above.

Example 9: absolute quantification of Rhizopus oryzae in fermented grain samples

(1) Reference is made to Song Z W, Du H, Zhang Y, Xu Y. innovative core functional microbiological in a catalytic solid-state compensation by high-throughput amplification and formatting strategies in microbiology 2017; 8:1294, extracting metagenome from fermented grains samples from Shandong province, wherein the genome concentration is 100.02 ng/mu L.

(2) The chromogenic reaction was carried out using a probe of Rhizopus oryzae. The sequence of the signal probe is

(3) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (containing Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH 7.9), 4. mu.L of fermented grain metagenomic DNA was added (blank control without sample DNA). Treating with water bath at 90 deg.C for 10 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(4) The quenching probe forms a double chain with the unbound signal probe, and the G quadruplex structure is damaged. To the system after the reaction in step (3), 8. mu.L of 20. mu.M quenching probe was added and the reaction was carried out at 55 ℃ for 30 min.

(5) Forming a heme/G quadruplex structure. To the system after the reaction in step (4), reagent 1 (heme) was added to a final concentration of 100nM, and treated at 37 ℃ for 30 min.

(6) And (4) color reaction. To the reaction-terminated system of (5), reagent 3(ABTS) was added at a final concentration of 7mM, and reagent 4 (H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance at a wavelength of 420nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0.413 as a blank control with the test group without sample DNA added.

(7) The total microbial count of Rhizopus oryzae in the sample was calculated to be 5.32log according to the standard curve obtained in example 7₁₀CFU/mL。

(8) The amount of Rhizopus oryzae in the same fermented grain sample was determined by a fluorometric method (the same procedure and materials as in example 13 and 6),the results showed that the total microbial count of Rhizopus oryzae was 5.41log₁₀CFU/mL was substantially identical to the quantitative results measured by the above-described method (coefficient of variation, CV ═ 0.01).

Example 10: rhizopus oryzae absolute quantification method based on non-extracted sample genome

(1) The Rhizopus oryzae solution was obtained according to the culture method in example 4, and the microbial concentration was measured by plate counting.

(2) The Rhizopus oryzae solution of (1) was diluted by a 10-fold gradient

(3) The chromogenic reaction was carried out using a probe of Rhizopus oryzae. The sequence of the signal probe is

(4) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (containing 50mM Tris-HCl, 50mM KCl, and 7.9 final pH) was added 10. mu.L of each of the dilutions (blank samples without addition of the sample). Treating in boiling water bath for 20 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(8) A standard curve is constructed by calculating the linear relationship between the absorbance and the concentration of the bacteria liquid, as shown in FIG. 4, R²0.99(x is log10 CFU/mL, y is OD₄₂₀Linear range of 10³～10⁷). The accuracy of the quantitative method of the kit provided by the invention is proved

Example 11: method for determining content of Rhizopus oryzae in wine sample based on absolute quantification method of microorganisms without extracting sample genome

(1) The sample is collected from a certain famous grape wine manufacturer of Shandong tobacco Taiwan, and the sample treatment method comprises the following steps: 5mL of phosphate buffer was added to 1mL of the sample, and the mixture was centrifuged at 3000 Xg for 10min to collect the cells.

(2) And (6) washing. 5mL of phosphate buffer was added to the cells obtained in (1), and the cells were collected by centrifugation at 12000 Xg for 2min and repeated once.

(3) Resuspend the cells, add 1mL of reagent 2 (containing 50mM Tris-HCl, 50mM KCl, final pH 7.9) to the cells obtained in (2), aspirate and mix well.

(4) The chromogenic reaction was carried out using a probe of Rhizopus oryzae. The sequence of the signal probe is

(5) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (containing 50mM Tris-HCl, 50mM KCl, and 7.9 final pH), 10. mu.L of the fermented grape liquid (blank control without addition of this liquid) was added. Treating in boiling water bath for 20 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(7) Forming a heme/G quadruplex structure. To the system after the reaction in step (6), reagent 1 (heme) was added at a final concentration of 100nM and treated at 37 ℃ for 30 min.

(8) And (4) color reaction. To the reaction-terminated system of (7), reagent 3(ABTS) was added at a final concentration of 7mM, and reagent 4 (H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. Measuring the absorbance at 420nm with an ultraviolet spectrophotometer without addingThe experimental group of sample DNA served as a blank and showed an absorbance of 0.

(9) According to the standard curve obtained in example 10, the total quantity of Rhizopus oryzae in the sample was calculated to be 0log₁₀CFU/mL。

(10) The Rhizopus oryzae in the same sample was quantified by fluorescent quantitative PCR (the quantification step and materials were the same as those in example 13(6)), and the results showed that the total amount of Rhizopus oryzae was 0log₁₀CFU/mL, consistent with the quantitative results determined by the methods described above.

Example 12: the content of Rhizopus oryzae in the fermented grain sample is determined based on an absolute quantitative method for not extracting a sample genome (1), the sample is from fermented grains of a certain brewery in Shandong, and a sample treatment method comprises the following steps: 5mL of phosphate buffer was added to 1g of the sample, and the mixture was centrifuged at 3000 Xg for 10min to collect the cells.

(5) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (containing 50mM Tris-HCl, 50mM KCl, and 7.9 final pH), 10. mu.L of fermented grain suspension was added (blank control without addition of this suspension). Treating in boiling water bath for 20 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(8) And (4) color reaction. To the reaction-terminated system of (7), reagent 3(ABTS) was added at a final concentration of 7mM, and reagent 4 (H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance at a wavelength of 420nm was measured using an ultraviolet spectrophotometer, and the absorbance was 0.411 as a blank control with the test group without sample DNA added.

(9) Based on the standard curve obtained in example 10, the total quantity of Rhizopus oryzae in the sample was calculated to be 5.39log₁₀ CFU/mL，

(10) The Rhizopus oryzae in the same sample was quantified by fluorescent quantitative PCR (the quantification step and materials were the same as those in example 13(6)), and the total amount of the Rhizopus oryzae was 5.41log₁₀CFU/mL was substantially identical to the two sets of data measured by the above method (coefficient of variation, CV 0.004).

Example 13: comparison of results of quantitative detection kit and fluorescent quantitative PCR (polymerase chain reaction) detection for microorganisms

(1) The sample is three fermented white spirit samples from the fermentation end point of a certain brewery in Shandong.

(2) Sample treatment:

(i) total genome concentrations of 369 ng/. mu.L, 590 ng/. mu.L and 321.89 ng/. mu.L were extracted from the three samples.

(ii) 5mL of phosphate buffer was added to 1g of the sample, and the mixture was centrifuged at 3000 Xg for 10min to collect the cells. To the obtained cells, 5mL of phosphate buffer was added, and the cells were collected by centrifugation at 12000 Xg for 2min and repeated once. Resuspend the cells, add 1mL of reagent 2 buffer to the obtained cells, aspirate and mix them well.

(4) The quantitative method is determined based on a kit without extracting genome.

(i) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (containing 50mM Tris-HCl, 50mM KCl, and 7.9 final pH), 10. mu.L of fermented grain suspension was added (blank control without addition of this suspension). Treating in boiling water bath for 20 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(ii) The quenching probe forms a double chain with the unbound signal probe, and the G quadruplex structure is damaged. To the system after the reaction in step (i), 8. mu.L of 20. mu.M quenching probe was added and the reaction was carried out at 55 ℃ for 30 min.

(iii) Forming a heme/G quadruplex structure. To the system after the reaction in step (ii), reagent 1 (heme) was added at a final concentration of 100mM, and the mixture was treated at 37 ℃ for 30 min.

(iv) And (4) color reaction. (iv) to the reaction-terminated system of (iii), reagent 3(ABTS) was added at a final concentration of 7mM, and reagent 4 (H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance values at a wavelength of 420nm were measured using an ultraviolet spectrophotometer, and the blank control was performed using the test group without the sample DNA, showing absorbance values of 0.435, 0.442, 0.433.

(v) The total quantity of Rhizopus oryzae in the sample was calculated to be 5.64. + -. 0.047log according to the standard curve obtained in example 8₁₀CFU/mL。

(5) Kit quantitative method determination based on genome extraction

(i) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (containing Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, and final pH 7.9), 4. mu.L of fermented grain metagenomic DNA was added (blank control without sample DNA). Treating with water bath at 90 deg.C for 10 min. After addition of 4. mu.L of 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(iii) Forming a heme/G quadruplex structure. To the system after the reaction in step (ii), reagent 1 (heme) was added at a final concentration of 100nM and treated at 37 ℃ for 30 min.

(iv) And (4) color reaction. To the reaction-terminated system of (5), reagent 3(ABTS) was added at a final concentration of 7mM andreagent 4 (H) at 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance values at a wavelength of 420nm were measured using an ultraviolet spectrophotometer, and the blank control was an experimental group without sample DNA, showing absorbance values of 0.425, 0.445, 0.432.

(v) The total quantity of Rhizopus oryzae in the sample was calculated to be 5.54. + -. 0.10log according to the standard curve obtained in example 5₁₀CFU/mL。

(6) qPCR quantitative determination of Rhizopus oryzae content in sample (i) Rhizopus oryzae solution obtained according to the culture method in example 6, microbial concentration was measured by plate count method, and genome extraction was performed as in example 6.

(ii) The Rhizopus oryzae genomic DNA was diluted by a 10-fold gradient.

(iii) The qPCR system was SYBR Green 10. mu.L, upstream and downstream primers 20. mu.M, template DNA 0.5. mu.L, and sterile water supplemented 20. mu.L.

(iv) Reaction procedure for qPCR: pre-denaturation 95 ℃ for 5min, cycle phase: 5s at 95 ℃ and 20s at 60 ℃; the number of cycles was 40, the dissolution curve was raised from 65 ℃ to 95 ℃ by 0.5 ℃ every 5 s.

(v) The extracted genome was subjected to qPCR using Rhizopus oryzae specific primers with upstream sequence of AAGGCATAAAACTCTTCC (SEQ ID No.5) and downstream sequence of TTGCAAGCTATTTGCATTTTT (SEQ ID No. 6).

(vi) A standard curve of CT values versus Rhizopus oryzae concentrations was established by 10-fold gradient dilution of genomic DNA, as shown in FIG. 4, R²＝0.99。

(vii) The qPCR system and reaction conditions were as in (iii), (iv). From the CT value at the end of the reaction, the concentration of Rhizopus oryzae in the sample was calculated to be 5.42. + -. 0.12log by the established standard curve₁₀ CFU/g。

(7) By significant difference analysis, the results are shown in FIG. 6, there is no significant difference between the three quantitative methods (P <0.05)

Example 14: detection limit for detection by using two different sequence signal probes

(1) The Rhizopus oryzae solution was obtained according to the cultivation method of example 4, and the concentration of microorganisms was measured by plate counting method, and the genome was extracted at 7.49log10 CFU/mL in the same manner as in example 4.

(2) Rhizopus oryzae genomic DNA was diluted by a 10-fold gradient to give a DNA template of log10 CFU/mL.

(3) The sequence of the Rhizopus oryzae signal probe provided by the invention is

GGGTGGGTGGGTGGGTAAGGCATAAAACTCTTCC (SEQ ID NO.1), and the sequence of the quenching probe is GGAAGAGTTTTATGCCTTACCCA (SEQ ID NO. 2). Adding the 3.2log obtained in (2)₁₀CFU/mL Rhizopus oryzae genomic DNA was subjected to a color reaction.

(4) The Rhizopus oryzae signal probe sequence was (SEQ ID NO.3) GGGATTGGGATTGGGATTGGGAAGGCATAAAACTCTTCC and the quench probe sequence was GGAAGAGTTTTATGCCTTCCCAA (SEQ ID NO. 4). The genomic DNA of Rhizopuscrosyzae obtained in (2) was added at log10 CFU/mL to conduct a color development reaction.

(5) The signal probe forms a double strand with the sample DNA. To 2mL of reagent 2 (including Tris-HCl at a final concentration of 50mM, KCl at a final concentration of 50mM, final pH 7.9), 4. mu.L of Rhizopus oryzae genomic DNA (blank control without sample DNA) was added. Treating with water bath at 90 deg.C for 10 min. After adding 4. mu.L of each 20. mu.M signal probe, the reaction was carried out at 55 ℃ for 30 min.

(6) The quenching probe forms a double chain with the unbound signal probe, and the G quadruplex structure is damaged. To the system after the reaction in step (5), 8. mu.L of 20. mu.M quenching probes were added, and the reaction was carried out at 55 ℃ for 30 min.

(8) And (4) color reaction. To the reaction-terminated system of (7), reagent 3(ABTS) was added at a final concentration of 7mM and reagent 4 (H) was added at a final concentration of 7mM₂O₂) And treating at 37 ℃ for 30 min. The absorbance at a wavelength of 420nm was measured using an ultraviolet spectrophotometer, and the experimental group without sample DNA was used as a blank.

(9) Repeating the steps (5), (6), (7) and (8) 9 times, and comparing the stability of the detection results, as shown in fig. 7. The Coefficient of Variation (CV) based on the quantitative results of the signal sequence of SEQ ID NO.3 was 0.87; the coefficient of variation of the quantitative result based on the signal sequence of SEQ ID NO.1 is 0.07, and the detection effect is stable.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> primer, probe and kit for absolute quantification of Rhizopus oryzae

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 34

<212> DNA

<213> Artificial Synthesis

<400> 1

gggtgggtgg gtgggtaagg cataaaactc ttcc 34

<210> 2

<211> 23

<212> DNA

<213> Artificial Synthesis

<400> 2

ggaagagttt tatgccttac cca 23

<210> 3

<211> 39

<212> DNA

<213> Artificial Synthesis

<400> 3

gggattggga ttgggattgg gaaggcataa aactcttcc 39

<210> 4

<211> 23

<212> DNA

<213> Artificial Synthesis

<400> 4

ggaagagttt tatgccttcc caa 23

<210> 5

<211> 18

<212> DNA

<213> Artificial Synthesis

<400> 5

aaggcataaa actcttcc 18

<210> 6

<211> 21

<212> DNA

<213> Artificial Synthesis

<400> 6

ttgcaagcta tttgcatttt t 21

Claims

1. The primer pair is characterized in that the sequences of the primer pair comprise a sequence shown as SEQ ID NO.5 and a sequence shown as SEQ ID NO. 6.

2. A set of probes, comprising a signaling probe and a quenching probe; the signal probe sequence comprises a sequence shown in SEQ ID NO. 1; the quenching probe sequence comprises a sequence shown in SEQ ID NO. 2.

3. A detection kit comprising the primer set according to claim 1, or the signaling probe and the quenching probe according to claim 2.

4. The detection kit according to claim 3, wherein the detection kit comprises the signaling probe and the quenching probe according to claim 2, and further comprises any one or more of the following: heme, buffer solution, 2-azino-bis- (3-ethylbenzodihydropyrazoline-6-sulfonic acid) diammonium salt, and H₂O₂。

5. A method for quantifying Rhizopus oryzae, which comprises using the primer set according to claim 1, the probe according to claim 2, or the detection kit according to any one of claims 3 to 4.

6. The quantification method according to claim 5, characterized in that it comprises: melting DNA in a sample to be detected; adding an excessive signal probe, and combining with a target nucleotide fragment of a sample to be detected to form a double chain so that a G quadruplex is exposed outside a sequence; adding sufficient quenching probe to form double chains with the unbound signal probe, and destroying the G quadruplex structure; the biomass of Rhizopus oryzae was characterized by using the naked-leak in the outer G quadruplex to react with heme to form a G quadruplex/heme mimic enzyme with catalase activity in combination with catalase activity.

7. The method according to any one of claims 5 to 6, wherein the sample to be tested is a sample containing a cell, a genome, a metagenome, or the like; optionally, the sample is a food product, a fermented food product, or a sample or environmental sample taken from a fermented food product fermentation and production process.

8. The method of claim 7, wherein the food or fermented food is any one or more of: white spirit, yellow wine, soy sauce, beer, wine, table vinegar, fermented tea, traditional fermented vegetables, fermented beverages, alcoholic drinks, yogurt, cheese, fruit vinegar, fermented glutinous rice, fermented soya beans, fermented bean curd, fermented rice and flour food, preserved fruits, aquatic products, beverages, candies, biscuits and instant noodles; the environmental sample is selected from intestinal tract, soil, water body and the like.

9. The method of using the kit of claim 4, wherein the method of using comprises: adding excessive signal probes into a sample to be detected after the DNA is unzipped, and reacting for a period of time to enable the signal probes to be combined with target fragments in the sample to be detected; then adding a sufficient amount of quenching probe to form a double strand with the unbound signaling probe; adding heme, reacting for a while, adding ABTS and H₂O₂Reacting for a period of time, detecting the absorbance of the reactant, and quantifying Rhizopus oryzae in the sample by combining the absorbance.

10. A method for detecting Rhizopus oryzae content in a food or environmental sample, comprising using the primer pair of claim 1, or the probe of claim 2, or the detection kit of any one of claims 3 to 4.