CN111763252A

CN111763252A - Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm2 and coding gene and application thereof

Info

Publication number: CN111763252A
Application number: CN202010740841.1A
Authority: CN
Inventors: 吕志创; 冀顺霞; 王晓迪; 申晓娜; 刘万学; 万方浩
Original assignee: Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Priority date: 2020-07-29
Filing date: 2020-07-29
Publication date: 2020-10-13
Anticipated expiration: 2040-07-29
Also published as: CN111763252B

Abstract

The invention relates to the technical field of agricultural biology, in particular to a bemisia tabaci MED cryptic chromatin remodeling factor Btbrm2, and a coding gene and application thereof. The amino acid sequence of the remodeling factor is shown in SEQ ID No:2, respectively. The invention defines the difference of the expression modes of the Btbrm2 gene in the tobacco whitefly invasive species MED hidden species and the local species Asia II 1 hidden species at different temperatures. The reduction of the expression of the gene directly reduces the tolerance of the MED cryptic species to the adversity temperature. The obtained result lays a foundation for further researching the relationship between the temperature tolerance mechanism of the hidden species of the bemisia tabaci MED and the epigenetic chromatin remodeling, and can be used for destroying the temperature tolerance of the bemisia tabaci and further preventing and controlling the harm and the diffusion of the bemisia tabaci.

Description

Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm2 and coding gene and application thereof

Technical Field

The invention relates to the technical field of agricultural biology, in particular to a bemisia tabaci MED cryptic chromatin remodeling factor Btbrm2, and a coding gene and application thereof.

Background

Bemisia tabaci (Gennadius)) belongs to the phylum Arthropoda, Insecta, Hemiptera, Bemisia, and is an important agricultural pest worldwide. The insect host has a wide range, can damage over 600 economic crops such as leguminous crops, solanaceae crops, compositae crops, cucurbitaceae crops, malvaceae crops and cruciferae crops in a mode of taking plant juice, secreting honeydew to induce sooty mould, spreading plant viruses and the like, and is a great pest which is necessary to deal with the crop production in China. Bemisia tabaci is a complex of species containing more than 36 cryptophytes. At present, the number of the existing aleyrodids hidden species in China is 15, including 2 invasive species and 13 local species. The hidden species of the invasive species MED are widely distributed in China. The local seeds are only distributed in local areas of China, for example, the AsiaII 1 hidden seeds are mainly distributed in local areas of the south and the middle, such as the areas of Hainan, Guangdong, Guangxi, Taiwan, Guizhou, Zhejiang and the like, and have no tendency of spreading to other areas.

With the change of global temperature, the successful adaptation of the hidden species of bemisia tabaci MED under different geographic environments has widely led people to the theoretical discussion of the invasion mechanism, and the molecular mechanism of the temperature adaptability is one of the research hotspots in recent years. In the experiment of heat shock selection of Bemisia tabaci, the survival rate of the invasive species Bemisia tabaci in the 2 generations is obviously improved, and the rapid improvement of the survival capability is an important strategy for the survival of the Bemisia tabaci in the severe environment. The mechanism of response of organisms to environmental variations within this short period of time is epigenetic related. Epigenetic processes increase the organism's response to the evolutionary potential for non-temperature stress and other environmental challenges, which are highly correlated with the background of global environmental warming.

Chromatin remodelling (chromatin remodelling) is one of the current research hotspots in the field of epigenetics, driving the replacement or rearrangement of nucleosomes, altering the spatial conformation of chromatin. ATP-dependent chromatin remodeling is an important epigenetic regulation mechanism for chromatin remodeling complex to utilize energy released by ATP hydrolysis to change chromatin structure, thereby regulating eukaryotic gene expression. Chromatin remodeling plays a key role in the expression regulation of genes related to biological defense, and the chromatin remodeling factor BRM can participate in the regulation of environmental stress on the biological adversity and plays an important role in regulating the expression of genes related to abiotic stress. Its role in temperature stress of bemisia tabaci is unknown.

The phenomenon of RNA interference (RNAi) is an evolutionarily conserved defense mechanism against transgene or foreign virus invasion. Introduction of double-stranded RNA (dsRNA) having a sequence homologous to the mRNA of the transcription product of a target gene into a cell specifically degrades the mRNA, resulting in a corresponding loss of functional phenotype. RNAi is widely available in the biological world for silencing certain genes in the insect body through RNAi technology

Therefore, some abilities of the insects are enhanced or lost, and the functional gene expression of the insects can be inhibited at a specific time, so that the development of the insects is stopped at a certain stage, and the aim of utilizing or preventing the damage of the insects is fulfilled. The dsRNA is fed to the bemisia tabaci, so that the dsRNA has the characteristics of simplicity, convenience, easiness in operation and the like, and can be applied to the research of the bemisia tabaci.

Disclosure of Invention

The invention aims to provide a bemisia tabaci MED cryptic chromatin remodeling factor.

Still another object of the present invention is to provide a gene encoding the above diaphorina fumonis MED cryptic chromatin remodeling factor.

Still another object of the present invention is to provide a recombinant expression vector containing a gene encoding the above bemisia tabaci MED cryptic chromatin remodeling factor.

Still another object of the present invention is to provide a recombinant strain containing a gene encoding the above bemisia tabaci MED cryptic chromatin remodeling factor.

The invention further aims to provide application of the coding gene of the bemisia tabaci MED cryptic chromatin remodeling factor.

According to the specific embodiment of the invention, the bemisia tabaci MED recessive chromatin remodeling gene Btbrm2 is cloned for the first time, and the full-length nucleotide sequence of cDNA is shown as SEQ ID No. 1:

ATGGCAGCTCCCACTCAAGACAATCTGAATGCTTTGCAGCACGCTATAGATTCAATGGAAGAGAAAGGTATGCAAGAGGATCCTAGATATTCTCAGCTCCTCGCTATCAGAGCTCGTCAAAATAACATGGAGCCCCCTCGACTTCCTGGATCGCAAGGATTTTGCGTATCCTCTGATAGCCCATCGAATTCCAAGCAAGTTTTGAGTCCCATCCAGTTGCAACAGTTACGAGTCCAAATCATGGCATATCGAGTTCTCGCTCGGAATCAGCCGTTGCCTCATCAACTTGCAGTAGCGGTTCAAGGGAAACGAATGGACTCGTCTCTCATTCAACCGGGTCTGGGACCTCCACCTCTCATGCCTCCAACCTCCGGTGGAAACACTCCAAGCCCACAAGCACGACCCACTGATTCAAGCAATGAAAACTCATCTGGAATGAGTGCAGCTCCTGTGTACCCTGTCGCACCCCCAACTTCACCCAACGTACCCCAAGGACCTCCGCCATCTCAGTTGCCCCCAGTAACCCCACCTCCCCCACAGTCATCCTCAACGATGGCTCCACCTCCTGCTGTTCCAGCACCACCTGCTCCATCTGTTCCTGCCCCTCTCCCACCCCCTGCTCTCAATTCAACACCCCCTGCGCCCCTCATGCCTCCCATTTCAGCACCGACACCACCTGTACCCTTGCAGCCACCAGTGACGTCACACGTCCATATCGCCCCACCCATGCCTCGGCTCCCCATCACGAGTCATCCCGTCATGGTTGTCCCTCCTCCTCCTAACTCAATGCTGAAACCGATGCCCAGTCCAGTTGTTCTGCCTCCTCCGCCACCACCACCCCCCAATCCGCAGCAACTTACGCAGCAACTTCAGTTACAAAAACAGAACAGAGTTACGACTATTCCTCGTCCAACTGGGATCGACCCTATACTAATTTTACAAGAAAGAGAAAATAGAGTCGCAGCTCGCATTGCCCATCATATGGAGAAGCTCTCCAATCTTCCGTCAACAGTGTCGGATGAAATTCGCCTCAAAGCTCAGATCGAACTTCGTGCTTTGAGAATCTTGAATTTTCAACGTCAGCTCCGAAGCGAGATCATATCTTGTGCTCGCAGAGATTCAACCCTGGAAACAGCCGTCAATATGAAAGCCTACAAGCGAGTCAAAACCCAAGGATTAAAAGAATCTCGCGCGACAGAAAAGTTGGAAAAGCAGCAGAAACTGGAAGCAGAGAGGAAACGGAGACAAAAACATCAAGAATATTTGGCAGCCATCATTCAGCACGGTAAAGACTTTAAAGAATACCATCGGAATAATCAAGCGAGGATCGTCCGGTTGAATAAAGCCATGCTTAGTTACCATGTGAATGCGGAGCGGGAGCAGAAGAAAGAACAGGAGAGGATCGAAAAGGAACGAATGAGACGCCTAATGGCAGAAGATGAAGAGGGTTACAGGAAACTCATCGATCAAAAGAAAGACAAGAGACTGGCATTCTTACTGTCTCAAACTGACGAATACATCACAAACTTGACAGAAATGGTCAAACAACACAAAGTTGAACAAAAACGTAAACTTGCAGAGAAAGCGAAAGAAGACAAGAGGAAAAAGAAAGAAACTGAGGATGCGGAGCGGAGAGCTTGCGTAATGGAAATGGAAAGTGGGAAAAAATTGAAGGGAGAAGAAGCTCCCTTGATGGTGGACCTAGGCACTTGGCTGGAAGCTCATCCTGGTTGGGAAGCATGTGAGGACTCAGAGGCAGAGACTGAAGAAGAGTCTGATTCTGATTCCGATCAAAATATCGAAGAAAAAATTGAAGAAGTCAAAGAAGAGAAGAAACCAAAAGAAGAACTTGATCCGAAAGAAGTTGTTGAAAAAGCGAAAAGTGAAGACGATGAATACAAAAATACCTCCGAAGAACTTACCTACTACAGTATTGCTCACACAATCAATGAAATTGTGACAGAACAAGCCTCTATCATGGTTAATGGTAAATTAAAAGAATATCAAATCAAGGGACTTGAGTGGCTAGTCTCTCTGTACAATAATAATCTCAATGGCATCCTGGCCGATGAAATGGGTCTTGGAAAAACCATCCAAACAATCGCATTGATCACATACTTGATGGAGATGAAAAAAGTAAACGGTCCATATTTAATCATCGTACCTCTTTCCACCCTTTCAAATTGGGTGTTGGAGTTTGAAAAATGGGCCCCATCTGTAAATGTTGTTGCGTACAAAGGCTCACCAGCTGTCAGACGTGCACTTCAAGCACAAATGAGATCATCTAAATTCAATGTGCTACTCACAACGTATGAATACGTTATCAAGGATAAAGCTGTTCTAGCCAAGTTGCACTGGAAGTACATGATCATCGATGAAGGGCATCGAATGAAGAATCACCATTGCAAATTGACACAAGTGCTAAATTCACATTATGTTGTTCCGCAAAGGCTCCTTTTGACTGGAACTCCGTTGCAAAATAAGTTGCCCGAACTGTGGGCTCTCCTCAATTTTCTTCTTCCGTCTATTTTCAAATCCTGCTCAACATTTGAACAGTGGTTCAATGCTCCTTTTGCCACAACTGGTGAAAAAGTGGAATTAAATGAGGAAGAAACTATTTTGATCATTCGCCGTCTACATAAAGTTTTACGTCCATTTTTGCTGCGACGTTTGAAGAAAGAAGTCGAGTCTCAACTTCCAGACAAAATCGAATATATCGTAAAATGTGATATGTCAGGGCTCCAGAGAGTCTTGTATAGGCACATGCAAAGTAAAGGGGTCCTTCTAACTGATGGCTCTGAAAAAGGTAACAAGGGCAAAGGTGGAGCCAAAGCACTGATGAATACAATTGTCCAACTTCGCAAGTTGTGCAATCATCCATTCCTGTTTCAACATATCGAAGAGAAGTTCTGCGATCATATCGGCTGTTCGTCAAATGGTGTTGTAAGTGGACCTGACCTTTATCGAGTCTCTGGTAAGTTTGAACTATTGGATCGAATTTTGCCAAAGTTGAAGGCCACCAATCACCGAGTACTTCTATTTTGTCAAATGACCCAGCTCATGAGCATAATGGAGGATTATTTCAACTGGCGAGGATTCTCGTACCTTCGTCTTGATGGAACAACCAAAGCGGAAGATCGAGGGGATTTATTGAAAAAATTTAACAGCGCCACCAGTGAATATTTCATATTCTTACTGAGCACACGAGCTGGTGGACTTGGCTTAAATCTTCAAGCTGCAGACACTGTAGTTATTTTCGACTCTGATTGGAATCCCCATCAGGATTTACAAGCGCAAGATCGAGCACATCGAATTGGTCAAAAGAACGAGGTACGAGTATTGAGGTTAATGACGGTCAATTCCGTTGAAGAACGAATCTTAGCAGCAGCTCGATACAAATTGAACATGGATGAAAAAGTCATCCAGGCAGGCATGTTCGATCAGAAGTCTACTGGAACTGAGAGGCAGCAGTTTTTGCATAGTATTTTGCATCAAGATGATGCAGAAGATGAGGAAGAGAATGAGGTTCCGGATGATGAAACTGTAAATCAGATGATTGCTCGCAGTGAAGCTGAATTTGACACTTTTCAAAAAATGGATGCTGAAAGACGCAAAGAAGAGTCTAAGGGCAAAAAATCCCGGCTTATTGAGGAGAGTGAACTACCAGACTGGTTGGTTAAAGATGACGCAGAGGTTGAAGCTTGGACGTACGAACAGGAAGAAGTGCAGATGGGACGAGGCTCAAGGACAAGAAAGGAAATTGACTACTCAGACAGCATGACAGAAAAGGAATGGTTAAAGGCCATTGATGATGGTATTGATGACTTTGATGAGATTGAAGATGAAGTGAAAGTGAAGAAAACTCGCAAACGGCGCAAAAAAGAAGAGGAGGAAGAGGAACCGGCCAAAAAACGAAGAAATGGTACAGAGAAGAATCCGCAAGAGAAAACACCACCTGCTAATTCAGGAGCGGATGCTCGAATGAAGAAGCAAATGCATAAATTGATGACGATTGTTGTAGAGTACACTGAACCTCAAGATTCGCGTGTTCTCAGTGAACCATTCATGAAACTACCATCTCGTCGTGAACTTCCTGATTATTATGAAGTCATCAAGAAACCCCTCGACATCAAGAAAATTCTCACAAAAATTGATGAAGGAAAGTACGAGGAACTGGATGATCTGGAGCGCGATTTCATGCAATTATGCAAGAATGCGCAGTTGTATAATGAAGAAGCATCACTCATCTATGAAGACTCAATTGTACTGCAGTCTGTTTTTACGAACGCTCGTCAGCGTTTGGAAAGTGAAGAGGAAGAAGCTCCGGAGGAAGAAGAAAAAGCGGCACCTGCTGAAGAGGAAGCCTCATCTGGAGCAGAATCGTCCTCTGTGAAAATGAAATTAAAATTGAAGGCATCAACCAAAGCGCCGAAAAATTCCGATGCCAAAACTGATACAAAGTCTACCCCACGATCAAGGAAAAGAACCTCGAAAAAATACATAAGTGACGATGAGAATGAAGATGATGCCGAATCAAGTAATGGCTAA

the amino acid sequence of the tobacco whitefly MED recessive chromatin remodeling gene Btbrm2 is shown in SEQ ID NO. 2:

MAAPTQDNLNALQHAIDSMEEKGMQEDPRYSQLLAIRARQNNMEPPRLPGSQGFCVSSDSPSNSKQVLSPIQLQQLRVQIMAYRVLARNQPLPHQLAVAVQGKRMDSSLIQPGLGPPPLMPPTSGGNTPSPQARPTDSSNENSSGMSAAPVYPVAPPTSPNVPQGPPPSQLPPVTPPPPQSSSTMAPPPAVPAPPAPSVPAPLPPPALNSTPPAPLMPPISAPTPPVPLQPPVTSHVHIAPPMPRLPITSHPVMVVPPPPNSMLKPMPSPVVLPPPPPPPPNPQQLTQQLQLQKQNRVTTIPRPTGIDPILILQERENRVAARIAHHMEKLSNLPSTVSDEIRLKAQIELRALRILNFQRQLRSEIISCARRDSTLETAVNMKAYKRVKTQGLKESRATEKLEKQQKLEAERKRRQKHQEYLAAIIQHGKDFKEYHRNNQARIVRLNKAMLSYHVNAEREQKKEQERIEKERMRRLMAEDEEGYRKLIDQKKDKRLAFLLSQTDEYITNLTEMVKQHKVEQKRKLAEKAKEDKRKKKETEDAERRACVMEMESGKKLKGEEAPLMVDLGTWLEAHPGWEACEDSEAETEEESDSDSDQNIEEKIEEVKEEKKPKEELDPKEVVEKAKSEDDEYKNTSEELTYYSIAHTINEIVTEQASIMVNGKLKEYQIKGLEWLVSLYNNNLNGILADEMGLGKTIQTIALITYLMEMKKVNGPYLIIVPLSTLSNWVLEFEKWAPSVNVVAYKGSPAVRRALQAQMRSSKFNVLLTTYEYVIKDKAVLAKLHWKYMIIDEGHRMKNHHCKLTQVLNSHYVVPQRLLLTGTPLQNKLPELWALLNFLLPSIFKSCSTFEQWFNAPFATTGEKVELNEEETILIIRRLHKVLRPFLLRRLKKEVESQLPDKIEYIVKCDMSGLQRVLYRHMQSKGVLLTDGSEKGNKGKGGAKALMNTIVQLRKLCNHPFLFQHIEEKFCDHIGCSSNGVVSGPDLYRVSGKFELLDRILPKLKATNHRVLLFCQMTQLMSIMEDYFNWRGFSYLRLDGTTKAEDRGDLLKKFNSATSEYFIFLLSTRAGGLGLNLQAADTVVIFDSDWNPHQDLQAQDRAHRIGQKNEVRVLRLMTVNSVEERILAAARYKLNMDEKVIQAGMFDQKSTGTERQQFLHSILHQDDAEDEEENEVPDDETVNQMIARSEAEFDTFQKMDAERRKEESKGKKSRLIEESELPDWLVKDDAEVEAWTYEQEEVQMGRGSRTRKEIDYSDSMTEKEWLKAIDDGIDDFDEIEDEVKVKKTRKRRKKEEEEEEPAKKRRNGTEKNPQEKTPPANSGADARMKKQMHKLMTIVVEYTEPQDSRVLSEPFMKLPSRRELPDYYEVIKKPLDIKKILTKIDEGKYEELDDLERDFMQLCKNAQLYNEEASLIYEDSIVLQSVFTNARQRLESEEEEAPEEEEKAAPAEEEASSGAESSSVKMKLKLKASTKAPKNSDAKTDTKSTPRSRKRTSKKYISDDENEDDAESSNG

the amino acid sequence has the typical structural characteristics of brm protein: HSA domain (406-478aa), BRK domain (541-585aa), ATPase domain (DEXDc:661-853aa and HELICC:1022-1106aa), SnAC domain (1201-1266aa), and Bromo domain (1325-1436 aa).

The expression mode of the Btbrm2 gene under temperature stress is analyzed, and the real-time fluorescent quantitative PCR result shows that the expression quantity of the Btbrm2 gene is obviously increased after the bemisia tabaci MED hidden species is subjected to low-temperature stress treatment for 5 hours; after the high-temperature stress treatment is carried out for 1h, the expression level of the Btbrm2 gene is obviously increased. After short-time high-temperature and low-temperature stress treatment, the expression level of the gene of the local Asia II 1 cryptophyte of the bemisia tabaci is obviously reduced. Comparing the expression level of Btbrm2 gene of different cryptophytes under the same temperature stress, the expression level of MED cryptophyte Btbrm2 gene after high and low temperature stress treatment is obviously higher than that of Asia II 1 cryptophyte.

The invention provides application of the bemisia tabaci MED cryptic chromatin remodeling gene Btbrm 2. RNAi is carried out on the cryptophyte of the bemisia tabaci MED, and the result shows that the high-temperature knockdown time of the cryptophyte MED imagoes fed with dsBtbrm2 is obviously reduced, and the low-temperature cold-induced stunning recovery time is obviously increased, which indicates that the Btbrm2 gene plays a key role in the temperature tolerance of the cryptophyte of the bemisia tabaci MED. The bemisia tabaci MED recessive chromatin remodeling gene Btbrm2 can be used for destroying temperature tolerance of bemisia tabaci, and further can be used for preventing and treating the bemisia tabaci.

The chromatin remodeling gene Btbrm2 is cloned from the aleyrodids MED hidden species for the first time, and the difference of the expression modes of the Btbrm2 gene in the aleyrodids MED hidden species and other hidden species under the stress of temperature is determined. In addition, the reduction of the expression of the gene directly reduces the tolerance of the MED cryptic species to high and low temperatures. The obtained result lays a foundation for further researching the relationship between the temperature tolerance mechanism of the hidden species of the bemisia tabaci MED and the epigenetic chromatin remodeling, and can be used for destroying the temperature tolerance of the bemisia tabaci and further preventing and controlling the harm and the diffusion of the bemisia tabaci.

Drawings

FIG. 1 conserved domain in the Bemisia tabaci MED cryptic Btbrm2 gene;

FIG. 2 shows the differences in expression patterns of the Btbrm2 gene in Bemisia tabaci MED cryptic species and AsiaII 1 cryptic species at different temperatures for treatments 1h (A), 3h (B), and 5h (C);

FIG. 3 shows the expression level changes of Btbrm2 under the conditions of feeding Btbrm2 gene dsRNA, feeding dsEGFP, feeding 10% sucrose solution and CK;

fig. 4 shows the effect of dsRNA treatment of Btbrm2 gene on whitefly MED cryptophyte adult heat resistance (a) and cold resistance (B): comparing the high-temperature knockdown time and the low-temperature cold-induced stunning recovery time of the Bemisia tabaci MED cryptomorphic adults fed with Btbrm2 gene dsRNA, dsEGFP and 10% sucrose solution under CK conditions.

Detailed Description

Example 1: full-length cDNA sequence clone of Bemisia tabaci MED cryptic Btbrm2 gene

Respectively putting 200 heads of bemisia tabaci adults under different temperature stress conditions into a 1.5mL centrifuge tube, freezing the bemisia tabaci adults by using liquid nitrogen, grinding the bemisia tabaci adults into powder by using a grinding rod, extracting RNA, and storing the RNA at minus 80 ℃ for later use. The extracted RNA was reverse transcribed to synthesize cDNA according to the instructions of the full-scale gold reverse transcription kit (One-Step gDNAremoval and cDNA Synthesis SuperMix). And (3) designing a primer by taking the cDNA as a template, and carrying out PCR amplification. Primers were designed as shown in tables 1 and 2:

TABLE 1

TABLE 2

Experiments show that the primers in the table 1 are used for PCR amplification to obtain the full-length cDNA of the bemisia tabaci MED cryptic seed Btbrm2 gene. However, the primers shown in Table 2 failed to obtain the desired gene sequence.

The full length of the cDNA sequence of the Btbrm2 gene obtained by utilizing the sequence in Table 1 and carrying out PCR amplification is 4548bp, the obtained gene has a nucleotide sequence shown as SEQ ID No. 1, and 1515 amino acid sequences shown as SEQ ID No. 2 are coded by the gene. The conserved domain analysis of the amino acid sequence encoded by the gene obtained by cloning shows that the gene has the typical structural characteristics of brm protein: comprises an HSA domain at the 406-478 site, a BRK domain at the 541-585 site, a DEXDc domain at the 661-853 site, a HELICC domain at the 1022-1106 site, an SnAC domain at the 1201-1266 site and a Bromo domain at the 1325-1436 site. The conserved domain of the gene is shown in FIG. 1.

Example 2: analysis of expression characteristics of Btbrm2 Gene

(1) Extracting RNA and synthesizing cDNA of bemisia tabaci adults under different temperature stresses

Selecting the preliminarily emerged Bemisia tabaci MED cryptophyte and Asia II 1 cryptophyte adults, and respectively carrying out stress treatment on the Bemisia tabaci adults at the temperature of 0, 12, 26, 35 and 40 ℃. Each of the 3 biology is repeated, 3000 adults are obtained, and after the stress is finished, the adults are immediately placed in liquid nitrogen to be frozen for 3 minutes and then stored at the temperature of minus 80 ℃. RNA was extracted and reverse transcribed into cDNA according to the method of example 1.

(2) Detecting Btbrm2 expression levels at different temperatures by fluorescent quantitative PCR:

primers for Btbrm2 gene and two internal reference genes (EF 1-alpha, beta-tublin) of fluorescent quantitative PCR were designed:

brm2-QF：AAAACCATCCAAACAATCGC

brm2-QR：TTTCAAACTCCAACACCCAA

EF1-α-F：TAGCCTTGTGCCAATTTCCG

EF1-α-R：CCTTCAGCATTACCGTCC

β-tub-F：TGTCAGGAGTAACGACGTGTTTG

β-tub-R：TTCGGGAACGGTAAGTGCTC

the reaction system is 20 μ L: 2 × TransStartTM Green qPCR 10.0 μ L, ROA 0.4 μ L, cDNA template 1.0 μ L, Primer-F0.4 μ L, Primer-R0.4 μ L, ddH2O 7.8. mu.L.

Reaction conditions are as follows: 30s at 95 ℃; 5s at 95 ℃, 30s at 60 ℃ and 40 cycles; and drawing a melting curve.

(3) Data analysis

The relative expression level of the gene was calculated by the 2-. DELTA.CT method. Performing statistical analysis on the data by using SAS9.4 software, performing one-way analysis of variance (ANOVA) on the difference between different temperature treatments, and performing Duncan test; the differences between different crypts at the same temperature were analyzed using independent samples T-test. Data are expressed as mean ± standard error, significance assay levels represent P <0.01, and P < 0.001.

As shown in FIG. 2, the real-time fluorescent quantitative PCR result shows that the expression level of Btbrm2 gene is obviously increased after the Bemisia tabaci MED cryptic species is subjected to low-temperature stress treatment for 5h (C); after the high-temperature stress treatment for 1h (A), the expression level of the Btbrm2 gene is obviously increased. After short-time high-temperature and low-temperature stress treatment, the expression level of the gene of the local Asia II 1 cryptophyte of the bemisia tabaci is obviously reduced. Comparing the expression level of Btbrm2 gene of different cryptophytes under the same temperature stress, the expression level of MED cryptophyte Btbrm2 gene after high and low temperature stress treatment is obviously higher than that of Asia II 1 cryptophyte.

Example 3: analyzing the influence of Btbrm2 gene on the temperature tolerance of Bemisia tabaci MED cryptic species

3.1 Synthesis of dsRNA

(1) Primer sequences were designed to synthesize plus the T7 promoter (sequence underlined):

T7+Btbrm2-F：5’-TAATACGACTCACTATAGGGTGTGATATGTCAGGGCT-3’

T7+Btbrm2-R：5’-TAATACGACTCACTATAGGGTACTCGGTGATTGGTGG-3'. Synthesized by Shanghai Biotechnology service, Inc.

(2) Total RNA extraction and cDNA synthesis: the same as in example 1.

(3) And (3) carrying out PCR amplification and product purification on the T7 primer, wherein the purified PCR product is the template for synthesizing dsRNA. dsRNA was synthesized and purified using the kit, following the kit instructions.

3.2dsRNA feeding

The Parafilm membrane was previously treated with DEPC water to remove RNase. Adding dsRNA into sucrose solution with the concentration of 10%, wherein the concentration is 0.3-0.5 mu g/mu L. According to the feeding characteristics of the bemisia tabaci, the method for clamping the nutrient solution by the Parafilm membrane is correspondingly improved: taking about 200 heads of the primary eclosion bemisia tabaci adults, putting the initial eclosion bemisia tabaci adults into a glass tube with two transparent ends, covering the upper end of the glass tube with a double-layer Parafilm, adding 200 mu L of 10% sucrose solution between the two films, adding dsRNA to enable the final concentration to be 0.3-0.5 mu g/mu L, covering the lower end of the glass tube with gauze, and keeping ventilation. The periphery and the lower end of the glass tube are wrapped by black plastic, so that the bemisia tabaci can gather to a parafilm at the top end to take dsRNA better, the device is placed into an artificial climate box (the temperature is 26 +/-0.5 ℃, the illumination is carried out for 24 hours, the relative humidity is 60-70 percent), and feeding is carried out for 3 hours. Collecting the fed bemisia tabaci in a finger-type pipe, putting a group of pipe into a preheated high-temperature water bath kettle for thermal knock down, and recording the time until the bemisia tabaci cannot stand independently, wherein the treatment temperature is 45 ℃. The other group is put into a low-temperature water bath kettle for cold knock down for ten minutes and then taken out to record the cold-induced dizziness recovery time, and the treatment temperature is-5 ℃. Bemisia tabaci without any treatment (CK), fed with a 10% sucrose solution and fed with a 10% sucrose mixed solution containing dsEGFP (final concentration of dsEGFP 0.3-0.5. mu.g/. mu.L) was used as a control, and 4 biological replicates were set for each treatment.

The relative expression amount of the gene is calculated by a 2-delta CT method, and the result is shown in figure 3, and the expression of the Btbrm2 gene can be obviously reduced by feeding dsBtbrm 2. Analyzing the high-temperature knockdown time and the low-temperature cold-induced stunning recovery time of the Bemisia tabaci MED cryptophyte adults fed with different solutions by using SAS9.4 statistical software, wherein the results are shown in figure 4, the high-temperature knockdown time (A) of the Bemisia tabaci MED cryptophyte fed with Btbrm2 gene dsRNA is remarkably lower than that of a CK group, a dsEGFP group and a sucrose group, and the low-temperature cold-induced stunning recovery time (B) is remarkably higher than that of three control groups (P < 0.05); the feeding target sequence has the sequence specific to the Btbrm2 gene, so that the interference effect is ensured to be generated by the Btbrm2 gene of the target cryptophyte of bemisia tabaci MED, and therefore, the Btbrm2 gene plays a key role in the temperature tolerance of the cryptophyte of bemisia tabaci MED.

The full-length cDNA of the Btbrm2 gene is cloned from the aleyrodids MED hidden seeds, and the difference of the expression quantity of the Btbrm2 gene in different aleyrodids hidden seeds at different temperatures is displayed by fluorescent quantitative PCR; and finally, the Btbrm2 gene dsRNA is fed, so that the high-temperature knockdown time of the bemisia tabaci MED cryptophyte adults is obviously shortened, and the low-temperature cold-induced stunning recovery time is obviously prolonged. According to the specific embodiment of the invention, the test result confirms that the Btbrm2 gene plays a key role in the temperature tolerance of the Bemisia tabaci MED cryptic species. The method lays a foundation for further researching the relationship between the temperature tolerance mechanism of the hidden species of the bemisia tabaci MED and the epigenetic chromatin remodeling, and can be used for destroying the temperature tolerance of the bemisia tabaci and further preventing and controlling the harm and the diffusion of the bemisia tabaci.

Sequence listing

<110> institute of plant protection of Chinese academy of agricultural sciences

<120> bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm2, and coding gene and application thereof

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>4548

<212>DNA

<213> Bemisia tabaci (Bemis tabaci)

<400>1

atggcagctc ccactcaaga caatctgaat gctttgcagc acgctataga ttcaatggaa 60

gagaaaggta tgcaagagga tcctagatat tctcagctcc tcgctatcag agctcgtcaa 120

aataacatgg agccccctcg acttcctgga tcgcaaggat tttgcgtatc ctctgatagc 180

ccatcgaatt ccaagcaagt tttgagtccc atccagttgc aacagttacg agtccaaatc 240

atggcatatc gagttctcgc tcggaatcag ccgttgcctc atcaacttgc agtagcggtt 300

caagggaaac gaatggactc gtctctcatt caaccgggtc tgggacctcc acctctcatg 360

cctccaacct ccggtggaaa cactccaagc ccacaagcac gacccactga ttcaagcaat 420

gaaaactcat ctggaatgag tgcagctcct gtgtaccctg tcgcaccccc aacttcaccc 480

aacgtacccc aaggacctcc gccatctcag ttgcccccag taaccccacc tcccccacag 540

tcatcctcaa cgatggctcc acctcctgct gttccagcac cacctgctcc atctgttcct 600

gcccctctcc caccccctgc tctcaattca acaccccctg cgcccctcat gcctcccatt 660

tcagcaccga caccacctgt acccttgcag ccaccagtga cgtcacacgt ccatatcgcc 720

ccacccatgc ctcggctccc catcacgagt catcccgtca tggttgtccc tcctcctcct 780

aactcaatgc tgaaaccgat gcccagtcca gttgttctgc ctcctccgcc accaccaccc 840

cccaatccgc agcaacttac gcagcaactt cagttacaaa aacagaacag agttacgact 900

attcctcgtc caactgggat cgaccctata ctaattttac aagaaagaga aaatagagtc 960

gcagctcgca ttgcccatca tatggagaag ctctccaatc ttccgtcaac agtgtcggat 1020

gaaattcgcc tcaaagctca gatcgaactt cgtgctttga gaatcttgaa ttttcaacgt 1080

cagctccgaa gcgagatcat atcttgtgct cgcagagatt caaccctgga aacagccgtc 1140

aatatgaaag cctacaagcg agtcaaaacc caaggattaa aagaatctcg cgcgacagaa 1200

aagttggaaa agcagcagaa actggaagca gagaggaaac ggagacaaaa acatcaagaa 1260

tatttggcag ccatcattca gcacggtaaa gactttaaag aataccatcg gaataatcaa 1320

gcgaggatcg tccggttgaa taaagccatg cttagttacc atgtgaatgc ggagcgggag 1380

cagaagaaag aacaggagag gatcgaaaag gaacgaatga gacgcctaat ggcagaagat 1440

gaagagggtt acaggaaact catcgatcaa aagaaagaca agagactggc attcttactg 1500

tctcaaactg acgaatacat cacaaacttg acagaaatgg tcaaacaaca caaagttgaa 1560

caaaaacgta aacttgcaga gaaagcgaaa gaagacaaga ggaaaaagaa agaaactgag 1620

gatgcggagc ggagagcttg cgtaatggaa atggaaagtg ggaaaaaatt gaagggagaa 1680

gaagctccct tgatggtgga cctaggcact tggctggaag ctcatcctgg ttgggaagca 1740

tgtgaggact cagaggcaga gactgaagaa gagtctgatt ctgattccga tcaaaatatc 1800

gaagaaaaaa ttgaagaagt caaagaagag aagaaaccaa aagaagaact tgatccgaaa 1860

gaagttgttg aaaaagcgaa aagtgaagac gatgaataca aaaatacctc cgaagaactt 1920

acctactaca gtattgctca cacaatcaat gaaattgtga cagaacaagc ctctatcatg 1980

gttaatggta aattaaaaga atatcaaatc aagggacttg agtggctagt ctctctgtac 2040

aataataatc tcaatggcat cctggccgat gaaatgggtc ttggaaaaac catccaaaca 2100

atcgcattga tcacatactt gatggagatg aaaaaagtaa acggtccata tttaatcatc 2160

gtacctcttt ccaccctttc aaattgggtg ttggagtttg aaaaatgggc cccatctgta 2220

aatgttgttg cgtacaaagg ctcaccagct gtcagacgtg cacttcaagc acaaatgaga 2280

tcatctaaat tcaatgtgct actcacaacg tatgaatacg ttatcaagga taaagctgtt 2340

ctagccaagt tgcactggaa gtacatgatc atcgatgaag ggcatcgaat gaagaatcac 2400

cattgcaaat tgacacaagt gctaaattca cattatgttg ttccgcaaag gctccttttg 2460

actggaactc cgttgcaaaa taagttgccc gaactgtggg ctctcctcaa ttttcttctt 2520

ccgtctattt tcaaatcctg ctcaacattt gaacagtggt tcaatgctcc ttttgccaca 2580

actggtgaaa aagtggaatt aaatgaggaagaaactattt tgatcattcg ccgtctacat 2640

aaagttttac gtccattttt gctgcgacgt ttgaagaaag aagtcgagtc tcaacttcca 2700

gacaaaatcg aatatatcgt aaaatgtgat atgtcagggc tccagagagt cttgtatagg 2760

cacatgcaaa gtaaaggggt ccttctaact gatggctctg aaaaaggtaa caagggcaaa 2820

ggtggagcca aagcactgat gaatacaatt gtccaacttc gcaagttgtg caatcatcca 2880

ttcctgtttc aacatatcga agagaagttc tgcgatcata tcggctgttc gtcaaatggt 2940

gttgtaagtg gacctgacct ttatcgagtc tctggtaagt ttgaactatt ggatcgaatt 3000

ttgccaaagt tgaaggccac caatcaccga gtacttctat tttgtcaaat gacccagctc 3060

atgagcataa tggaggatta tttcaactgg cgaggattct cgtaccttcg tcttgatgga 3120

acaaccaaag cggaagatcg aggggattta ttgaaaaaat ttaacagcgc caccagtgaa 3180

tatttcatat tcttactgag cacacgagct ggtggacttg gcttaaatct tcaagctgca 3240

gacactgtag ttattttcga ctctgattgg aatccccatc aggatttaca agcgcaagat 3300

cgagcacatc gaattggtca aaagaacgag gtacgagtat tgaggttaat gacggtcaat 3360

tccgttgaag aacgaatctt agcagcagct cgatacaaat tgaacatgga tgaaaaagtc 3420

atccaggcag gcatgttcga tcagaagtct actggaactg agaggcagca gtttttgcat 3480

agtattttgc atcaagatga tgcagaagat gaggaagaga atgaggttcc ggatgatgaa 3540

actgtaaatc agatgattgc tcgcagtgaa gctgaatttg acacttttca aaaaatggat 3600

gctgaaagac gcaaagaaga gtctaagggc aaaaaatccc ggcttattga ggagagtgaa 3660

ctaccagact ggttggttaa agatgacgca gaggttgaag cttggacgta cgaacaggaa 3720

gaagtgcaga tgggacgagg ctcaaggaca agaaaggaaa ttgactactc agacagcatg 3780

acagaaaagg aatggttaaa ggccattgat gatggtattg atgactttga tgagattgaa 3840

gatgaagtga aagtgaagaa aactcgcaaa cggcgcaaaa aagaagagga ggaagaggaa 3900

ccggccaaaa aacgaagaaa tggtacagag aagaatccgc aagagaaaac accacctgct 3960

aattcaggag cggatgctcg aatgaagaag caaatgcata aattgatgac gattgttgta 4020

gagtacactg aacctcaaga ttcgcgtgtt ctcagtgaac cattcatgaa actaccatct 4080

cgtcgtgaac ttcctgatta ttatgaagtc atcaagaaac ccctcgacat caagaaaatt 4140

ctcacaaaaa ttgatgaagg aaagtacgag gaactggatg atctggagcg cgatttcatg 4200

caattatgca agaatgcgca gttgtataat gaagaagcat cactcatcta tgaagactca 4260

attgtactgc agtctgtttt tacgaacgct cgtcagcgtt tggaaagtga agaggaagaa 4320

gctccggagg aagaagaaaa agcggcacct gctgaagagg aagcctcatc tggagcagaa 4380

tcgtcctctg tgaaaatgaa attaaaattg aaggcatcaa ccaaagcgcc gaaaaattcc 4440

gatgccaaaa ctgatacaaa gtctacccca cgatcaagga aaagaacctc gaaaaaatac 4500

ataagtgacg atgagaatga agatgatgcc gaatcaagta atggctaa 4548

<210>2

<211>1515

<212>PRT

<213> Bemisia tabaci (Bemis tabaci)

<400>2

Met Ala Ala Pro Thr Gln Asp Asn Leu Asn Ala Leu Gln His Ala Ile

1 5 10 15

Asp Ser Met Glu Glu Lys Gly Met Gln Glu Asp Pro Arg Tyr Ser Gln

20 25 30

Leu Leu Ala Ile Arg Ala Arg Gln Asn Asn Met Glu Pro Pro Arg Leu

35 40 45

Pro Gly Ser Gln Gly Phe Cys Val Ser Ser Asp Ser Pro Ser Asn Ser

50 55 60

Lys Gln Val Leu Ser Pro Ile Gln Leu Gln Gln Leu Arg Val Gln Ile

65 70 75 80

Met Ala Tyr Arg Val Leu Ala Arg Asn Gln Pro Leu Pro His Gln Leu

85 90 95

Ala Val Ala Val Gln Gly Lys Arg Met Asp Ser Ser Leu Ile Gln Pro

100 105 110

Gly Leu Gly Pro Pro Pro Leu Met Pro Pro Thr Ser Gly Gly Asn Thr

115 120 125

Pro Ser Pro Gln Ala Arg Pro Thr Asp Ser Ser Asn Glu Asn Ser Ser

130 135 140

Gly Met Ser Ala Ala Pro Val Tyr Pro Val Ala Pro Pro Thr Ser Pro

145 150 155 160

Asn Val Pro Gln Gly Pro Pro Pro Ser Gln Leu Pro Pro Val Thr Pro

165 170 175

Pro Pro Pro Gln Ser Ser Ser Thr Met Ala Pro Pro Pro Ala Val Pro

180 185 190

Ala Pro Pro Ala Pro Ser Val Pro Ala Pro Leu Pro Pro Pro Ala Leu

195 200 205

Asn Ser Thr Pro Pro Ala Pro Leu Met Pro Pro Ile Ser Ala Pro Thr

210 215 220

Pro Pro Val Pro Leu Gln Pro Pro Val Thr Ser His Val His Ile Ala

225 230 235 240

Pro Pro Met Pro Arg Leu Pro Ile Thr Ser His Pro Val Met Val Val

245 250 255

Pro Pro Pro Pro Asn Ser Met Leu Lys Pro Met Pro Ser Pro Val Val

260 265 270

Leu Pro Pro Pro Pro Pro Pro Pro Pro Asn Pro Gln Gln Leu Thr Gln

275 280 285

Gln Leu Gln Leu Gln Lys Gln Asn Arg Val Thr Thr Ile Pro Arg Pro

290 295 300

Thr Gly Ile Asp Pro Ile Leu Ile Leu Gln Glu Arg Glu Asn Arg Val

305 310 315 320

Ala AlaArg Ile Ala His His Met Glu Lys Leu Ser Asn Leu Pro Ser

325 330 335

Thr Val Ser Asp Glu Ile Arg Leu Lys Ala Gln Ile Glu Leu Arg Ala

340 345 350

Leu Arg Ile Leu Asn Phe Gln Arg Gln Leu Arg Ser Glu Ile Ile Ser

355 360 365

Cys Ala Arg Arg Asp Ser Thr Leu Glu Thr Ala Val Asn Met Lys Ala

370 375 380

Tyr Lys Arg Val Lys Thr Gln Gly Leu Lys Glu Ser Arg Ala Thr Glu

385 390 395 400

Lys Leu Glu Lys Gln Gln Lys Leu Glu Ala Glu Arg Lys Arg Arg Gln

405 410 415

Lys His Gln Glu Tyr Leu Ala Ala Ile Ile Gln His Gly Lys Asp Phe

420 425 430

Lys Glu Tyr His Arg Asn Asn Gln Ala Arg Ile Val Arg Leu Asn Lys

435 440 445

Ala Met Leu Ser Tyr His Val Asn Ala Glu Arg Glu Gln Lys Lys Glu

450 455 460

Gln Glu Arg Ile Glu Lys Glu Arg Met Arg Arg Leu Met Ala Glu Asp

465 470 475 480

Glu Glu Gly TyrArg Lys Leu Ile Asp Gln Lys Lys Asp Lys Arg Leu

485 490 495

Ala Phe Leu Leu Ser Gln Thr Asp Glu Tyr Ile Thr Asn Leu Thr Glu

500 505 510

Met Val Lys Gln His Lys Val Glu Gln Lys Arg Lys Leu Ala Glu Lys

515 520 525

Ala Lys Glu Asp Lys Arg Lys Lys Lys Glu Thr Glu Asp Ala Glu Arg

530 535 540

Arg Ala Cys Val Met Glu Met Glu Ser Gly Lys Lys Leu Lys Gly Glu

545 550 555 560

Glu Ala Pro Leu Met Val Asp Leu Gly Thr Trp Leu Glu Ala His Pro

565 570 575

Gly Trp Glu Ala Cys Glu Asp Ser Glu Ala Glu Thr Glu Glu Glu Ser

580 585 590

Asp Ser Asp Ser Asp Gln Asn Ile Glu Glu Lys Ile Glu Glu Val Lys

595 600 605

Glu Glu Lys Lys Pro Lys Glu Glu Leu Asp Pro Lys Glu Val Val Glu

610 615 620

Lys Ala Lys Ser Glu Asp Asp Glu Tyr Lys Asn Thr Ser Glu Glu Leu

625 630 635 640

Thr Tyr Tyr Ser Ile AlaHis Thr Ile Asn Glu Ile Val Thr Glu Gln

645 650 655

Ala Ser Ile Met Val Asn Gly Lys Leu Lys Glu Tyr Gln Ile Lys Gly

660 665 670

Leu Glu Trp Leu Val Ser Leu Tyr Asn Asn Asn Leu Asn Gly Ile Leu

675 680 685

Ala Asp Glu Met Gly Leu Gly Lys Thr Ile Gln Thr Ile Ala Leu Ile

690 695 700

Thr Tyr Leu Met Glu Met Lys Lys Val Asn Gly Pro Tyr Leu Ile Ile

705 710 715 720

Val Pro Leu Ser Thr Leu Ser Asn Trp Val Leu Glu Phe Glu Lys Trp

725 730 735

Ala Pro Ser Val Asn Val Val Ala Tyr Lys Gly Ser Pro Ala Val Arg

740 745 750

Arg Ala Leu Gln Ala Gln Met Arg Ser Ser Lys Phe Asn Val Leu Leu

755 760 765

Thr Thr Tyr Glu Tyr Val Ile Lys Asp Lys Ala Val Leu Ala Lys Leu

770 775 780

His Trp Lys Tyr Met Ile Ile Asp Glu Gly His Arg Met Lys Asn His

785 790 795 800

His Cys Lys Leu Thr Gln Val LeuAsn Ser His Tyr Val Val Pro Gln

805 810 815

Arg Leu Leu Leu Thr Gly Thr Pro Leu Gln Asn Lys Leu Pro Glu Leu

820 825 830

Trp Ala Leu Leu Asn Phe Leu Leu Pro Ser Ile Phe Lys Ser Cys Ser

835 840 845

Thr Phe Glu Gln Trp Phe Asn Ala Pro Phe Ala Thr Thr Gly Glu Lys

850 855 860

Val Glu Leu Asn Glu Glu Glu Thr Ile Leu Ile Ile Arg Arg Leu His

865 870 875 880

Lys Val Leu Arg Pro Phe Leu Leu Arg Arg Leu Lys Lys Glu Val Glu

885 890 895

Ser Gln Leu Pro Asp Lys Ile Glu Tyr Ile Val Lys Cys Asp Met Ser

900 905 910

Gly Leu Gln Arg Val Leu Tyr Arg His Met Gln Ser Lys Gly Val Leu

915 920 925

Leu Thr Asp Gly Ser Glu Lys Gly Asn Lys Gly Lys Gly Gly Ala Lys

930 935 940

Ala Leu Met Asn Thr Ile Val Gln Leu Arg Lys Leu Cys Asn His Pro

945 950 955 960

Phe Leu Phe Gln His Ile Glu Glu Lys PheCys Asp His Ile Gly Cys

965 970 975

Ser Ser Asn Gly Val Val Ser Gly Pro Asp Leu Tyr Arg Val Ser Gly

980 985 990

Lys Phe Glu Leu Leu Asp Arg Ile Leu Pro Lys Leu Lys Ala Thr Asn

995 1000 1005

His Arg Val Leu Leu Phe Cys Gln Met Thr Gln Leu Met Ser Ile Met

1010 1015 1020

Glu Asp Tyr Phe Asn Trp Arg Gly Phe Ser Tyr Leu Arg Leu Asp Gly

1025 1030 1035 1040

Thr Thr Lys Ala Glu Asp Arg Gly Asp Leu Leu Lys Lys Phe Asn Ser

1045 1050 1055

Ala Thr Ser Glu Tyr Phe Ile Phe Leu Leu Ser Thr Arg Ala Gly Gly

1060 1065 1070

Leu Gly Leu Asn Leu Gln Ala Ala Asp Thr Val Val Ile Phe Asp Ser

1075 1080 1085

Asp Trp Asn Pro His Gln Asp Leu Gln Ala Gln Asp Arg Ala His Arg

1090 1095 1100

Ile Gly Gln Lys Asn Glu Val Arg Val Leu Arg Leu Met Thr Val Asn

1105 1110 1115 1120

Ser Val Glu Glu Arg Ile Leu Ala Ala Ala Arg Tyr Lys Leu Asn Met

1125 1130 1135

Asp Glu Lys Val Ile Gln Ala Gly Met Phe Asp Gln Lys Ser Thr Gly

1140 1145 1150

Thr Glu Arg Gln Gln Phe Leu His Ser Ile Leu His Gln Asp Asp Ala

1155 1160 1165

Glu Asp Glu Glu Glu Asn Glu Val Pro Asp Asp Glu Thr Val Asn Gln

1170 1175 1180

Met Ile Ala Arg Ser Glu Ala Glu Phe Asp Thr Phe Gln Lys Met Asp

1185 1190 1195 1200

Ala Glu Arg Arg Lys Glu Glu Ser Lys Gly Lys Lys Ser Arg Leu Ile

1205 1210 1215

Glu Glu Ser Glu Leu Pro Asp Trp Leu Val Lys Asp Asp Ala Glu Val

1220 1225 1230

Glu Ala Trp Thr Tyr Glu Gln Glu Glu Val Gln Met Gly Arg Gly Ser

1235 1240 1245

Arg Thr Arg Lys Glu Ile Asp Tyr Ser Asp Ser Met Thr Glu Lys Glu

1250 1255 1260

Trp Leu Lys Ala Ile Asp Asp Gly Ile Asp Asp Phe Asp Glu Ile Glu

1265 1270 12751280

Asp Glu Val Lys Val Lys Lys Thr Arg Lys Arg Arg Lys Lys Glu Glu

1285 1290 1295

Glu Glu Glu Glu Pro Ala Lys Lys Arg Arg Asn Gly Thr Glu Lys Asn

1300 1305 1310

Pro Gln Glu Lys Thr Pro Pro Ala Asn Ser Gly Ala Asp Ala Arg Met

1315 1320 1325

Lys Lys Gln Met His Lys Leu Met Thr Ile Val Val Glu Tyr Thr Glu

1330 1335 1340

Pro Gln Asp Ser Arg Val Leu Ser Glu Pro Phe Met Lys Leu Pro Ser

1345 1350 1355 1360

Arg Arg Glu Leu Pro Asp Tyr Tyr Glu Val Ile Lys Lys Pro Leu Asp

1365 1370 1375

Ile Lys Lys Ile Leu Thr Lys Ile Asp Glu Gly Lys Tyr Glu Glu Leu

1380 1385 1390

Asp Asp Leu Glu Arg Asp Phe Met Gln Leu Cys Lys Asn Ala Gln Leu

1395 1400 1405

Tyr Asn Glu Glu Ala Ser Leu Ile Tyr Glu Asp Ser Ile Val Leu Gln

1410 1415 1420

Ser Val Phe Thr Asn Ala Arg Gln Arg Leu Glu Ser Glu Glu Glu Glu

1425 1430 1435 1440

Ala Pro Glu Glu Glu Glu Lys Ala Ala Pro Ala Glu Glu Glu Ala Ser

1445 1450 1455

Ser Gly Ala Glu Ser Ser Ser Val Lys Met Lys Leu Lys Leu Lys Ala

1460 1465 1470

Ser Thr Lys Ala Pro Lys Asn Ser Asp Ala Lys Thr Asp Thr Lys Ser

1475 1480 1485

Thr Pro Arg Ser Arg Lys Arg Thr Ser Lys Lys Tyr Ile Ser Asp Asp

1490 1495 1500

Glu Asn Glu Asp Asp Ala Glu Ser Ser Asn Gly

1505 1510 1515

Claims

1. The bemisia tabaci MED cryptomorphic chromatin remodeling factor is characterized in that an amino acid sequence is shown as SEQ ID No:2, respectively.

2. A diaphorina fumosorosea MED cryptic chromatin remodeling gene Btbrm2 encoding the diaphorina fumosorosea MED cryptic chromatin remodeling factor of claim 1.

3. The bemisia MED cryptic chromatin remodeling gene Btbrm2 of claim 2, wherein the nucleotide sequence is shown in SEQ ID No. 1.

4. A recombinant expression vector comprising the bemisia tabaci MED cryptic chromatin remodeling gene Btbrm2 of claim 2.

5. A recombinant strain comprising the bemisia tabaci MED cryptic chromatin remodeling gene Btbrm2 of claim 2.

6. The use of the bemisia tabaci MED cryptic chromatin remodeling gene Btbrm2 of claim 2 for controlling bemisia tabaci.

7. The use of the bemisia tabaci MED cryptic chromatin remodeling factor of claim 1 for controlling bemisia tabaci.

8. A method of reducing temperature tolerance of bemisia tabaci, comprising the step of feeding to bemisia tabaci the dsRNA of bemisia MED cryptic chromatin remodeling gene Btbrm2 of claim 2.

9. The method of reducing temperature tolerance of bemisia tabaci according to claim 8, wherein the dsRNA is amplified from the following primers:

Btbrm2-F：5’-TAATACGACTCACTATAGGGTGTGATATGTCAGGGCT-3’，

Btbrm2-R：5’-TAATACGACTCACTATAGGGTACTCGGTGATTGGTGG-3’。