CN111763253B

CN111763253B - Chromatin remodeling factor ISWI, coding gene and role in diaphorina tabaci MED cryptic temperature tolerance

Info

Publication number: CN111763253B
Application number: CN202010741312.3A
Authority: CN
Inventors: 吕志创; 冀顺霞; 王晓迪; 申晓娜; 刘万学; 万方浩
Original assignee: Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Priority date: 2020-07-29
Filing date: 2020-07-29
Publication date: 2022-03-25
Anticipated expiration: 2040-07-29
Also published as: CN111763253A

Abstract

The invention relates to the technical field of agricultural biology, in particular to a bemisia tabaci MED recessive chromatin remodeling gene Btiswi and application thereof. The nucleotide sequence of the gene is shown as SEQ ID No. 1. The invention defines the expression mode of the Btiswi gene in the hidden seed of Bemisia tabaci MED under the temperature gradient. The reduction of the expression of the gene directly reduces the tolerance of the MED cryptic species to the adversity temperature. The obtained result lays a foundation for further defining the function of the chromatin remodeling factor in the rapid adaptation of the bemisia tabaci to the adverse environmental conditions, and provides a theoretical basis for further disclosing the rapid expansion of the hidden seeds of MED and the outbreak disaster-forming mechanism. Can be used for destroying the temperature tolerance of the bemisia tabaci, and further preventing and controlling the harm and the diffusion of the bemisia tabaci.

Description

Chromatin remodeling factor ISWI, coding gene and role in diaphorina tabaci MED cryptic temperature tolerance

Technical Field

The invention relates to the technical field of agricultural biology, in particular to a chromatin remodeling factor ISWI, an encoding gene and an effect in diaphorina tabaci MED recessive temperature tolerance.

Background

Bemisia tabaci (Gennadius)) belongs to the phylum Arthropoda, Insecta, Hemiptera, Bemisia, and is an important agricultural pest worldwide. The insect host has a wide range, can damage over 600 economic crops such as leguminous crops, solanaceae crops, compositae crops, cucurbitaceae crops, malvaceae crops and cruciferae crops in a mode of taking plant juice, secreting honeydew to induce sooty mould, spreading plant viruses and the like, and is a great pest which is necessary to deal with the crop production in China.

With the change of global temperature, the successful adaptation of the hidden species of bemisia tabaci MED under different geographic environments has widely led people to the theoretical discussion of the invasion mechanism, and the molecular mechanism of the temperature adaptability is one of the research hotspots in recent years. In the experiment of heat shock selection of Bemisia tabaci, the survival rate of the invasive species Bemisia tabaci in the 2 generations is obviously improved, and the rapid improvement of the survival capability is an important strategy for the survival of the Bemisia tabaci in the severe environment. The mechanism of response of organisms to environmental variations within this short period of time is epigenetic related. Epigenetic processes increase the organism's response to the evolutionary potential for non-temperature stress and other environmental challenges, which are highly correlated with the background of global environmental warming.

Chromatin remodelling (chromatin remodelling) is one of the current research hotspots in the field of epigenetics, driving the replacement or rearrangement of nucleosomes, altering the spatial conformation of chromatin. ATP-dependent chromatin remodeling is an important epigenetic regulation mechanism for chromatin remodeling complex to utilize energy released by ATP hydrolysis to change chromatin structure, thereby regulating eukaryotic gene expression. Chromatin remodeling plays a key role in the expression regulation of genes related to biological defense, and the chromatin remodeling factor ISWI can participate in the regulation of environmental stress on the biological adversity and plays an important role in regulating the expression of genes related to abiotic stress. Its role in temperature stress of bemisia tabaci is unknown.

The phenomenon of RNA interference (RNAi) is an evolutionarily conserved defense mechanism against transgene or foreign virus invasion. Double-stranded RNA (dsRNA) having a sequence homologous to and complementary to mRNA, which is a transcription product of a target gene, is introduced into a cell to specifically degrade the mRNA, thereby causing a loss of the corresponding functional phenotype. RNAi is widely existed in biology world, and can silence some genes in insect body by RNAi technology to enhance or lose some abilities of insect, and also can inhibit the expression of functional gene in specific time to make the development of insect stay at a certain stage, so as to achieve the purpose of utilizing or preventing the damage of insect. The dsRNA is fed to the bemisia tabaci, so that the dsRNA has the characteristics of simplicity, convenience, easiness in operation and the like, and can be applied to the research of the bemisia tabaci.

Disclosure of Invention

The invention aims to provide a bemisia tabaci MED cryptic chromatin remodeling factor ISWI.

Still another object of the present invention is to provide a gene encoding the above diaphorina fumonis MED cryptic chromatin remodeling factor.

It is still another object of the present invention to provide a recombinant expression vector containing the above-mentioned coding gene.

It is still another object of the present invention to provide a recombinant strain containing the above-mentioned encoding gene.

The invention further aims to provide application of the bemisia tabaci MED cryptic chromatin remodeling factor ISWI.

According to the specific embodiment of the invention, the bemisia tabaci MED recessive chromatin remodeling gene Btiswi is cloned for the first time, and the cDNA full-length nucleotide sequence is shown as SEQ ID No. 1:

ATGGTTAAAACGGGGTCTGAAAACCGGTCAGACGACGGTTCTGATGGTGAAGAATTGTCGAACGAATCATCCTCTATGGAAGCTCCGCCCGCTCCGAAAAGTCTTAAAGCAGAATTCGATAAACCTGGAGTTGACCAGAGTAAGCGCTTTGAATTCTTACTAAAACAGACCGAAATTTTCTCTCACTTCATGACGAACAGCAATAAGGATAAAACTTCCCCAACAACCACTGGAAAACCAAAAGGTAGGCCTCGGAAAGAACAACCCAAATCCTCGGACTCACCCTCTAAAGATTCTGCTGATCATCGTCACCGGAAAACAGAGCAAGAGGAAGATGAAGAACTACTGGCTGAGAGTAACGCAGCCACAAAGACCATAACCATGTTTGATTCCTCACCATTCTACATTAAAAATGGTGAATTACGAGATTACCAAGTTCGTGGTCTAAACTGGATGATTTCTCTCTTTGAAAACGGCATTAACGGTATTCTTGCCGATGAGATGGGTCTAGGTAAAACCCTTCAAACCATCTCGCTACTTGGTTACATGAAGAACTTCCGTAACATCTCTGGCCCTCATATGGTCATTGTCCCTAAGTCAACCTTGATGAACTGGATGAATGAATTCAAAAAGTGGTGTCCCTCGCTGAAAGCAGTTTGTTTAATTGGAGACCAAGAAGCTCGTAATAATTTCATCAGAGACGTTTTAATGCCTGGAGACTGGGACGTTTGTGTAACTTCTTATGAAATGATCATTCGAGAGAAAAGCACCTTGAAGAAATTTAATTGGCGTTACATGGTCATTGACGAAGCTCACCGTATTAAAAACGAGAAATCCAAGTTATCAGAAATTGTTCGAGAATTCAAGACAACCAACAGATTGCTGCTAACTGGAACTCCATTACAAAACAACCTTCATGAGTTATGGTCTCTGTTGAATTTCTTGCTACCTGATGTCTTTAATTCATCAGATGATTTTGATGCATGGTTCAATACGAATACTTGTCTTGGTGACAATGCACTTGTTGAAAGATTGCATGCAGTTTTAAGACCTTTCTTGTTGCGTCGTCTCAAGTCTGAAGTGGAAAAGCGATTGAAACCCAAAAAAGAATTAAAGGTGTATGTTGGCTTAAGTAAAATGCAAAGAGAGTGGTATACTAAAGTCCTGATGAAAGATATTGACATTGTGAATGGTGCTGGAAAAATTGAGAAAATGCGGCTTCAAAACATCCTGATGCAACTGCGAAAGTGCTGTAACCACCCGTATCTTTTTGATGGCGCTGAACCTGGTCCACCATATACAACAGATGAGCACTTGGTATTTAACTGTGGCAAAATGGTCATTCTTGATAAGCTGCTGCCGAAATTACAAGAACAAGACTCAAGGGTGCTAATTTTTAGTCAAATGACGCGTATGATTGACATCCTTGAAGATTTCTGCCACTGGCGTGGATATAAGTATTGCAGGTTAGATGGTCAAACTCCCCATGAAGATCGACAGCGGCAGATCAATGAATTTAATGCCCCAAACAGCGACAAATTCATTTTCATGTTGTCAACTCGCGCTGGTGGTCTTGGTATCAACTTGGCAACTGCAGATGTAGTTATCATTTATGATTCTGACTGGAATCCTCAAATGGACTTGCAGGCCATGGACCGAGCTCATCGTATAGGTCAGAAAAAACAAGTACGAGTTTTCCGACTAATCACCGAAAATACTGTTGAGGAAAAAATTGTTGAAAGAGCAGAAGTCAAATTACGTTTGGACAAGCTGGTCATTCAACAAGGTCGCTTAGTCGACAACAAGGCTGCTCTCCAAAAAGACGAAATGCTTAACATGATTCGGCATGGTGCCAATCATGTCTTTGCTTCAAAAGACTCAGAAATTACAGATGAAGATATTGATACAATTCTTGAGAAAGGTGAGGCTAAGACTGAAGAGATGAAGCAGAAGCTAGAAACGCTCGGGGAATCCTCTCTTCGAAATTTCACCCTCGATGCTCCCACTGAATCTGTTTATCAGTTTGAAGGGGAAGACTACCGTGAAAAGCAAAAACTCACCGGGATTGGAAATTGGATTGAGCCTCCTAAGAGAGAGAGGAAAGCAAACTATGCTGTCGATGCATATTTCCGTGAAGCGCTCCGAGTTTCAGAACCGAAAGCACCAAAAGCTCCAAGACCTCCAAAACAACCAATTGTCCAAGATTTCCAGTTCTTTCCAATGCGTCTATTTGAGCTGTTAGATCAAGAAATCTACTATTTCCGCAAGTCAGTGGGCTACCGGGTACCCAAGAACCCAGAGTTGGGTGTAGATGCAAACAAAATACAGAAAGAAGAGCAGAAGAAGATCGACGAGGCACAACCACTGACTGAAGAAGAACTGTTGGAAAAAGAAGATCTTCTGACACAAGGATTTACCAACTGGACGAAGCGTGATTTCAACCAATTTATAAAAGCTAATGAAAAATTCGGTAGAGACGATATTCACAACATTTGCAAGGAAGTCGAAGGCAAAACCCCCGAAGAAGTTATAGAGTATAGCAGTGTATTTTGGGAACGCTGTCAGGAATTACAAGATATTGAACGAATAATGGCTCAAATAGAACGTGGTGAAGCAAAAATCCAACGCCGTGCCAGTATAAAGCGAGCCTTAGATGCTAAAATGGAGAGGTATCAAGCGCCATTCCACCAGCTGAGAATATCCTATGGCACAAACAAAGGCAAAAACTACACCGAAGAAGAAGATCGGTTTTTGGTTTGTATGTTGCATCGACTTGGATTCGACAAGGAGAATGTGTATGAGGAACTCCGATCTGCAACAAGATTTGCCCCTCAGTTCCGCTTTGACTGGTTCATCAAGAGCAGAACTGCGATGGAATTGCAGCGACGATGTAACACATTAATCACACTCATTGAGCGAGAAAATCAAGAACTAGAGGAGAAAGAGAAAGCAGCTGACAAAACAAAGAACAAGCGAGGACCTCGTGCTGGCCAAGGCAAACGGAAAAGCGAAGCTAACGCTGTGGCCGATTCGAAACCAACCTCAGCTAAAAAGAAGAAAAAGAACTAA

the amino acid sequence of the gene-encoded bemisia tabaci MED cryptic chromatin remodeling factor is shown in SEQ ID NO:2, as shown in the figure:

MVKTGSENRSDDGSDGEELSNESSSMEAPPAPKSLKAEFDKPGVDQSKRFEFLLKQTEIFSHFMTNSNKDKTSPTTTGKPKGRPRKEQPKSSDSPSKDSADHRHRKTEQEEDEELLAESNAATKTITMFDSSPFYIKNGELRDYQVRGLNWMISLFENGINGILADEMGLGKTLQTISLLGYMKNFRNISGPHMVIVPKSTLMNWMNEFKKWCPSLKAVCLIGDQEARNNFIRDVLMPGDWDVCVTSYEMIIREKSTLKKFNWRYMVIDEAHRIKNEKSKLSEIVREFKTTNRLLLTGTPLQNNLHELWSLLNFLLPDVFNSSDDFDAWFNTNTCLGDNALVERLHAVLRPFLLRRLKSEVEKRLKPKKELKVYVGLSKMQREWYTKVLMKDIDIVNGAGKIEKMRLQNILMQLRKCCNHPYLFDGAEPGPPYTTDEHLVFNCGKMVILDKLLPKLQEQDSRVLIFSQMTRMIDILEDFCHWRGYKYCRLDGQTPHEDRQRQINEFNAPNSDKFIFMLSTRAGGLGINLATADVVIIYDSDWNPQMDLQAMDRAHRIGQKKQVRVFRLITENTVEEKIVERAEVKLRLDKLVIQQGRLVDNKAALQKDEMLNMIRHGANHVFASKDSEITDEDIDTILEKGEAKTEEMKQKLETLGESSLRNFTLDAPTESVYQFEGEDYREKQKLTGIGNWIEPPKRERKANYAVDAYFREALRVSEPKAPKAPRPPKQPIVQDFQFFPMRLFELLDQEIYYFRKSVGYRVPKNPELGVDANKIQKEEQKKIDEAQPLTEEELLEKEDLLTQGFTNWTKRDFNQFIKANEKFGRDDIHNICKEVEGKTPEEVIEYSSVFWERCQELQDIERIMAQIERGEAKIQRRASIKRALDAKMERYQAPFHQLRISYGTNKGKNYTEEEDRFLVCMLHRLGFDKENVYEELRSATRFAPQFRFDWFIKSRTAMELQRRCNTLITLIERENQELEEKEKAADKTKNKRGPRAGQGKRKSEANAVADSKPTSAKKKKKN

the above amino acid sequence has the conserved domain characteristics typical of the ISWI protein: ATPase domains (DEXDc:137-324aa and HELICC:474-558aa), HAND domain (705-804aa), SANT domain (805-855aa), SLIDE domain (890-984aa), and a continuous alpha helix (SP:856-889aa) connecting the SANT and SLIDE domains.

The expression mode of the Btiswi gene under temperature stress is analyzed, and the real-time fluorescent quantitative PCR result shows that the Bemisia tabaci MED cryptomorphic Btiswi gene can be over-expressed under short-time high and low temperature stress.

The invention provides application of the bemisia tabaci MED cryptomorphic chromatin remodeling gene Btiswi. RNAi is carried out on the cryptophyte of the tobacco powder MED, and the result shows that the high-temperature knockdown time of the cryptophyte MED imagoes fed with dsBtsiswi is obviously reduced, and the low-temperature cold-induced stunning recovery time is obviously increased, which indicates that the Btsiswi gene plays a key role in the temperature tolerance of the cryptophyte MED of the tobacco powder lice. The bemisia tabaci MED recessive chromatin remodeling gene Btiswi can be used for destroying the temperature tolerance of bemisia tabaci, and further can be used for preventing and treating the bemisia tabaci.

The invention clones the chromatin remodeling gene Btiswi from the hidden seeds of Bemisia tabaci MED for the first time, and defines the expression condition of the Btiswi gene in the hidden seeds of Bemisia tabaci MED under temperature stress. In addition, the reduction of the expression of the gene directly reduces the tolerance of the MED cryptic species to high and low temperatures. The obtained result lays a foundation for further defining the function of the chromatin remodeling factor in the rapid adaptation of the bemisia tabaci to the adverse environmental conditions, and provides a theoretical basis for further disclosing the rapid expansion of the hidden seeds of MED and the outbreak disaster-forming mechanism. Can be used for destroying the temperature tolerance of the bemisia tabaci, and further preventing and controlling the harm and the diffusion of the bemisia tabaci.

Drawings

FIG. 1 shows a conservative domain pattern diagram (A) of Btiswi gene of Bemisia tabaci MED and a predicted Btiswi-C end three-dimensional structure diagram (B);

FIG. 2 shows the analysis of expression pattern of Btiswi gene at gradient temperature in Bemisia tabaci MED cryptic;

FIG. 3 shows the expression level changes of Btiswi under the conditions of feeding Btiswi gene dsRNA, feeding dsEGFP, feeding 10% sucrose solution and CK;

figure 4 shows the effect of dsRNA treatment of the Btiswi gene on the heat and cold tolerance of bemisia tabaci MED cryptophyte adults: comparing the high-temperature knockdown time (A) and the low-temperature cold-induced stunning recovery time (B) of the bemisia tabaci MED cryptomorphic adults fed with Btiswi gene dsRNA, dsEGFP and 10% sucrose solution and CK.

Detailed Description

Example 1: full-length cDNA sequence clone of Bemisia tabaci MED cryptomorphic Btiswi gene

Respectively putting 200 heads of bemisia tabaci adults under different temperature stress conditions into a 1.5mL centrifuge tube, freezing the bemisia tabaci adults by using liquid nitrogen, grinding the bemisia tabaci adults into powder by using a grinding rod, extracting RNA, and storing the RNA at minus 80 ℃ for later use. The extracted RNA was reverse transcribed to synthesize cDNA according to the instructions of the full-scale gold reverse transcription kit (One-Step gDNAremoval and cDNA Synthesis SuperMix). And (3) designing a primer by taking the cDNA as a template, and carrying out PCR amplification. Primers were designed as shown in Table 1.

TABLE 1

The sequence in Table 1 is utilized to obtain the cDNA sequence of Btiswi gene with the full length of 3069bp through PCR amplification, the obtained gene has the nucleotide sequence shown as SEQ ID No. 1, and the gene codes 1022 amino acid sequences shown as SEQ ID No. 2. The conserved domain of the amino acid sequence was analyzed using an online database and found to contain structural features unique to the ISWI protein family: a DEXDc domain at the 137-324 site, a HELICC domain at the 474-558 site, a HAND domain at the 705-804 site, a SANT domain at the 805-855 site, a SLIDE domain at the 890-984 site, and an alpha helix joining the SANT-SLIDE domain at the 856-889 site. The conserved domain (A) and the predicted Btiswi-C terminal three-dimensional structure (B) of the gene are shown in figure 1.

Example 2: analysis of expression characteristics of Btiswi Gene

(1) Extracting RNA and synthesizing cDNA of bemisia tabaci adults under different temperature stresses

Selecting the preliminarily emerged Bemisia tabaci MED cryptomorphic imagoes, and carrying out stress treatment on the Bemisia tabaci imagoes at 0, 12, 26, 35 and 40 ℃. Each of the 3 biology is repeated, 3000 adults are obtained, and after the stress is finished, the adults are immediately placed in liquid nitrogen to be frozen for 3 minutes and then stored at the temperature of minus 80 ℃. RNA was extracted and reverse transcribed into cDNA according to the method of example 1.

(2) Detecting Btiswi expression quantity at different temperatures by fluorescent quantitative PCR:

primers for the Btiswi gene and two internal reference genes (EF 1-alpha, beta-tubulin) of the fluorescent quantitative PCR were designed:

iswi-QF：GCAGGTTAGATGGTCAAACTCCCC

iswi-QR：TTTTCCTCAACAGTATTTTCGGTG

EF1-α-F：TAGCCTTGTGCCAATTTCCG

EF1-α-R：CCTTCAGCATTACCGTCC

β-tub-F：TGTCAGGAGTAACGACGTGTTTG

β-tub-R：TTCGGGAACGGTAAGTGCTC

the reaction system is 20 μ L: 2 × TransStartTM Green qPCR 10.0 μ L, ROA 0.4 μ L, cDNA template 1.0 μ L, Primer-F0.4 μ L, Primer-R0.4 μ L, ddH2O 7.8. mu.L.

Reaction conditions are as follows: 30s at 95 ℃; 5s at 95 ℃, 30s at 60 ℃ and 40 cycles; and drawing a melting curve.

(3) Data analysis

The relative expression amount of the gene was calculated by the 2- Δ Δ Ct method. Data were statistically analyzed using SAS9.4 software, differences between different temperature treatments were analyzed using one-way analysis of variance (ANOVA), and Duncan's test was performed. Data are expressed as mean ± standard error with significance test level P < 0.05.

As shown in FIG. 2, real-time fluorescent quantitative PCR results show that the expression level of the MED cryptomorphic Btiswi gene is obviously increased after short-time high-temperature and low-temperature stress treatment.

Example 3: analyzing the influence of Btiswi gene on the temperature tolerance of the Bemisia tabaci MED cryptic species

3.1 Synthesis of dsRNA

(1) Primer sequences were designed to synthesize plus the T7 promoter (sequence underlined):

T7+Btiswi-F：5’-TAATACGACTCACTATAGGGCTCCGATTCACCCTCT-3’

T7+Btiswi-R：5’-TAATACGACTCACTATAGGGGTCCCAGTCTCCAGGC-3'. Synthesized by Shanghai Biotechnology service, Inc.

(2) Total RNA extraction and cDNA synthesis: the same as in example 1.

(3) And (3) carrying out PCR amplification and product purification on the T7 primer, wherein the purified PCR product is the template for synthesizing dsRNA. dsRNA was synthesized and purified using the kit, following the kit instructions.

3.2dsRNA feeding

The Parafilm membrane was previously treated with DEPC water to remove RNase. Adding dsRNA into sucrose solution with the concentration of 10%, wherein the concentration is 0.3-0.5 mu g/mu L. According to the feeding characteristics of the bemisia tabaci, the method for clamping the nutrient solution by the Parafilm membrane is correspondingly improved: taking about 200 heads of the primary eclosion bemisia tabaci adults, putting the initial eclosion bemisia tabaci adults into a glass tube with two transparent ends, covering the upper end of the glass tube with a double-layer Parafilm, adding 200 mu L of 10% sucrose solution between the two films, adding dsRNA to enable the final concentration to be 0.3-0.5 mu g/mu L, covering the lower end of the glass tube with gauze, and keeping ventilation. The periphery and the lower end of the glass tube are wrapped by black plastic, so that the bemisia tabaci can gather to a parafilm at the top end to take dsRNA better, the device is placed into an artificial climate box (the temperature is 26 +/-0.5 ℃, the illumination is carried out for 24 hours, the relative humidity is 60-70 percent), and feeding is carried out for 3 hours. Collecting the fed bemisia tabaci in a finger-type pipe, putting a group of pipe into a preheated high-temperature water bath kettle for thermal knock down, and recording the time until the bemisia tabaci cannot stand independently, wherein the treatment temperature is 45 ℃. The other group is put into a low-temperature water bath kettle for cold knock down for ten minutes and then taken out to record the cold-induced dizziness recovery time, and the treatment temperature is-5 ℃. Bemisia tabaci without any treatment (CK), fed with a 10% sucrose solution and fed with a 10% sucrose mixed solution containing dsEGFP (final concentration of dsEGFP 0.3-0.5. mu.g/. mu.L) was used as a control, and 4 biological replicates were set for each treatment.

The relative expression quantity of the gene is calculated by a 2-delta CT method, and the result is shown in figure 3, and the expression of the Btiswi gene can be obviously reduced by feeding dsBtiswi. SAS9.4 statistical software is used for analyzing the high-temperature knockdown time and the low-temperature cold-induced stunning recovery time of the Bemisia tabaci MED cryptophyte adults fed with different solutions, and the results are shown in figure 4, wherein the high-temperature knockdown time (A) of the Bemisia tabaci MED cryptophyte fed with Btiswi gene dsRNA is obviously lower than that of three control groups, and the low-temperature cold-induced stunning recovery time (B) is obviously higher than that of the control groups. Meanwhile, NCBI (http:// BLAST. NCBI. nlm. nih. gov /) BLAST shows that the fed target sequence has a sequence specific to Btiswi gene, thereby ensuring that the interference effect is generated by the Btiswi gene of the target Btiswi gene of the Bemisia tabaci MED cryptic species. Therefore, the Btiswi gene plays a key role in the temperature tolerance of the bemisia tabaci MED cryptic species.

The full-length cDNA of the Btiswi gene is cloned from the Bemisia tabaci MED cryptic species, and the fluorescent quantitative PCR shows that the Btiswi gene can be overexpressed under the stress of the adversity temperature; and finally, the Btiswi gene dsRNA is fed, so that the high-temperature knockdown time of the bemisia tabaci MED cryptophyte adults is obviously shortened, and the low-temperature cold-induced stunning recovery time is obviously prolonged. According to the specific embodiment of the invention, the test result confirms that the Btiswi gene plays a key role in the temperature tolerance of the Bemisia tabaci MED cryptic species. The invention lays a foundation for further defining the function of chromatin remodeling factors in the rapid adaptation of bemisia tabaci to adverse environmental conditions, and provides a theoretical basis for further disclosing the rapid expansion of hidden seeds of MED and the disaster-forming mechanism of outbreak. Can be used for destroying the temperature tolerance of the bemisia tabaci, and further preventing and controlling the harm and the diffusion of the bemisia tabaci.

Sequence listing

<110> institute of plant protection of Chinese academy of agricultural sciences

<120> chromatin remodeling factor ISWI, coding gene and role in diaphorina tabaci MED cryptic temperature tolerance

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3069

<212> DNA

<213> Bemisia tabaci (Bemis tabaci)

<400> 1

atggttaaaa cggggtctga aaaccggtca gacgacggtt ctgatggtga agaattgtcg 60

aacgaatcat cctctatgga agctccgccc gctccgaaaa gtcttaaagc agaattcgat 120

aaacctggag ttgaccagag taagcgcttt gaattcttac taaaacagac cgaaattttc 180

tctcacttca tgacgaacag caataaggat aaaacttccc caacaaccac tggaaaacca 240

aaaggtaggc ctcggaaaga acaacccaaa tcctcggact caccctctaa agattctgct 300

gatcatcgtc accggaaaac agagcaagag gaagatgaag aactactggc tgagagtaac 360

gcagccacaa agaccataac catgtttgat tcctcaccat tctacattaa aaatggtgaa 420

ttacgagatt accaagttcg tggtctaaac tggatgattt ctctctttga aaacggcatt 480

aacggtattc ttgccgatga gatgggtcta ggtaaaaccc ttcaaaccat ctcgctactt 540

ggttacatga agaacttccg taacatctct ggccctcata tggtcattgt ccctaagtca 600

accttgatga actggatgaa tgaattcaaa aagtggtgtc cctcgctgaa agcagtttgt 660

ttaattggag accaagaagc tcgtaataat ttcatcagag acgttttaat gcctggagac 720

tgggacgttt gtgtaacttc ttatgaaatg atcattcgag agaaaagcac cttgaagaaa 780

tttaattggc gttacatggt cattgacgaa gctcaccgta ttaaaaacga gaaatccaag 840

ttatcagaaa ttgttcgaga attcaagaca accaacagat tgctgctaac tggaactcca 900

ttacaaaaca accttcatga gttatggtct ctgttgaatt tcttgctacc tgatgtcttt 960

aattcatcag atgattttga tgcatggttc aatacgaata cttgtcttgg tgacaatgca 1020

cttgttgaaa gattgcatgc agttttaaga cctttcttgt tgcgtcgtct caagtctgaa 1080

gtggaaaagc gattgaaacc caaaaaagaa ttaaaggtgt atgttggctt aagtaaaatg 1140

caaagagagt ggtatactaa agtcctgatg aaagatattg acattgtgaa tggtgctgga 1200

aaaattgaga aaatgcggct tcaaaacatc ctgatgcaac tgcgaaagtg ctgtaaccac 1260

ccgtatcttt ttgatggcgc tgaacctggt ccaccatata caacagatga gcacttggta 1320

tttaactgtg gcaaaatggt cattcttgat aagctgctgc cgaaattaca agaacaagac 1380

tcaagggtgc taatttttag tcaaatgacg cgtatgattg acatccttga agatttctgc 1440

cactggcgtg gatataagta ttgcaggtta gatggtcaaa ctccccatga agatcgacag 1500

cggcagatca atgaatttaa tgccccaaac agcgacaaat tcattttcat gttgtcaact 1560

cgcgctggtg gtcttggtat caacttggca actgcagatg tagttatcat ttatgattct 1620

gactggaatc ctcaaatgga cttgcaggcc atggaccgag ctcatcgtat aggtcagaaa 1680

aaacaagtac gagttttccg actaatcacc gaaaatactg ttgaggaaaa aattgttgaa 1740

agagcagaag tcaaattacg tttggacaag ctggtcattc aacaaggtcg cttagtcgac 1800

aacaaggctg ctctccaaaa agacgaaatg cttaacatga ttcggcatgg tgccaatcat 1860

gtctttgctt caaaagactc agaaattaca gatgaagata ttgatacaat tcttgagaaa 1920

ggtgaggcta agactgaaga gatgaagcag aagctagaaa cgctcgggga atcctctctt 1980

cgaaatttca ccctcgatgc tcccactgaa tctgtttatc agtttgaagg ggaagactac 2040

cgtgaaaagc aaaaactcac cgggattgga aattggattg agcctcctaa gagagagagg 2100

aaagcaaact atgctgtcga tgcatatttc cgtgaagcgc tccgagtttc agaaccgaaa 2160

gcaccaaaag ctccaagacc tccaaaacaa ccaattgtcc aagatttcca gttctttcca 2220

atgcgtctat ttgagctgtt agatcaagaa atctactatt tccgcaagtc agtgggctac 2280

cgggtaccca agaacccaga gttgggtgta gatgcaaaca aaatacagaa agaagagcag 2340

aagaagatcg acgaggcaca accactgact gaagaagaac tgttggaaaa agaagatctt 2400

ctgacacaag gatttaccaa ctggacgaag cgtgatttca accaatttat aaaagctaat 2460

gaaaaattcg gtagagacga tattcacaac atttgcaagg aagtcgaagg caaaaccccc 2520

gaagaagtta tagagtatag cagtgtattt tgggaacgct gtcaggaatt acaagatatt 2580

gaacgaataa tggctcaaat agaacgtggt gaagcaaaaa tccaacgccg tgccagtata 2640

aagcgagcct tagatgctaa aatggagagg tatcaagcgc cattccacca gctgagaata 2700

tcctatggca caaacaaagg caaaaactac accgaagaag aagatcggtt tttggtttgt 2760

atgttgcatc gacttggatt cgacaaggag aatgtgtatg aggaactccg atctgcaaca 2820

agatttgccc ctcagttccg ctttgactgg ttcatcaaga gcagaactgc gatggaattg 2880

cagcgacgat gtaacacatt aatcacactc attgagcgag aaaatcaaga actagaggag 2940

aaagagaaag cagctgacaa aacaaagaac aagcgaggac ctcgtgctgg ccaaggcaaa 3000

cggaaaagcg aagctaacgc tgtggccgat tcgaaaccaa cctcagctaa aaagaagaaa 3060

aagaactaa 3069

<210> 2

<211> 1022

<212> PRT

<213> Bemisia tabaci (Bemis tabaci)

<400> 2

Met Val Lys Thr Gly Ser Glu Asn Arg Ser Asp Asp Gly Ser Asp Gly

1 5 10 15

Glu Glu Leu Ser Asn Glu Ser Ser Ser Met Glu Ala Pro Pro Ala Pro

20 25 30

Lys Ser Leu Lys Ala Glu Phe Asp Lys Pro Gly Val Asp Gln Ser Lys

35 40 45

Arg Phe Glu Phe Leu Leu Lys Gln Thr Glu Ile Phe Ser His Phe Met

50 55 60

Thr Asn Ser Asn Lys Asp Lys Thr Ser Pro Thr Thr Thr Gly Lys Pro

65 70 75 80

Lys Gly Arg Pro Arg Lys Glu Gln Pro Lys Ser Ser Asp Ser Pro Ser

85 90 95

Lys Asp Ser Ala Asp His Arg His Arg Lys Thr Glu Gln Glu Glu Asp

100 105 110

Glu Glu Leu Leu Ala Glu Ser Asn Ala Ala Thr Lys Thr Ile Thr Met

115 120 125

Phe Asp Ser Ser Pro Phe Tyr Ile Lys Asn Gly Glu Leu Arg Asp Tyr

130 135 140

Gln Val Arg Gly Leu Asn Trp Met Ile Ser Leu Phe Glu Asn Gly Ile

145 150 155 160

Asn Gly Ile Leu Ala Asp Glu Met Gly Leu Gly Lys Thr Leu Gln Thr

165 170 175

Ile Ser Leu Leu Gly Tyr Met Lys Asn Phe Arg Asn Ile Ser Gly Pro

180 185 190

His Met Val Ile Val Pro Lys Ser Thr Leu Met Asn Trp Met Asn Glu

195 200 205

Phe Lys Lys Trp Cys Pro Ser Leu Lys Ala Val Cys Leu Ile Gly Asp

210 215 220

Gln Glu Ala Arg Asn Asn Phe Ile Arg Asp Val Leu Met Pro Gly Asp

225 230 235 240

Trp Asp Val Cys Val Thr Ser Tyr Glu Met Ile Ile Arg Glu Lys Ser

245 250 255

Thr Leu Lys Lys Phe Asn Trp Arg Tyr Met Val Ile Asp Glu Ala His

260 265 270

Arg Ile Lys Asn Glu Lys Ser Lys Leu Ser Glu Ile Val Arg Glu Phe

275 280 285

Lys Thr Thr Asn Arg Leu Leu Leu Thr Gly Thr Pro Leu Gln Asn Asn

290 295 300

Leu His Glu Leu Trp Ser Leu Leu Asn Phe Leu Leu Pro Asp Val Phe

305 310 315 320

Asn Ser Ser Asp Asp Phe Asp Ala Trp Phe Asn Thr Asn Thr Cys Leu

325 330 335

Gly Asp Asn Ala Leu Val Glu Arg Leu His Ala Val Leu Arg Pro Phe

340 345 350

Leu Leu Arg Arg Leu Lys Ser Glu Val Glu Lys Arg Leu Lys Pro Lys

355 360 365

Lys Glu Leu Lys Val Tyr Val Gly Leu Ser Lys Met Gln Arg Glu Trp

370 375 380

Tyr Thr Lys Val Leu Met Lys Asp Ile Asp Ile Val Asn Gly Ala Gly

385 390 395 400

Lys Ile Glu Lys Met Arg Leu Gln Asn Ile Leu Met Gln Leu Arg Lys

405 410 415

Cys Cys Asn His Pro Tyr Leu Phe Asp Gly Ala Glu Pro Gly Pro Pro

420 425 430

Tyr Thr Thr Asp Glu His Leu Val Phe Asn Cys Gly Lys Met Val Ile

435 440 445

Leu Asp Lys Leu Leu Pro Lys Leu Gln Glu Gln Asp Ser Arg Val Leu

450 455 460

Ile Phe Ser Gln Met Thr Arg Met Ile Asp Ile Leu Glu Asp Phe Cys

465 470 475 480

His Trp Arg Gly Tyr Lys Tyr Cys Arg Leu Asp Gly Gln Thr Pro His

485 490 495

Glu Asp Arg Gln Arg Gln Ile Asn Glu Phe Asn Ala Pro Asn Ser Asp

500 505 510

Lys Phe Ile Phe Met Leu Ser Thr Arg Ala Gly Gly Leu Gly Ile Asn

515 520 525

Leu Ala Thr Ala Asp Val Val Ile Ile Tyr Asp Ser Asp Trp Asn Pro

530 535 540

Gln Met Asp Leu Gln Ala Met Asp Arg Ala His Arg Ile Gly Gln Lys

545 550 555 560

Lys Gln Val Arg Val Phe Arg Leu Ile Thr Glu Asn Thr Val Glu Glu

565 570 575

Lys Ile Val Glu Arg Ala Glu Val Lys Leu Arg Leu Asp Lys Leu Val

580 585 590

Ile Gln Gln Gly Arg Leu Val Asp Asn Lys Ala Ala Leu Gln Lys Asp

595 600 605

Glu Met Leu Asn Met Ile Arg His Gly Ala Asn His Val Phe Ala Ser

610 615 620

Lys Asp Ser Glu Ile Thr Asp Glu Asp Ile Asp Thr Ile Leu Glu Lys

625 630 635 640

Gly Glu Ala Lys Thr Glu Glu Met Lys Gln Lys Leu Glu Thr Leu Gly

645 650 655

Glu Ser Ser Leu Arg Asn Phe Thr Leu Asp Ala Pro Thr Glu Ser Val

660 665 670

Tyr Gln Phe Glu Gly Glu Asp Tyr Arg Glu Lys Gln Lys Leu Thr Gly

675 680 685

Ile Gly Asn Trp Ile Glu Pro Pro Lys Arg Glu Arg Lys Ala Asn Tyr

690 695 700

Ala Val Asp Ala Tyr Phe Arg Glu Ala Leu Arg Val Ser Glu Pro Lys

705 710 715 720

Ala Pro Lys Ala Pro Arg Pro Pro Lys Gln Pro Ile Val Gln Asp Phe

725 730 735

Gln Phe Phe Pro Met Arg Leu Phe Glu Leu Leu Asp Gln Glu Ile Tyr

740 745 750

Tyr Phe Arg Lys Ser Val Gly Tyr Arg Val Pro Lys Asn Pro Glu Leu

755 760 765

Gly Val Asp Ala Asn Lys Ile Gln Lys Glu Glu Gln Lys Lys Ile Asp

770 775 780

Glu Ala Gln Pro Leu Thr Glu Glu Glu Leu Leu Glu Lys Glu Asp Leu

785 790 795 800

Leu Thr Gln Gly Phe Thr Asn Trp Thr Lys Arg Asp Phe Asn Gln Phe

805 810 815

Ile Lys Ala Asn Glu Lys Phe Gly Arg Asp Asp Ile His Asn Ile Cys

820 825 830

Lys Glu Val Glu Gly Lys Thr Pro Glu Glu Val Ile Glu Tyr Ser Ser

835 840 845

Val Phe Trp Glu Arg Cys Gln Glu Leu Gln Asp Ile Glu Arg Ile Met

850 855 860

Ala Gln Ile Glu Arg Gly Glu Ala Lys Ile Gln Arg Arg Ala Ser Ile

865 870 875 880

Lys Arg Ala Leu Asp Ala Lys Met Glu Arg Tyr Gln Ala Pro Phe His

885 890 895

Gln Leu Arg Ile Ser Tyr Gly Thr Asn Lys Gly Lys Asn Tyr Thr Glu

900 905 910

Glu Glu Asp Arg Phe Leu Val Cys Met Leu His Arg Leu Gly Phe Asp

915 920 925

Lys Glu Asn Val Tyr Glu Glu Leu Arg Ser Ala Thr Arg Phe Ala Pro

930 935 940

Gln Phe Arg Phe Asp Trp Phe Ile Lys Ser Arg Thr Ala Met Glu Leu

945 950 955 960

Gln Arg Arg Cys Asn Thr Leu Ile Thr Leu Ile Glu Arg Glu Asn Gln

965 970 975

Glu Leu Glu Glu Lys Glu Lys Ala Ala Asp Lys Thr Lys Asn Lys Arg

980 985 990

Gly Pro Arg Ala Gly Gln Gly Lys Arg Lys Ser Glu Ala Asn Ala Val

995 1000 1005

Ala Asp Ser Lys Pro Thr Ser Ala Lys Lys Lys Lys Lys Asn

1010 1015 1020

Claims

1. A method for shortening the high-temperature knockdown time of the aleyrodid tobacco plant MED cryptic species and prolonging the low-temperature cold-induced stunning recovery time of the aleyrodid tobacco plant MED cryptic species is characterized by comprising the step of feeding dsRNA of an aleyrodid tobacco plant MED cryptic chromatin remodeling gene Btiswi to the aleyrodid tobacco plant MED cryptic species, wherein the nucleotide sequence of the chromatin remodeling gene is shown as SEQ ID No. 1,

the dsRNA is obtained by amplifying the following primers:

Btiswi-F：5’-TAATACGACTCACTATAGGGCTCCGATTCACCCTCT-3’，

Btiswi-R：5’-TAATACGACTCACTATAGGGGTCCCAGTCTCCAGGC-3’。