CN108060146A

CN108060146A - Migratory locusts peroxiredoxin PRX5 and its encoding gene and application

Info

Publication number: CN108060146A
Application number: CN201810140906.1A
Authority: CN
Inventors: 涂雄兵; 张泽华; 崔栋楠; 赵海龙; 王广君; 农向群
Original assignee: Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Priority date: 2018-02-11
Filing date: 2018-02-11
Publication date: 2018-05-22

Abstract

The invention discloses migratory locusts peroxiredoxin PRX5 and its encoding gene and applications.The present invention has cloned migratory locusts peroxiredoxin gene PRX5 from migratory locusts first, and primer is designed to migratory locusts peroxiredoxin gene PRX5, the dsRNA for migratory locusts peroxiredoxin gene PRX5 has been synthesized, and dsRNA has been imported into migratory locusts with injection, RNAi is carried out to migratory locusts peroxiredoxin gene PRX5.Also migratory locusts peroxiredoxin PRX5 is successfully prepared by the method for eukaryotic expression in the present invention, and migratory locusts peroxiredoxin PRX5 importing migratory locusts are verified its function with injection.The result shows that：The controllable migratory locusts diapause of migratory locusts peroxiredoxin PRX5.The present invention is deeper into understanding that migratory locusts diapauze mechanism, the new biological pesticide preparation of initiative provide fundamental basis.

Description

Migratory locusts peroxiredoxin PRX5 and its encoding gene and application

Technical field

The invention belongs to biological technical fields, and in particular to migratory locusts peroxiredoxin PRX5 and its encoding gene are with answering With.

Background technology

Peroxiredoxin family (Peroxiredoxins) represents the peroxiredoxins that a kind of mercaptan relies on, work( It can be the content for reducing hydrogen peroxide, alkyl hydroperoxide and peroxynitric acid salt in tissue.PRX5 is also referred to as Prx V, is only A mammal atypia 2-Cys peroxiredoxins one by one.

Human body PRX5 is a kind of peroxidase, is found in mitochondria and peroxisome, thus it is speculated that may be with work Property oxygen/active nitrogen (ROS/RNS) generation it is related.In addition, in saccharomyces cerevisiae (Saccharomyces cerevisiae) line grain The human body PRX5 expressed in body or cytoplasmic matrix protects yeast cells to be coerced from oxidative stress；In CHO and HT-22 cells After being overexpressed human body PRX5 in the cytoplasmic matrix of cytoplasmic matrix, mitochondria and nucleus and Tenocyte cell, due to leaking cruelly Caused cell death greatly reduces in exogenous hydrogen peroxide；In mouse brain, the human body PRX5 recombinants of external source can be with Protection brain cell is protected from the excitotoxin pressure of exitotoxicity induction；PRX5 can also protect cell resistance mitochondria Or nuclear DNA damage；In addition, inhibiting in cell after the expression of PRX5, cell is easier oxidation caused by being subject to hydrogen peroxide Damage and Apoptosis；In the embryo of XenoPus, human body PRX5 genes heterogenous expression can protect cell to be induced from alcohol The injury of the ROS/RNS of generation；It not only can be in the ortholog PRX5 of drosophila (Drosophila melanogaster) Oxidation reaction injury and Apoptosis are resisted, the service life of drosophila can also be increased.

The content of the invention

The technical problem to be solved by the present invention is to how pest control.

In order to solve the above-mentioned technical problem, present invention firstly provides a kind of peroxiredoxins.

Peroxiredoxin provided by the invention derives from migratory locusts, entitled PRX5, be it is following a) or b) or c) or D) protein：

A) amino acid sequence is the protein shown in sequence 2；

B) fused protein obtained in N-terminal and/or C-terminal the connection label of the protein shown in sequence 2；

C) by the amino acid sequence shown in sequence 2 by one or several amino acid residues substitution and/or missing and/or Add the obtained protein with identical function；

D) with sequence 2 shown in homology of the amino acid sequence with 75% or more than 75% and the egg with identical function White matter.

Wherein, sequence 2 is made of 185 amino acid residues.

In order to which the protein in making a) is convenient for purifying, the amino terminal of protein that can be in sequence table shown in sequence 2 or The upper label as shown in Table 1 of carboxyl terminal connection.

The sequence of table 1, label

Label	Residue	Sequence
			Poly-Arg	5-6 (being usually 5)	RRRRR
Poly-His	2-10 (being usually 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

It is above-mentioned c) in protein PRX5, the substitution of one or several amino acid residues and/or missing and/or addition To be no more than the substitution of 10 amino acid residues and/or missing and/or addition.

It is above-mentioned c) in protein PRX5 can be artificial synthesized, also can first synthesize its encoding gene, then carry out biological expression and obtain It arrives.

It is above-mentioned c) in protein PRX5 encoding gene can by will in the DNA sequence dna shown in sequence 1 lack one or The codons of several amino acid residues and/or carry out the missense mutation of one or several base-pairs and/or at its 5 ' end and/or The coded sequence that 3 ' ends connect the label shown in table 1 obtains.

In order to solve the above-mentioned technical problem, the present invention also provides with the relevant biomaterial of PRX5 protein.

Any one of provided by the invention with the relevant biomaterial of PRX5 protein is following A 1) to A8)：

A1 the nucleic acid molecules of PRX5 protein) are encoded；

A2 A1) is contained) expression cassettes of the nucleic acid molecules；

A3 A1) is contained) recombinant vectors of the nucleic acid molecules；

A4 A2) is contained) recombinant vector of the expression cassette；

A5 A1) is contained) recombinant microorganisms of the nucleic acid molecules；

A6 A2) is contained) recombinant microorganism of the expression cassette；

A7 A3) is contained) recombinant microorganism of the recombinant vector；

A8 A4) is contained) recombinant microorganism of the recombinant vector.

In above-mentioned biomaterial, A1) nucleic acid molecules for it is following 1) or 2) or 3) shown in gene：

1) its coded sequence is cDNA molecules or the genomic DNA molecule shown in sequence 1；

2) nucleotide sequence with 1) limiting has 75% or more than 75% homogeneity, and encodes the cDNA of PRX5 protein Molecule or genomic DNA molecule；

1) or 2) 3) and the cDNA molecules of PRX5 protein are encoded with the nucleotide sequence hybridization limited under strict conditions Or genomic DNA molecule.

Wherein, the nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；The nucleic acid molecules also may be used To be RNA, such as mRNA or hnRNA.

Wherein, sequence 1 is made of 558 nucleotide, the amino acid sequence shown in coded sequence 2.

Those of ordinary skill in the art can easily adopt by known method, such as the side of orthogenesis and point mutation Method is mutated the nucleotide sequence of the coding PRX5 protein of the present invention.Those have and this hair by manually modified The nucleotide sequence 75% of bright isolated PRX5 or the nucleotide of higher homogeneity, as long as encoding PRX5 and with identical Function is the nucleotide sequence derived from the present invention and is equal to the sequence of the present invention.

Term " homogeneity " used herein refers to the sequence similarity with native sequence nucleic acid." homogeneity " includes and this hair Shown in bright coded sequence 2 amino acid sequence composition protein nucleotide sequence have 75% higher or 85% or Higher or 90% higher or 95% or higher homogeneity nucleotide sequence.Homogeneity can with the naked eye or computer software It is evaluated.Using computer software, homogeneity between two or more sequences can use percentage (%) to represent, can be with For evaluating the homogeneity between correlated series.

Above-mentioned 75% or more than 75% homogeneity can be 80%, 85%, 90% or more than 95% homogeneity.

In order to solve the above-mentioned technical problem, the present invention also provides PRX5 protein or the new applications of above-mentioned biomaterial.

The present invention provides PRX5 protein or above-mentioned biomaterial in following a1)-a8) in it is any in application：

A1 Insect Diapause) is regulated and controled；

A2 the product of regulation and control Insect Diapause) is prepared；

A3) pest control；

A4 the product of pest control) is prepared；

A5 Insect Diapause rate) is improved；

A6 the product for improving Insect Diapause rate) is prepared；

A7 Insect Diapause rate) is reduced；

A8) preparing reduces the product of Insect Diapause rate.

In above application, the insect or pest are migratory locusts；The raising Insect Diapause rate is raising migratory locusts ovum Diapause rate； The reduction Insect Diapause rate is reduction migratory locusts ovum Diapause rate.

In order to solve the above-mentioned technical problem, the present invention also provides a kind of methods for improving Insect Diapause rate.

The step of method provided by the invention for improving Insect Diapause rate includes peroxiredoxin importing insect, from And it realizes and improves Insect Diapause rate.

In the above method, the peroxiredoxin is PRX5 protein.

In the above method, the insect is migratory locusts, and the raising Insect Diapause rate is raising migratory locusts ovum Diapause rate.

In order to solve the above-mentioned technical problem, the present invention also provides a kind of methods for reducing Insect Diapause rate.

The method provided by the invention for reducing Insect Diapause rate includes reducing the expression quantity of peroxiredoxin in insect And/or the step of activity, so as to fulfill Insect Diapause rate is reduced.

In the above method, the expression quantity of peroxiredoxin and/or the method for activity are will to press down in the reduction insect The substance of the encoding gene expression of peroxiredoxin imports insect in insect processed；

The substance of the encoding gene expression for inhibiting peroxiredoxin in insect is peroxide in inhibition insect The dsRNA of the encoding gene expression of reductase.

In the above method, the peroxiredoxin is PRX5 protein；Inhibit the coding of PRX5 protein in insect The dsRNA of gene expression is to be made of the nucleotide shown in the nucleotide shown in sequence in sequence table 3 and its reverse complementary sequence Double-stranded RNA.

In the above method, the mode of the importing is injection.

In the above method, the insect is migratory locusts, and the reduction Insect Diapause rate is reduction migratory locusts ovum Diapause rate.

Application of the above method in pest control falls within protection scope of the present invention.

To solve the above-mentioned problems, the present invention finally additionally provides the object for the encoding gene expression for inhibiting PRX5 protein Matter.

The substance of the encoding gene expression provided by the invention for inhibiting PRX5 protein is as shown in sequence in sequence table 3 The double-stranded RNA of nucleotide composition shown in nucleotide and its reverse complementary sequence.

The substance of the encoding gene expression of above-mentioned inhibition PRX5 protein is in pest control and/or raising Insect Diapause rate Application fall within protection scope of the present invention.

In above application, the insect or pest are migratory locusts.

The present invention has cloned migratory locusts peroxiredoxin gene PRX5 from migratory locusts first, and to migratory locusts peroxide also Nitroreductase gene PRX5 designs primer, has synthesized the dsRNA for migratory locusts peroxiredoxin gene PRX5, and with injection DsRNA is imported into migratory locusts, RNAi is carried out to migratory locusts peroxiredoxin gene PRX5.The present invention also passes through the side of eukaryotic expression Migratory locusts peroxiredoxin PRX5 is successfully prepared in method, and imports migratory locusts peroxiredoxin PRX5 with injection Migratory locusts verify its function.The result shows that：The controllable migratory locusts diapause of migratory locusts peroxiredoxin PRX5.The present invention is deeper into reason The new biological pesticide preparation of solution migratory locusts diapauze mechanism, initiative is provided fundamental basis.

Description of the drawings

Fig. 1 is migratory locusts peroxiredoxin gene PRX5 jamming effectiveness under long-day conditions.

Fig. 2 is migratory locusts peroxiredoxin gene PRX5 jamming effectiveness under the conditions of short-day.

Locust egg Diapause rate detects after Fig. 3 is RNAi migratory locusts peroxiredoxin genes PRX5.

Fig. 4 is bacterium colony growing way.

Fig. 5 is PCR screening positive clone electrophoretograms.1-10：The saccharomycete Genomic PCR products of 1-10, M：Marker 5000。

Fig. 6 be bacterial cell disruption after purify SDS-PAGE.

Fig. 7 is the SDS-PAGE of PRX5 albumen.

Fig. 8 is influence of injection 5 albumen of PRX to locust egg Diapause rate.

Specific embodiment

Experimental method used in following embodiments is conventional method unless otherwise specified.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

Quantitative test in following embodiments, is respectively provided with three repeated experiments, and results are averaged.

Selected insect source in following embodiments：Migratory locusts ovum is collected in Tianjin Huanghua, and mostly generation is continuously raised in laboratory.Migratory locusts Ovum is hatched in intelligent growth cabinet, 30 DEG C of temperature, relative humidity 60%.Rearing conditions：Diapause inducement condition, photoperiod L： D=10h：14h, 28 DEG C of temperature；Non- diapause condition, photoperiod L：D=16h：8h, 28 DEG C.Feeding wheat seedling.

Main agents and reagent in following embodiments：Separation agent (invitrogen is original-pack), RNA spin column (Quan Shijin), plastic recovery kit (Axygen), EX Taq archaeal dna polymerases (Takara), T4DNA connect Connect the reagents such as enzyme (Takara), pGEM-T Easy Vector Systems (Promega), absolute ethyl alcohol, isopropanol, glycerine It is domestic analysis alcohol.

Key instrument in following embodiments：Superclean bench (Shanghai Bo Xun Industrial Co., Ltd.s), east victory dragon ETC- 811PCR instrument (Beijing Eastwin Scientific, Inc.), Germany's Sigma 3K15 refrigerated centrifuges (German sigma from Scheming Co., Ltd), NanoPhotometer micro-spectrophotometers (German IMPLEN companies), HPX-9052MBE digital displays electricity Hot incubator (Shanghai Bo Xun Industrial Co., Ltd.s), THZ-D Desk type constant-temperatureoscillator oscillators (magnificent biochemical instrument factory), vortex oscillator (Shanghai Bo Xun Industrial Co., Ltd.s cure by QL-901 (its woods Bell instrument manufacturing of Haimen City), high-pressure sterilizing pot YXQ-LS-50SII Treat instrument factory), electric conversion instrument (Eppendorf), high speed freezing centrifuge (Sigma), assay balance (Sartorius), constant temperature Incubator ZHWY-103B (Shanghai intelligence city).

Pichia pastoris GS115 and Yeast expression carrier pPIC9K in following embodiments are purchased from Suzhou Hong Xun companies.

The formula of culture medium in following embodiments：

1) YPD culture mediums：20g peptones, 10g dusty yeasts, 20g glucose add H₂O is settled to 1L, 115 DEG C of high pressure sterilizations 20min (every liter of solid medium needs plus 15g agar powders).

2) 1M D-glucitols：182g D-glucitols, add H₂O is settled to 1L, 121 DEG C of high pressure sterilization 20min.

3) MD tablets (100mL)：Agarose 2g (20g/L) is added in 80mL water, 121 DEG C sterilize 20 minutes, treat that temperature is low In 60 DEG C, 10 × YNB 10mL (13.4g/L), 10 × glucose 10mL (20g/L), 500 × biotin are added on super-clean bench 0.2mL(4×10^-4g/L)。

4)BMGY(1L)：10g yeast extracts, 20g peptones, 3g K₂HPO₄, 11.8g KH₂PO₄, 890mL is added water to, 121 DEG C sterilize 20 minutes, add in 10 × YNB100mL (13.4g/L), 500 × life on super-clean bench after temperature is less than 60 DEG C Object element 1mL (4 × 10^-4G/L), glycerine 10mL.

5)BMMY(1L)：10g yeast extracts, 20g peptones, 3g K₂HPO₄, 11.8g KH₂PO₄, 890mL is added water to, 121 DEG C sterilize 20 minutes, are then down to after temperature after 60 DEG C on super-clean bench and add in 10 × YNB100mL (13.4g/L), and 500 × biotin 1mL (4 × 10^-4G/L), methanol 5mL.

The acquisition of embodiment 1, migratory locusts peroxiredoxin PRX5 and its encoding gene

1st, the extraction of migratory locusts total serum IgE

WithSeparation agent extracts the RNA of migratory locusts tissue sample, is as follows：

1) 2ml homogenizers are put in baking oven, 160 DEG C, 3 hours, are cooled to room temperature spare.

2) homogenizer is placed on ice, adds in 1mlSeparation agent and 100-200mg migratory locusts tissue, grind Mill.

3) homogenate is transferred in 1.5ml centrifuge tubes, is stored at room temperature 5min.4 DEG C, 13000r centrifugations 5min.

4) supernatant is transferred in clean 1.5ml centrifuge tubes, adds in 200 μ l chloroforms, whirlpool concussion 15s.It is placed at room temperature for 5min.4 DEG C, 13000r centrifugations 10min.

5) 400 μ l supernatants are drawn to be transferred in new 1.5ml centrifuge tubes, adds in 200 μ l chloroforms, whirlpool concussion 30s.Room temperature Place 5min.4 DEG C, 13000r centrifugations 10min.

6) 300 μ l supernatants are drawn, add in 300 μ l isopropanols, whirlpool concussion 30s is transferred in RNA spin column, 10min is stood on ice.

7) 4 DEG C, 13000r centrifugation 2min abandon filtrate.

8) 600 μ l RNA washsolution are added in, suction, which is beaten, washs sediment, 4 DEG C, and 13000r centrifugation 2min abandon filter Liquid.600 μ l RNA washsolution are added in again, and suction, which is beaten, washs sediment, 4 DEG C, and 13000r centrifugation 2min abandon filtrate. 4 DEG C, 13000r skies remove unnecessary alcohol, air blow drying 3min from 3min.

9) a new collecting pipe is replaced, the RNase- of 50 μ l, 65 DEG C of preheatings is added in into RNA spin column Free-water, heat puts 5min under waste heat, 4 DEG C, 13000r centrifugations 3min.

10) filter liquor is collected, RNA concentration and OD260/280 values are detected with NanoPhotometer micro-spectrophotometers, Confirm RNA mass.Meanwhile take 2 μ l extract RNA, agarose gel electrophoresis detection, remaining RNA be stored in -20 DEG C it is spare.

2nd, reverse transcription

Use PrimeScript^TMThe reverse transcription of 1st strand cDNA Synthesis Kit reverse transcription reagent box obtains CDNA is as follows：

1) 10 μ l systems are configured：Oligo dT Primer(50μM)1μl、dNTP Mixture(10mM each)1μl、 total RNA<5μl、RNase Free dH₂O supplies system to 10 μ l.

2) after 65 DEG C of heat preservation 5min, rapid cooling on ice.

3) 20 μ l reaction solutions are configured：5×PrimeScript Buffer 4μl、RNase Inhibitor(400U/ul) 0.5μl(20units)、PrimeScript RTase(200U/ul)1μl(200units)、RNase Free dH₂O supplies body It is to 20 μ l.

4) slow mixing.

5) 42 DEG C of heat preservation 30-60min.

6) 95 DEG C of heat preservation 5min, inactivate enzyme, place on ice, -20 DEG C of preservation cDNA.

3rd, the acquisition of migratory locusts peroxiredoxin PRX5 and its encoding gene

1) design of primers

Migratory locusts transcript profile according to measuring early period obtains PRX5 gene orders, and PRX5 full length genes are designed using DNAMAN8 Primer or fragment primer.The primer of design is as follows：

PRX5-1F：CATATATAAATGCTGCCGATTTAC；

PRX5-1R：CTACAAAGGAAGTTTGTCAGCC.

2) PCR reacts

Using migratory locusts cDNA as template, PCR amplification is carried out with primer PRX5-1F/PRX5-1R, obtains PCR product.

PCR reaction systems are following (50 μ l of total volume)：1 μ l of cDNA templates, dNTP 4 μ l, 10 × Buffer, 5 μ l, leading 1 μ l of object, 1 μ l of rear primer, 0.25 μ l of Taq enzyme, ddH₂O 38μl。

PCR reaction conditions are as follows：95℃3min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min30s, 35 Xun Huans；72℃ 10min；4 DEG C of preservations.

3) PCR product recycling, clone, sequencing

Electrophoresis 3-1) is carried out on 1% Ago-Gel for preparing PCR product in TAE, when object tape separation is preferable, Blob of viscose where cutting object tape with blade is put into sterile centrifuge tube.Plastic recovery kit (Axygen) recovery purifying is used again Object tape, recovery purifying process are carried out with reference to kit specification.

PGEM-T Easy carriers 3-2) are connected after PCR product recycling, obtain recombinant vector.Linked system is as follows：T4DNA 1 μ l of ligase, 2 × buffer, 5 μ l, 1 μ l of pGEM-T Easy, 3 μ l of PCR recovery products.Condition of contact：6 are connected at room temperature A hour.

3-3) the preparation and conversion of competent cell

In 1.5ml centrifuge tubes, 33.3 μ l Trans1-t1 competent cells are added in, place 15min, 42 DEG C of water-baths on ice 90s places 10min on ice.The liquid LB culture solutions of 500 μ l are added in each 1.5ml centrifuge tubes, 37 DEG C, 200rpm shakes bacterium 2h.After shaking bacterium, 100 μ l bacterium solutions are drawn into 1 ‰ AMP LB solid mediums, 37 DEG C of overnight incubations.Picking individual colonies are in 2ml's There are the 1 ‰ AMP LB fluid nutrient mediums of 1ml in centrifuge tube, in pipe.37 DEG C, 200rpm shakes bacterium 3-6h, observes growing state.

3-4) bacterium solution PCR

To 3-3) in bacterium solution carry out PCR verifications, bacterium solution PCR reaction systems (50 μ l of total volume) are as follows：1 μ l of bacterium solution, 4 μ l of dNTP, 10 × Buffer, 5 μ l, 1 μ l of preceding primer, 1 μ l of rear primer, 0.25 μ l of Taq enzyme, ddH₂O 38μl。

Reaction condition is as follows：95℃3min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min30s, 35 Xun Huans；72℃10min； 4 DEG C of preservations.

Positive colony bacterial strain is sent to Shanghai Sangon Biological Engineering Technology And Service Co., Ltd and carries out sequencing and to surveying Sequence result is analyzed.

Sequencing result shows：PCR amplification obtain size be 558bp DNA fragmentation, nucleotide sequence as shown in sequence 1, By the unnamed gene shown in sequence 1 be migratory locusts peroxiredoxin gene PRX5, coding peroxiredoxin ammonia Base acid sequence is named as migratory locusts peroxiredoxin PRX5 as shown in sequence 2, by the amino acid sequence shown in sequence 2.

Embodiment 2, the dsRNA of migratory locusts peroxiredoxin gene PRX5 and its application in migratory locusts are prevented

First, the synthesis of dsRNA

Using T7RiboMAX^TMExpress RNAi System kits synthesize dsRNA.It is as follows：

1) synthesis of dsRNA primers

Primer is designed according to the genetic fragment cloned, amplification target fragment is 600bp or so, is drawn at the 5' ends of primer Enter T7 promoters.Primer sequence is as follows：

PRX5-2F：5’-TAATACGACTCACTATAGGCATATATAAATGCTGCCGATTTAC-3’；

PRX5-2R：5’-TAATACGACTCACTATAGGCTACAAAGGAAGTTTGTCAGCC-3’.

2) preparation of DNA profiling

Bacterium solution plasmid is extracted with kit, with the plasmid (recombinant vector in embodiment 1) containing genetic fragment for template, is adopted PCR amplification is carried out with PRX5-2F and PRX5-2R, obtains the target fragment containing T7 promoter sequences.

PCR reaction systems are following (50 μ l of total volume)：1 μ l of plasmid, dNTP 4 μ l, 10 × Buffer, 5 μ l, 1 μ of preceding primer L, rear 1 μ l of primer, 0.25 μ l of Taq enzyme, ddH₂O 38μl。

PCR reaction conditions are as follows：95℃3min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min, 35 Xun Huans；72℃10min； 4 DEG C of preservations.

PCR product is recycled, and target DNA concentration is detected with NanoPhotometer micro-spectrophotometers, recycles concentration 150ng/ μ l need to be more than.

3) synthesis of dsRNA

Using T7RiboMAX^TMThe DNA in-vitro transcriptions of recycling are synthesized migratory locusts by Express RNAi System kits The dsRNA of peroxiredoxin gene PRX5, and dsRNA concentration is detected with NanoPhotometer micro-spectrophotometers, DsRNA concentration is adjusted to 1000ng/ μ l, obtains dsRNA solution (solvent is Nucleause free water).

The dsRNA for the migratory locusts peroxiredoxin gene PRX5 that the present invention obtains is double-stranded RNA, by positive-sense strand and antisense Chain forms, and the nucleotides sequence of positive-sense strand is classified as sequence 3, and the nucleotides sequence of antisense strand is classified as the reverse complementary sequence of sequence 3. The dsRNA of above-mentioned migratory locusts peroxiredoxin gene PRX5 can also be obtained by artificial synthesized method.By migratory locusts peroxidating The dsRNA of object reductase gene PRX5 is named as dsPRX5.

4) dsRNA of GFP is compareed

The dsRNA of synthesis control GFP according to the method described above, is named as dsGFP, obtaining concentration is by the dsRNA for compareing GFP The dsGFP solution of 1000ng/ μ l.The dsRNA of GFP is compareed as double-stranded RNA, is made of positive-sense strand and antisense strand, positive-sense strand Nucleotides sequence is classified as sequence 4, and the nucleotides sequence of antisense strand is classified as the reverse complementary sequence of sequence 4.Synthesis GFP dsRNA's draws Object is as follows：

GFP-1F：5’-TAATACGACTCACTATAGGTACGACTCACTATAGGAGTAAAGG-3’；

GFP-1R：5’-TAATACGACTCACTATAGGTAGGTTTGTATAGTTCATCCATACC-3’.

2nd, applications of the dsRNA in migratory locusts are prevented

1st, experimental method

DsRNA is imported in locust body.It is as follows：Respectively in long illumination (non-diapause condition, photoperiod L：D= 16h：8h, 28 DEG C) and short photoperiod (diapause condition, photoperiod L：D=10h：Migratory locusts 14h) are raised under condition (28 DEG C of temperature), are used The micro syringe of 10 μ l draws the dsPRX5 solution (experimental group) that 10 μ l concentration are 1000ng/ μ l and the (control of dsGFP solution Group), in migratory locusts female adult pest first day section being injected into respectively between the third and fourth uromere of migratory locusts female adult pest abdomen of emergence Between in film, the syringe needle of syringe is parallel with abdomen, avoids damage to the internal organ tissues of locust.Long-day and short-day condition Under, experimental group and control group inject 25 female adult pests respectively.After injecting 36h, each processing takes 5 female adult pests at random, and dissection obtains Take migratory locusts metapedes, fat-body and ovary tissue.

2nd, real-time fluorescence quantitative PCR

The total serum IgE of migratory locusts different tissues is extracted, Takara reverse transcription reagent box synthesis cDNA detects PRX5 gene expressions Amount.Using actin genes as reference gene.Primer sequence is as follows：

actin-F：GTTACAAACTGGGACGACAT；

actin-R：AGAAAGCACAGCCTGAATAG；

PRX5-3F：TGCTGCCGATTTACTCTTTGAC；

PRX5-3R：TGGAAGGTGTGTCTTAGAACAACC.

As a result as depicted in figs. 1 and 2.As can be seen from Figure：Under the conditions of long illumination condition and short photoperiod, PRX5 genes exist Relative expression levels in each tissue of experimental group have significant difference (P ＜ 0.05) with control group, and are below control group. Under the conditions of long illumination and short photoperiod, the expression quantity of the PRX5 genes in the migratory locusts of dsPRX5 experimental groups significantly reduces, explanation DsPRX5 successfully disturbs the expression of PRX5 genes during migratory locusts are respectively organized.

3rd, migratory locusts Diapause rate counts

The ovum (locust egg) for the migratory locusts production for injecting dsPRX5 or dsGFP under the conditions of long illumination and short photoperiod is taken to be placed in respectively Hatch under the conditions of 27 DEG C, count larvae number D1, remaining ovum is placed in 4 DEG C and preserves one month, it is therefore an objective to termination of diapause, then 32 DEG C hatching, counts larvae number D2, and remaining ovum is unfertilized egg or dead ovum, then locust egg Diapause rate=D2/ (D1+D2) × 100%.

The results are shown in Figure 3.As can be seen from Figure：It is non-stagnant under long illumination condition after disturbing migratory locusts female adult pest PRX5 genes It educates locust egg all to hatch, hatching rate is unchanged, and Diapause rate is 0, illustrates the variation of PRX5 gene transcription levels to non-Diapausing egg Hatching rate is without influence；Migratory locusts filial generation ovum Diapause rate declines compared with the control group under the conditions of short photoperiod, and there were significant differences (P ＜ 0.05).Illustrating that PRX5 genes participate in regulation and control migratory locusts diapause, when PRX5 gene transcription levels decline, migratory locusts ovum Diapause rate declines, and During PRX5 gene transcription level increases, migratory locusts ovum Diapause rate increases.

The expression and its functional verification of embodiment 3, PRX5 albumen

First, the expression of PRX5 albumen

1st, the structure of recombinant expression plasmid and linearisation

1) useCodon optimization software optimization PRX5 gene orders, and synthesized by Suzhou Hong Xun companies PRX5 genes after optimization, the nucleotide sequence of the PRX5 genes after optimization is as shown in sequence 5.After the optimization shown in sequence 5 PRX5 genes insertion pPIC9K expression vectors EcoRI and NotI restriction enzyme sites between, obtain recombinant expression plasmid pPIC9K- PRX5。

2) the recombinant expression plasmid pPIC9K-PRX5 in step 1) is linearized, the plasmid linearized.Linearly Change system is as follows：6 μ g of recombinant expression plasmid pPIC9K-PRX5,10 × Buffer, 10 μ l, 6 μ l of Sac I, H₂O supplies system Total volume is to 100 μ l.2 times of volume absolute ethyl alcohol precipitation recycling after linearisation, with 30 μ l ddH₂O dissolves.

2nd, the structure of recombinant yeast and identification

1) preparation of Pichia pastoris GS115 competent cell

1-1) glycerine of Pichia pastoris GS115 freezes bacterium and draws YPD tablets, and 30 DEG C are cultivated 2-3 days, choose monoclonal in 50ml 25-28 DEG C of overnight incubation in YPD culture mediums.

1-2) next day collects thalline when OD long to 1.0 or so with sterile 50ml centrifuge tubes, 1600g centrifugation 5min. With the sterile ddH of 30ml or so₂O is resuspended, and 1600g centrifugation 5min collect thalline, and repetition is washed twice.

It 1-3) is resuspended with the sterile 1M D-glucitols of 30ml or so, 1500g centrifugation 5min collect thalline.With 1ml 1M D-glucitol is resuspended, and is placed in spare on ice.

2) the electricity conversion of linearization plasmid

200 μ l Pichia pastoris GS115 competent cells 2-1) are taken, add in 30 μ l linearization plasmids, electricity is transferred to after mixing and is turned In cup (d=0.2cm), after placing several minutes on ice, electric shock (voltage in electroporation is put into：1680V shocks by electricity the time：5ms), it is electric After hitting, 1ml YPD culture mediums are added immediately, are gently blown and beaten for several times, the yeast after electricity is turned is drawn onto in 1.5ml EP pipes, is put on ice It puts several minutes.

2-2) EP pipes are put into after being incubated 1h in 28 DEG C of incubators and are coated on MD tablets.Flat-plate bacterial colony growing way is observed after 48h. Bacterium colony growing way is as shown in Figure 4.

3) extracting of genome

From MD tablets among each 10 monoclonals of picking to the single tube containing 4ml YPD fluid nutrient mediums, 28 DEG C of cultures 36h.Taking 500 μ l bacterium solutions, thalline were collected by centrifugation into 1.5ml EP pipes, uses TIANamp Yeast DNA Kit yeast genes The genome of group DNA extraction kit (Tiangeng biology) extraction saccharomycete.

4) PCR screening positive clones

When using PPIC9K, 5 ' AOX can be selected in F ends universal primer, and R ends universal primer is 3 ' AOX.PCR system is as follows： ddH₂40 μ l of O, 10 × Taq buffer, 5 μ l, 1 μ l of dNTP (10mM), 5 ' AOX (20pM), 1 μ l, 3 ' AOX (20pM), 1 μ l, mould 1 μ l of plate genome, 1 μ l of Taq DNA polymerase.PCR response procedures：94℃5min；94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C 1min, totally 28 cycle；72℃5min.

The results are shown in Figure 5 for PCR screening positive clones.The genome of host strain in itself can amplify 2.2kb's or so Segment, positive colony should be two bands, i.e., size is the genomic fragment and target fragment of 2.2kb, take 1/2/3/4/5 each five kinds Bacterium solution carries out glycerine and protects bacterium.

3rd, the induced expression PRX5 albumen of recombination yeast

1) picking individual colonies on YPD tablets are placed in the test tube containing 50ml BMGY culture mediums, 28 DEG C, 250- 300rpm is cultivated, until OD600 reaches 2-6 (24-36h).

2) 1500-3000rpm centrifuges 5min at room temperature, collects thalline, and thalline is resuspended with 40ml BMMY culture mediums.

3) step 2 is accredited as positive clone's bacterium solution to be homogeneously disposed in the test tube equipped with 4 bottles of 500ml BMMY culture mediums, It is positioned over 28 DEG C, continued growth on the shaking table of 250-300rpm.

4) per 100% methanol is added into culture medium for 24 hours to final concentration of 1.0%, 72h is co-cultured.

5) 12000rpm centrifuges 10min, and separation supernatant precipitation, 4 DEG C of preservation bacterium solutions, -20 DEG C freeze thalline.

4th, the purifying of PRX5 albumen

1) fermented liquid supernatant purifies

It collects supernatant and carries out ni-sepharose purification, wire feeding Ni-IMAC.Equilibrium liquid：20mM Tris, 500mM NaCl, pH8.0；Eluent：20mM Tris, 500mM NaCl, 500mM imidazole, pH8.0.Respectively using containing 20mM/ 4 kinds of eluents of 50mM/200mM/500mM imidazole are eluted, and eluent is collected according to absorption peak.On zymotic fluid Clearly after purification, destination protein is not detected, therefore thalline is crushed with being purified.

2) bacterial cell disruption and purifying

With broken bacterium buffer solution：20mM Tris, 500mM NaCl, 20mM imidazoles, pH8.01) progress ultrasound after thalline is resuspended Ripple crushes, and ultrasonication condition is as follows：450W power crushes 4s, is spaced 6s, totally 300 Xun Huan.Broken 4 DEG C of thalline, 12000rpm centrifuges 20min, collects supernatant and carries out Ni-IMAC (5ml) purifying, wire feeding Ni-IMAC.Equilibrium liquid：20mM Tris, 500mM NaCl, 20mM imidazole, pH8.0；Eluent：20mM Tris, 500mM NaCl, 500mM Imidazole, pH8.0.2 containing 50mM/200mMimidazole kinds of eluents is used to be eluted respectively, according to absworption peak Value collects eluent.SDS-PAGE detects broken loading bacterium solution respectively, column leakage liquid and 50mM/200mM/imidazole excessively is washed De- liquid.

The result shows that：SDS-PAGE detects biobelt (Fig. 6), and consideration may be since moieties internal disulfide bonds are formed Special construction causes, and reducing agent (DDT) is added to destroy after disulfide bond, single band (Fig. 7) is presented in Reduced samples, the band is big Small about 30KDa, it is substantially bigger than normal than destination protein molecular weight, thus it is speculated that may express not to be removed in intracellular signal peptide causes.

5th, the concentration of PRX5 albumen

The PRX5 albumen of purifying 4mL 10KD albumen super filter tube is centrifuged, concentration is concentrated into as 2.675mg/mL, obtains PRX5 protein solutions.

2nd, application of the PRX5 albumen in migratory locusts are prevented

Respectively in long illumination (non-diapause condition, photoperiod L：D=16h：8h, 28 DEG C) and short photoperiod (diapause condition, light week Phase L：D=10h：Migratory locusts 14h) are raised under condition (28 DEG C of temperature), drawing 10 μ l concentration with the micro syringe of 10 μ l is The PRX5 protein solutions (experimental group) of 2.675mg/mL are sprouted wings first day in migratory locusts female adult pest and are injected into migratory locusts female adult pest abdomen The third and fourth uromere between coria in, the syringe needle of syringe is parallel with abdomen, avoids damage to the internal of locust Tissue.Using 10 μ l buffer solutions, (for solvent as water, solute and concentration are as follows simultaneously：20mM PB, 500mM NaCl, pH7.8) conduct pair According to.Ovum (locust egg) juxtaposition for the migratory locusts production that PRX5 protein solutions or buffer solution are injected under the conditions of long illumination and short photoperiod is taken respectively Hatch under the conditions of 27 DEG C, count larvae number D1, remaining ovum is placed in 4 DEG C and preserves one month, it is therefore an objective to termination of diapause, then 32 DEG C of hatchings, count larvae number D2, and remaining ovum is unfertilized egg or dead ovum, then locust egg Diapause rate=D2/ (D1+D2) × 100%.

The results are shown in Figure 8.As can be seen from the figure：Under long illumination condition, experimental group locust egg Diapause rate and control group without Significant difference, locust egg are all hatched, and Diapause rate is 0, illustrate PRX5 albumen on non-diapause migratory locusts egg hatching rate without influence；It is short Locust egg Diapause rate is compared with control group under illumination condition, after injection PRX5 albumen dramatically increases, PRX5 eggs under the conditions of Diapause inducement White level increases, and locust egg Diapause rate improves.Illustrate the controllable migratory locusts diapause of PRX5 albumen.

Sequence table

<110>Plant Protection institute, Chinese Academy of Agricultral Sciences

<120>Migratory locusts peroxiredoxin PRX5 and its encoding gene and application

<160>5

<170>PatentIn version 3.5

<210>1

<211>558

<212>DNA

<213>Artificial sequence (Artificial Sequence)

<400>1

atgctgccga tttactcttt gacggccgtc aatactacga agactttgtt gaaacagttt 60

tgtagatcgt ttcacgcaag tagcatcatg ggactgaagg tcggcgacaa attgccatcg 120

gttgaactgt atgaaaataa tcctaccaat aaagttaatc ttgaaaaatt gctgagtaac 180

aaaaaggctg tcgtgttcgc tgtacctggt gcatttacac ctggttgttc taagacacac 240

cttccaggat acgtagaaaa ggcagacgag ttgaaaaaga agggaattga tgaaatcatt 300

tgtgtctccg tgaatgatcc atttgtcatg gatgcgtggg gaaaggagca caaggcgacc 360

ggaaaggtcc ggatgctggc tgatcctgat gcatcattca caaaagcatt ggaactggaa 420

acaaatttac cacctttggg gggtactcgt tcaaaacggt attcaatgat aattgaaaat 480

ggagtagtta agtcattaaa tgttgagcct gatggcacag gcctatcatg ttctttggct 540

gacaaacttc ctttgtag 558

<210>2

<211>185

<212>PRT

<213>Artificial sequence (Artificial Sequence)

<400>2

Met Leu Pro Ile Tyr Ser Leu Thr Ala Val Asn Thr Thr Lys Thr Leu

1 5 10 15

Leu Lys Gln Phe Cys Arg Ser Phe His Ala Ser Ser Ile Met Gly Leu

20 25 30

Lys Val Gly Asp Lys Leu Pro Ser Val Glu Leu Tyr Glu Asn Asn Pro

35 40 45

Thr Asn Lys Val Asn Leu Glu Lys Leu Leu Ser Asn Lys Lys Ala Val

50 55 60

Val Phe Ala Val Pro Gly Ala Phe Thr Pro Gly Cys Ser Lys Thr His

65 70 75 80

Leu Pro Gly Tyr Val Glu Lys Ala Asp Glu Leu Lys Lys Lys Gly Ile

85 90 95

Asp Glu Ile Ile Cys Val Ser Val Asn Asp Pro Phe Val Met Asp Ala

100 105 110

Trp Gly Lys Glu His Lys Ala Thr Gly Lys Val Arg Met Leu Ala Asp

115 120 125

Pro Asp Ala Ser Phe Thr Lys Ala Leu Glu Leu Glu Thr Asn Leu Pro

130 135 140

Pro Leu Gly Gly Thr Arg Ser Lys Arg Tyr Ser Met Ile Ile Glu Asn

145 150 155 160

Gly Val Val Lys Ser Leu Asn Val Glu Pro Asp Gly Thr Gly Leu Ser

165 170 175

Cys Ser Leu Ala Asp Lys Leu Pro Leu

180 185

<210>3

<211>605

<212>DNA

<213>Artificial sequence (Artificial Sequence)

<400>3

uaauacgacu cacuauaggc auauauaaau gcugccgauu uacucuuuga cggccgucaa 60

uacuacgaag acuuuguuga aacaguuuug uagaucguuu cacgcaagua gcaucauggg 120

acugaagguc ggcgacaaau ugccaucggu ugaacuguau gaaaauaauc cuaccaauaa 180

aguuaaucuu gaaaaauugc ugaguaacaa aaaggcuguc guguucgcug uaccuggugc 240

auuuacaccu gguuguucua agacacaccu uccaggauac guagaaaagg cagacgaguu 300

gaaaaagaag ggaauugaug aaaucauuug ugucuccgug aaugauccau uugucaugga 360

ugcgugggga aaggagcaca aggcgaccgg aaagguccgg augcuggcug auccugaugc 420

aucauucaca aaagcauugg aacuggaaac aaauuuacca ccuuuggggg guacucguuc 480

aaaacgguau ucaaugauaa uugaaaaugg aguaguuaag ucauuaaaug uugagccuga 540

uggcacaggc cuaucauguu cuuuggcuga caaacuuccu uuguagccua uagugagucg 600

uauua 605

<210>4

<211>769

<212>DNA

<213>Artificial sequence (Artificial Sequence)

<400>4

uaauacgacu cacuauaggu acgacucacu auaggaguaa aggagaagaa cuuuucacug 60

gaguugugac aauucuuguu gaauuagaug gugauguuaa uggucacaaa uuuucuguua 120

guggagaggg ugaaggugau gcaacauacg gaaaacuuac ccuuaaauuu auuuguacua 180

cuggaaaacu accuguuccc uggccaacac uuguuacuac uuugacuuau gguguucaau 240

guuuuucaag auacccagau cacaugaaac ggcacgacuu uuucaagagu gcaaugcccg 300

aagguuaugu acaagaaaga acuauuuuuu ucaaagauga cgguaacuac aagacacgug 360

cugaaguuaa guuugaaggu gauacccuug uuaauagaau cgaguuaaaa gguauugauu 420

uuaaagaaga uggaaacauu cuuggacaca aauuggaaua caacuauaac ucacacaaug 480

uauacauuau ggcagacaaa caaaagaaug gaaucaaagu uaacuucaaa auuagacaca 540

acauugaaga uggaaguguu caacuagcag accauuauca acaaaauacu ccaauuggcg 600

auggcccugu ucuuuuacca gacaaccauu accuguccac acaaucugcu cuuucuaaag 660

aucccaacga aaagagagac cauauggugc uucuugaguu uguaacagcu gcugguauua 720

cacacgguau ggaugaacua uacaaaccua ccuauaguga gucguauua 769

<210>5

<211>558

<212>DNA

<213>Artificial sequence (Artificial Sequence)

<400>5

gaattcatgc tgccaatcta ctctttgacc gccgttaaca ccaccaagac cctgctgaag 60

cagttttgca gatccttcca cgcttcctct atcatgggtt tgaaggtcgg agataagttg 120

ccatccgttg agctgtacga gaacaaccca accaacaagg tcaacctgga gaagttgctg 180

tccaacaaga aggccgttgt tttcgcagtt ccaggagctt tcactccagg ttgttctaag 240

acccacttgc caggttacgt tgaaaaggca gacgagctga agaagaaggg tatcgacgag 300

atcatttgcg tctccgttaa cgacccattc gttatggacg cttggggtaa ggaacataag 360

gctacaggta aggttagaat gttggccgat ccagacgctt ctttcactaa ggctctggag 420

ttggagacca atttgccacc attgggaggt accagatcca agagatactc catgatcatc 480

gagaacggtg tcgtcaagtc tttgaacgtt gagccagacg gtacaggttt gtcttgttcc 540

ttggctgata agttgccatt gcatcatcat catcatcatt aagcggccgc 590

Claims

1. protein is following protein a) or b) or c) or d)：

A) amino acid sequence is the protein shown in sequence 2；

C) by the amino acid sequence shown in sequence 2 by the substitution of one or several amino acid residues and/or missing and/or addition The obtained protein with identical function；

D) with sequence 2 shown in homology of the amino acid sequence with 75% or more than 75% and the albumen with identical function Matter.

Any one of 2. it is following A 1 with the relevant biomaterial of protein described in claim 1) to A8)：

A1 the nucleic acid molecules of protein described in claim 1) are encoded；

A2 A1) is contained) expression cassettes of the nucleic acid molecules；

A3 A1) is contained) recombinant vectors of the nucleic acid molecules；

A4 A2) is contained) recombinant vector of the expression cassette；

A6 A2) is contained) recombinant microorganism of the expression cassette；

A7 A3) is contained) recombinant microorganism of the recombinant vector；

A8 A4) is contained) recombinant microorganism of the recombinant vector.

3. relevant biological material according to claim 2, it is characterised in that：A1) nucleic acid molecules for it is following 1) or 2) Or 3) shown in gene：

2) nucleotide sequence with 1) limiting has 75% or more than 75% homogeneity, and encodes albumen described in claim 1 The cDNA molecules or genomic DNA molecule of matter；

1) or 2) 3) and protein described in claim 1 is encoded with the nucleotide sequence hybridization limited under strict conditions CDNA molecules or genomic DNA molecule.

4. the biomaterial described in protein described in claim 1 or Claims 2 or 3 is in following a1)-a8) in it is any In application：

A1 Insect Diapause) is regulated and controled；

A2 the product of regulation and control Insect Diapause) is prepared；

A3) pest control；

A4 the product of pest control) is prepared；

A5 Insect Diapause rate) is improved；

A6 the product for improving Insect Diapause rate) is prepared；

A7 Insect Diapause rate) is reduced；

A8) preparing reduces the product of Insect Diapause rate.

5. it is a kind of improve Insect Diapause rate method, including by peroxiredoxin import insect the step of, so as to fulfill carrying High Insect Diapause rate.

6. according to the method described in claim 5, it is characterized in that：The peroxiredoxin is described in claim 1 Protein.

7. a kind of method for reducing Insect Diapause rate, expression quantity and/or activity including reducing peroxiredoxin in insect The step of, so as to fulfill Insect Diapause rate is reduced.

8. according to the method described in claim 7, it is characterized in that：The expression quantity for reducing peroxiredoxin in insect And/or the method for activity is that the substance that the encoding gene for inhibiting peroxiredoxin in insect is expressed is imported insect；

Or, it is described inhibit insect in peroxiredoxin encoding gene expression substance for inhibit insect in peroxide also The dsRNA of the encoding gene expression of protoenzyme；

Or, the peroxiredoxin is protein described in claim 1；

Or, the dsRNA of the encoding gene expression for inhibiting peroxiredoxin in insect is as shown in sequence in sequence table 3 Nucleotide and its reverse complementary sequence shown in nucleotide composition double-stranded RNA；

Or, the mode of the importing is injection.

It is as the core shown in sequence in sequence table 3 9. inhibiting the substance of the encoding gene expression of protein described in claim 1 The double-stranded RNA of nucleotide composition shown in thuja acid and its reverse complementary sequence.

10. application according to claim 4 or any methods of claim 5-8, it is characterised in that：The insect Or pest is migratory locusts.