CN108060147A - Migratory locusts protein tyrosine kinase PTK and its encoding gene and application - Google Patents
Migratory locusts protein tyrosine kinase PTK and its encoding gene and application Download PDFInfo
- Publication number
- CN108060147A CN108060147A CN201810140810.5A CN201810140810A CN108060147A CN 108060147 A CN108060147 A CN 108060147A CN 201810140810 A CN201810140810 A CN 201810140810A CN 108060147 A CN108060147 A CN 108060147A
- Authority
- CN
- China
- Prior art keywords
- sequence
- protein
- insect
- tyrosine kinase
- ptk
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N57/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
- A01N57/10—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds
- A01N57/16—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds containing heterocyclic radicals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
- C12Y207/01112—Protein-tyrosine kinase (2.7.1.112)
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Agronomy & Crop Science (AREA)
- Pest Control & Pesticides (AREA)
- Plant Pathology (AREA)
- Dentistry (AREA)
- Environmental Sciences (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses migratory locusts protein tyrosine kinase PTK and its encoding gene and applications.The present invention has cloned migratory locusts protein tyrosine kinase gene PTK from migratory locusts first, and primer is designed to migratory locusts protein tyrosine kinase gene PTK, it has synthesized to be used for the dsRNA for disturbing migratory locusts protein tyrosine kinase gene PTK, and dsRNA has been imported into migratory locusts with injection, RNAi is carried out to migratory locusts protein tyrosine kinase gene PTK.The result shows that：The controllable migratory locusts diapause of migratory locusts protein tyrosine kinase PTK.The present invention is deeper into understanding that migratory locusts diapauze mechanism, the new biological pesticide preparation of initiative provide fundamental basis.
Description
Technical field
The invention belongs to biological technical fields, and in particular to migratory locusts protein tyrosine kinase PTK and its encoding gene are with answering
With.
Background technology
Migratory locusts are farming and animal husbandry Severe pests, overwintering with embryonic diapause, belong to facultative diapause insect.Diapause inducement external condition has
Temperature, photoperiod etc..At present it has been reported that diapause regulatory mechanism have molecular regulation, hormone regulating and controlling, biological clock regulation and control and energy
Amount regulation and control.Comparison is it is generally accepted that insulin signaling regulates and controls.The signal path is related to the various features of diapause, such as inhibits life
It grows, extends the service life, inhibits metabolism, Fat Accumulation, resistance of reverse enhancing.The tyrosine phosphorus of signaling molecule in insulin signaling pathway
Acidification can adjust insulin signaling, such as the phosphorylation of insulin receptor and insulin receptor substrate.
Protein tyrosine kinase (protein tyrosine kinase, PTK) is a kind of catalytic protein tyrosine phosphorylation
Kinases, a variety of substrate protein white matter tyrosine residue phosphorylations can be catalyzed, in cell growth, multiplication, differentiation have important work
With.Show that mammal correlative study protein tyrosine kinase (Proteintyrosine kinase, PTK) can participate in carefully
The balance regulation of intracellular protein tyrosine, but the diapause regulation and control whether PTK participates in insect have not been reported.
The content of the invention
The technical problem to be solved by the present invention is to how pest control.
In order to solve the above-mentioned technical problem, present invention firstly provides a kind of protein tyrosine kinases.
Protein tyrosine kinase source provided by the invention migratory locusts, entitled PTK, be it is following a) or b) or c) or d)
Protein：
A) amino acid sequence is the protein shown in sequence 2；
B) fused protein obtained in N-terminal and/or C-terminal the connection label of the protein shown in sequence 2；
C) by the amino acid sequence shown in sequence 2 by one or several amino acid residues substitution and/or missing and/or
Add the obtained protein with identical function；
D) with sequence 2 shown in homology of the amino acid sequence with 75% or more than 75% and the egg with identical function
White matter.
Wherein, sequence 2 is made of 298 amino acid residues.
In order to which the protein in making a) is convenient for purifying, the amino terminal of protein that can be in sequence table shown in sequence 2 or
The upper label as shown in Table 1 of carboxyl terminal connection.
The sequence of table 1, label
It is above-mentioned c) in protein PTK, the substitution of one or several amino acid residues and/or missing and/or addition
To be no more than the substitution of 10 amino acid residues and/or missing and/or addition.
It is above-mentioned c) in protein PTK can be artificial synthesized, also can first synthesize its encoding gene, then carry out biological expression and obtain
It arrives.
It is above-mentioned c) in protein PTK encoding gene can by will in the DNA sequence dna shown in sequence 1 lack one or several
The codon of a amino acid residue and/or carry out the missense mutation of one or several base-pairs and/or at its 5 ' end and/or 3 '
The coded sequence that end connects the label shown in table 1 obtains.
In order to solve the above-mentioned technical problem, the present invention also provides with the relevant biomaterial of PTK protein.
Any one of provided by the invention with the relevant biomaterial of PTK protein is following A 1) to A8)：
A1 the nucleic acid molecules of PTK protein) are encoded；
A2 A1) is contained) expression cassettes of the nucleic acid molecules；
A3 A1) is contained) recombinant vectors of the nucleic acid molecules；
A4 A2) is contained) recombinant vector of the expression cassette；
A5 A1) is contained) recombinant microorganisms of the nucleic acid molecules；
A6 A2) is contained) recombinant microorganism of the expression cassette；
A7 A3) is contained) recombinant microorganism of the recombinant vector；
A8 A4) is contained) recombinant microorganism of the recombinant vector.
In above-mentioned biomaterial, A1) nucleic acid molecules for it is following 1) or 2) or 3) shown in gene：
1) its coded sequence is cDNA molecules or the genomic DNA molecule shown in sequence 1；
2) nucleotide sequence with 1) limiting has 75% or more than 75% homogeneity, and encodes the cDNA of PTK protein
Molecule or genomic DNA molecule；
1) or 2) 3) and the cDNA molecules of PTK protein are encoded with the nucleotide sequence hybridization limited under strict conditions
Or genomic DNA molecule.
Wherein, the nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；The nucleic acid molecules also may be used
To be RNA, such as mRNA or hnRNA.
Wherein, sequence 1 is made of 1104 nucleotide, the amino acid sequence shown in coded sequence 2.
Those of ordinary skill in the art can easily adopt by known method, such as the side of orthogenesis and point mutation
Method is mutated the nucleotide sequence of the coding PTK protein of the present invention.Those have and this hair by manually modified
The nucleotide sequence 75% of bright isolated PTK or the nucleotide of higher homogeneity, as long as encoding PTK and with identical work(
Can, it is the nucleotide sequence derived from the present invention and is equal to the sequence of the present invention.
Term " homogeneity " used herein refers to the sequence similarity with native sequence nucleic acid." homogeneity " includes and this hair
Shown in bright coded sequence 2 amino acid sequence composition protein nucleotide sequence have 75% higher or 85% or
Higher or 90% higher or 95% or higher homogeneity nucleotide sequence.Homogeneity can with the naked eye or computer software
It is evaluated.Using computer software, homogeneity between two or more sequences can use percentage (%) to represent, can be with
For evaluating the homogeneity between correlated series.
Above-mentioned 75% or more than 75% homogeneity can be 80%, 85%, 90% or more than 95% homogeneity.
In order to solve the above-mentioned technical problem, the present invention also provides PTK protein or the new applications of above-mentioned biomaterial.
The present invention provides PTK protein or above-mentioned biomaterial in following a1)-a6) in it is any in application：
A1 Insect Diapause) is regulated and controled；
A2 the product of regulation and control Insect Diapause) is prepared；
A3) pest control；
A4 the product of pest control) is prepared；
A5 Insect Diapause rate) is improved；
A6 the product for improving Insect Diapause rate) is prepared.
It is described to be regulated to improve in above application；The insect or pest are migratory locusts；The raising Insect Diapause rate is to carry
Soar locust egg Diapause rate.
In order to solve the above-mentioned technical problem, the present invention also provides a kind of methods for improving Insect Diapause rate.
The method provided by the invention for improving Insect Diapause rate includes reducing the expression quantity of protein tyrosine kinase in insect
And/or the step of activity, so as to fulfill Insect Diapause rate is improved；
The expression quantity of protein tyrosine kinase and/or the method for activity are will to inhibit albumen in insect in the reduction insect
The substance of the encoding gene expression of tyrosine kinase imports insect；
The substance of the encoding gene expression for inhibiting protein tyrosine kinase in insect is albumen junket ammonia in inhibition insect
The dsRNA of the encoding gene expression of acid kinase.
In the above method, the protein tyrosine kinase is PTK protein；Inhibit the coding base of PTK protein in insect
Because the dsRNA of expression is to be made of the nucleotide shown in the nucleotide shown in sequence in sequence table 3 and its reverse complementary sequence
Double-stranded RNA.
In the above method, the mode of the importing is injection.
In the above method, the insect is migratory locusts；The raising Insect Diapause rate is raising migratory locusts ovum Diapause rate.
Application of the above method in pest control falls within protection scope of the present invention.
To solve the above-mentioned problems, the present invention finally additionally provides the substance for the encoding gene expression for inhibiting PTK protein.
The substance of the encoding gene expression provided by the invention for inhibiting PTK protein is as shown in sequence in sequence table 3
The double-stranded RNA of nucleotide composition shown in nucleotide and its reverse complementary sequence.
The substance of the encoding gene expression of above-mentioned inhibition PTK protein is in pest control and/or raising Insect Diapause rate
Application fall within protection scope of the present invention.
In above application, the insect or pest are migratory locusts.
The present invention has cloned migratory locusts protein tyrosine kinase gene PTK from migratory locusts first, and to migratory locusts protein-tyrosine
Kinase gene PTK designs primer, has synthesized to disturb the dsRNA of migratory locusts protein tyrosine kinase gene PTK, and with injection
DsRNA is imported migratory locusts and carries out RNAi to migratory locusts protein tyrosine kinase gene PTK by method.The result shows that：Migratory locusts protein-tyrosine
The controllable migratory locusts diapause of kinases PTK.The present invention is to provide deeper into understanding migratory locusts diapauze mechanism, formulate new biological pesticide preparation
Theoretical foundation.
Description of the drawings
Fig. 1 is PTK gene jamming effectiveness under long-day conditions.
Fig. 2 is PTK gene jamming effectiveness under the conditions of short-day.
Locust egg Diapause rate detects after Fig. 3 is RNAi migratory locusts protein tyrosine kinase genes PTK.
Specific embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Quantitative test in following embodiments, is respectively provided with three repeated experiments, and results are averaged.
Selected insect source in following embodiments：Migratory locusts ovum is collected in Tianjin Huanghua, and mostly generation is continuously raised in laboratory.Migratory locusts
Ovum is hatched in intelligent growth cabinet, 30 DEG C of temperature, relative humidity 60%.Rearing conditions：Diapause inducement condition, photoperiod L：
D=10h：14h, 28 DEG C of temperature；Non- diapause condition, photoperiod L：D=16h：8h, 28 DEG C.Feeding wheat seedling.
Main agents and reagent in following embodiments：RNA separation agents (invitrogen is original-pack), RNA
Spin column (Quan Shijin), plastic recovery kit (Axygen), EX Taq archaeal dna polymerases (Takara), T4DNA ligases
(Takara), the reagents such as pGEM-T Easy Vector Systems (Promega), absolute ethyl alcohol, isopropanol, glycerine are
Domestic analysis alcohol.
Key instrument in following embodiments：Superclean bench (Shanghai Bo Xun Industrial Co., Ltd.s), east victory dragon ETC-
811PCR instrument (Beijing Eastwin Scientific, Inc.), Germany's Sigma 3K15 refrigerated centrifuges (German sigma from
Scheming Co., Ltd), NanoPhotometer micro-spectrophotometers (German IMPLEN companies), HPX-9052MBE digital displays electricity
Hot incubator (Shanghai Bo Xun Industrial Co., Ltd.s), THZ-D Desk type constant-temperatureoscillator oscillators (magnificent biochemical instrument factory), vortex oscillator
(Shanghai Bo Xun Industrial Co., Ltd.s cure by QL-901 (its woods Bell instrument manufacturing of Haimen City), high-pressure sterilizing pot YXQ-LS-50SII
Treat instrument factory).
The acquisition of embodiment 1, migratory locusts protein tyrosine kinase PTK and its encoding gene
1st, the extraction of migratory locusts total serum IgE
WithRNA separation agents extract the RNA of migratory locusts tissue sample.It is as follows：
1) 2ml homogenizers are put in baking oven, 160 DEG C, 3 hours, are cooled to room temperature spare.
2) homogenizer is placed on ice, adds in 1mlRNA separation agents and 100-200mg migratory locusts tissue, grind
Mill.
3) homogenate is transferred in 1.5ml centrifuge tubes, is stored at room temperature 5min.4 DEG C, 13000r centrifugations 5min.
4) supernatant is transferred in clean 1.5ml centrifuge tubes, adds in 200 μ l chloroforms, whirlpool concussion 15s.It is placed at room temperature for
5min.4 DEG C, 13000r centrifugations 10min.
5) 400 μ l supernatants are drawn to be transferred in new 1.5ml centrifuge tubes, adds in 200 μ l chloroforms, whirlpool concussion 30s.Room temperature
Place 5min.4 DEG C, 13000r centrifugations 10min.
6) 300 μ l supernatants are drawn, add in 300 μ l isopropanols, whirlpool concussion 30s is transferred in RNA spin column,
10min is stood on ice.
7) 4 DEG C, 13000r centrifugation 2min abandon filtrate.
8) 600 μ l RNA washsolution are added in, suction, which is beaten, washs sediment, 4 DEG C, and 13000r centrifugation 2min abandon filter
Liquid.600 μ l RNA washsolution are added in again, and suction, which is beaten, washs sediment, 4 DEG C, and 13000r centrifugation 2min abandon filtrate.
4 DEG C, 13000r skies remove unnecessary alcohol, air blow drying 3min from 3min.
9) a new collecting pipe is replaced, the RNase- of 50 μ l, 65 DEG C of preheatings is added in into RNA spin column
Free-water, heat puts 5min under waste heat, 4 DEG C, 13000r centrifugations 3min.
10) filter liquor is collected, RNA concentration and OD260/280 values are detected with NanoPhotometer micro-spectrophotometers,
Confirm RNA mass.Meanwhile take 2 μ l extract RNA, agarose gel electrophoresis detection, remaining RNA be stored in -20 DEG C it is spare.
2nd, reverse transcription
Use PrimeScriptTMThe reverse transcription of 1st strand cDNA Synthesis Kit reverse transcription reagent box obtains
cDNA.It is as follows：
1) 10 μ l systems are configured：Oligo dT Primer(50μM)1μl、dNTP Mixture(10mM each)1μl、
total RNA<5μl、RNase Free dH2O supplies system to 10 μ l.
2) after 65 DEG C of heat preservation 5min, rapid cooling on ice.
3) 20 μ l reaction solutions are configured：5×PrimeScript Buffer 4μl、RNase Inhibitor(400U/ul)
0.5μl(20units)、PrimeScript RTase(200U/ul)1μl(200units)、RNase Free dH2O supplies body
It is to 20 μ l.
4) slow mixing.
5) 42 DEG C of heat preservation 30-60min.
6) 95 DEG C of heat preservation 5min, inactivate enzyme, place on ice, -20 DEG C of preservation cDNA.
3rd, the acquisition of migratory locusts protein tyrosine kinase and its encoding gene
1) design of primers
PTK gene orders are obtained according to the migratory locusts transcript profile that early period obtains, are drawn using DNAMAN8 design PTK full length genes
Object or fragment primer.The primer of design is as follows：
PTK-1F：AAGGTGGTGGTCGCTCTTTACC；
PTK-1R：CAGAACTCCATAAGCCCAGACG.
2) PCR reacts
Using migratory locusts cDNA as template, PCR amplification is carried out with primer PTK-1F/PTK-1R, obtains PCR product.
PCR reaction systems are following (50 μ l of total volume)：1 μ l of cDNA templates, dNTP 4 μ l, 10 × Buffer, 5 μ l, leading
1 μ l of object, 1 μ l of rear primer, 0.25 μ l of Taq enzyme, ddH2O 38μl。
PCR reaction conditions are as follows：95℃3min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min30s, 35 Xun Huans；72℃
10min；4 DEG C of preservations.
3) PCR product recycling, clone, sequencing
Electrophoresis 3-1) is carried out on 1% Ago-Gel for preparing PCR product in TAE, when object tape separation is preferable,
Blob of viscose where cutting object tape with blade is put into sterile centrifuge tube.Plastic recovery kit (Axygen) recovery purifying is used again
Object tape, recovery purifying process are carried out with reference to kit specification.
PGEM-T Easy carriers 3-2) are connected after PCR product recycling, obtain recombinant vector.Linked system is as follows：T4DNA
1 μ l of ligase, 2 × buffer, 5 μ l, 1 μ l of pGEM-T Easy, 3 μ l of PCR recovery products.Condition of contact：6 are connected at room temperature
A hour.
3-3) the preparation and conversion of competent cell
In 1.5ml centrifuge tubes, 33.3 μ l Trans1-t1 competent cells are added in, place 15min, 42 DEG C of water-baths on ice
90s places 10min on ice.The liquid LB culture solutions of 500 μ l are added in each 1.5ml centrifuge tubes, 37 DEG C, 200rpm shakes bacterium
2h.After shaking bacterium, 100 μ l bacterium solutions are drawn into 1 ‰ AMP LB solid mediums, 37 DEG C of overnight incubations.Picking individual colonies are in 2ml's
There are the 1 ‰ AMP LB fluid nutrient mediums of 1ml in centrifuge tube, in pipe.37 DEG C, 200rpm shakes bacterium 3-6h, observes growing state.
3-4) bacterium solution PCR
To 3-3) in bacterium solution carry out PCR verifications, bacterium solution PCR reaction systems (50 μ l of total volume) are as follows：1 μ l of bacterium solution,
4 μ l of dNTP, 10 × Buffer, 5 μ l, 1 μ l of preceding primer, 1 μ l of rear primer, 0.25 μ l of Taq enzyme, ddH2O 38μl。
Reaction condition is as follows：95℃3min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min30s, 35 Xun Huans；72℃10min；
4 DEG C of preservations.
Positive colony bacterial strain is sent to Shanghai Sangon Biological Engineering Technology And Service Co., Ltd and carries out sequencing and to surveying
Sequence result is analyzed.
Sequencing result shows：PCR amplification obtains the DNA fragmentation that size is 1104bp, nucleotide sequence such as 1 institute of sequence
Show, be migratory locusts protein tyrosine kinase gene PTK by the unnamed gene shown in sequence 1, the protein tyrosine kinase of coding
Amino acid sequence is named as migratory locusts protein tyrosine kinase PTK as shown in sequence 2, by the amino acid sequence shown in sequence 2.
Embodiment 2, the dsRNA of migratory locusts protein tyrosine kinase gene PTK and its application in migratory locusts are prevented
First, the synthesis of dsRNA
Using T7RiboMAXTMExpress RNAi System kits synthesize dsRNA.It is as follows：
1) synthesis of dsRNA primers
Primer is designed according to the genetic fragment cloned, amplification target fragment is 600bp or so, is drawn at the 5' ends of primer
Enter T7 promoters.Primer sequence is as follows：
PTK-2F：5’-TAATACGACTCACTATAGGACGATTCACAGGAACATTGGTG-3’；
PTK-2R：5’-TAATACGACTCACTATAGGCATCTTGACAGCGACATCTATGG-3’.
2) preparation of DNA profiling
Bacterium solution plasmid is extracted with kit, with the plasmid (recombinant vector in embodiment 1) containing genetic fragment for template, is adopted
PCR amplification is carried out with PTK-2F and PTK-2R, obtains the target fragment containing T7 promoter sequences.
PCR reaction systems are following (50 μ l of total volume)：1 μ l of plasmid, dNTP 4 μ l, 10 × Buffer, 5 μ l, 1 μ of preceding primer
L, rear 1 μ l of primer, 0.25 μ l of Taq enzyme, ddH2O 38μl。
PCR reaction conditions are as follows：95℃3min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min, 35 Xun Huans；72℃10min；
4 DEG C of preservations.
PCR product is recycled, and target DNA concentration is detected with NanoPhotometer micro-spectrophotometers, recycles concentration
150ng/ μ l need to be more than.
3) synthesis of dsRNA
Using T7RiboMAXTMThe DNA in-vitro transcriptions of recycling are synthesized migratory locusts by Express RNAi System kits
The dsRNA of protein tyrosine kinase gene PTK, and dsRNA concentration is detected with NanoPhotometer micro-spectrophotometers, it will
DsRNA concentration is adjusted to 1000ng/ μ l, obtains dsRNA solution (solvent is Nucleause free water).
The dsRNA for the migratory locusts protein tyrosine kinase gene PTK that the present invention obtains is double-stranded RNA, by positive-sense strand and antisense
Chain forms, and the nucleotides sequence of positive-sense strand is classified as sequence 3, and the nucleotides sequence of antisense strand is classified as the reverse complementary sequence of sequence 3.
The dsRNA of above-mentioned migratory locusts protein tyrosine kinase gene PTK can also be obtained by artificial synthesized method.By migratory locusts albumen junket ammonia
The dsRNA of kinase gene PTK is named as dsPTK.
4) dsRNA of GFP is compareed
The dsRNA of synthesis control GFP according to the method described above, is named as dsGFP, obtaining concentration is by the dsRNA for compareing GFP
The dsGFP solution of 1000ng/ μ l.The dsRNA of GFP is compareed as double-stranded RNA, is made of positive-sense strand and antisense strand, positive-sense strand
Nucleotides sequence is classified as sequence 4, and the nucleotides sequence of antisense strand is classified as the reverse complementary sequence of sequence 4.Synthesis GFP dsRNA's draws
Object is as follows：
GFP-1F：5’-TAATACGACTCACTATAGGTACGACTCACTATAGGAGTAAAGG-3’；
GFP-1R：5’-TAATACGACTCACTATAGGTAGGTTTGTATAGTTCATCCATACC-3’.
2nd, applications of the dsRNA in migratory locusts are prevented
1st, experimental method
DsRNA is imported in locust body.It is as follows：Respectively in long illumination (non-diapause condition, photoperiod L：D=
16h：8h, 28 DEG C) and short photoperiod (diapause condition, photoperiod L：D=10h：Migratory locusts 14h) are raised under condition (28 DEG C of temperature), are used
The micro syringe of 10 μ l draws the dsPTK solution (experimental group) that 10 μ l concentration are 1000ng/ μ l and the (control of dsGFP solution
Group), in migratory locusts female adult pest first day section being injected into respectively between the third and fourth uromere of migratory locusts female adult pest abdomen of emergence
Between in film, the syringe needle of syringe is parallel with abdomen, avoids damage to the internal organ tissues of locust.Long-day and short-day condition
Under, experimental group and control group inject 25 female adult pests respectively.After injecting 36h, each processing takes 5 female adult pests at random, and dissection obtains
Take migratory locusts metapedes, fat-body and ovary tissue.
2nd, real-time fluorescence quantitative PCR
The total serum IgE of migratory locusts different tissues is extracted, Takara reverse transcription reagent box synthesis cDNA detects PTK gene expression amounts.
Using actin genes as reference gene.Primer sequence is as follows：
actin-F：GTTACAAACTGGGACGACAT；
actin-R：AGAAAGCACAGCCTGAATAG；
PTK-3F：CTAAAACAGGAAGACAAGGAAGG；
PTK-3R：TGTTGTGGCGGTGGTAGTTGA.
As a result as depicted in figs. 1 and 2.As can be seen from Figure：Under the conditions of long illumination condition and short photoperiod, PTK genes exist
Relative expression levels in each tissue of experimental group have significant difference (P ＜ 0.05) with control group, and are below control group.
Under the conditions of long illumination and short photoperiod, the expression quantity of the PTK genes in the migratory locusts of dsPTK experimental groups significantly reduces, illustrate dsPTK into
Work(disturbs the expression of PTK genes during migratory locusts are respectively organized.
3rd, migratory locusts Diapause rate counts
The ovum (locust egg) for the migratory locusts production for injecting dsPTK or dsGFP under the conditions of long illumination and short photoperiod is taken to be placed in respectively
Hatch under the conditions of 27 DEG C, count larvae number D1, remaining ovum is placed in 4 DEG C and preserves one month, it is therefore an objective to termination of diapause, then 32
DEG C hatching, counts larvae number D2, and remaining ovum is unfertilized egg or dead ovum, then locust egg Diapause rate=D2/ (D1+D2) ×
100%.
The results are shown in Figure 3.As can be seen from Figure：After disturbing migratory locusts female adult pest PTK genes, locust egg is equal under long illumination condition
All hatchings, hatching rate is unchanged, and Diapause rate is 0, illustrates the variation of PTK gene transcription levels to non-diapause migratory locusts egg hatching rate
Without influence；Migratory locusts filial generation ovum Diapause rate increases compared with the control group under the conditions of short photoperiod, and there were significant differences (P ＜ 0.05), says
Bright PTK genes participate in regulation and control migratory locusts diapause, and when PTK gene transcription levels decline, migratory locusts ovum Diapause rate then increases, and PTK genes
During transcriptional level increase, migratory locusts ovum Diapause rate reduces.
Sequence table
<110>Plant Protection institute, Chinese Academy of Agricultral Sciences
<120>Migratory locusts protein tyrosine kinase PTK and its encoding gene and application
<160>4
<170>PatentIn version 3.5
<210>1
<211>1104
<212>DNA
<213>Artificial sequence (Artificial Sequence)
<400>1
aaggtggtgg tcgctcttta cccattcaaa gcaattgaag gtggtgacat atcattggag 60
aagggtgctg agtatgaggt gcttgacgat tcacaggaac attggtggaa ggtgaaggat 120
gagcatggaa acataggtta catccctagt aactatgtga aggagaaaga attactggga 180
cttcaaaagt atgaatggta cgtcggagac atgtccaggc agagagcaga gtcacttcta 240
aaacaggaag acaaggaagg ttgctttgtg gttcggaatt catccacaaa aggtctctat 300
acactctcac tatataccaa agttcctcac ccccatgtga aacattatca cattaagcag 360
aactctcggg gagaattttt cctgtctgag aagcactgct gcagctccat cccagacctg 420
gtcaactacc accgccacaa cagtggcggc ctcgcatcaa ggctcaaggc gagcccctgt 480
gaccgccctg ttcctgccac tgctggcctc agccatgata agtgggagat cgacccacaa 540
gaactgatgt tgttggaaga gctcggttct gggcagttcg gtgtcgtgcg acgtggcaag 600
tggcgcggat ccatagatgt cgctgtcaag atgatgaagc agggtactat gtcagaagat 660
gacttcattg aggaggcgaa agtcatgaca cgactgcagc atctcaactt ggtccaattg 720
tatggtgtgt gcagcaagca ccgaccaatc tacattgtta cggagtacat gcgccacggc 780
tctctgctca actacctccg ccgacacgag gcctcactcg gtggcaacac cggcctgctg 840
ctcgacatgt gcatacaagt gtgcaatggt atggcctact tggagcgaca caactatatt 900
cacagagacc tggcagcacg aaattgtctg gtcggttcag aaaatgttgt gaaagttgca 960
gactttggtt tagcaaggta cgttttggat gaccagtaca cgagctctgg cggcaccaag 1020
tttccaatta agtgggcacc acccgaggta ctcaactaca ccaggttttc ctcaaagtcc 1080
gacgtctggg cttatggagt tctg 1104
<210>2
<211>298
<212>PRT
<213>Artificial sequence (Artificial Sequence)
<400>2
Met Ser Arg Gln Arg Ala Glu Ser Leu Leu Lys Gln Glu Asp Lys Glu
1 5 10 15
Gly Cys Phe Val Val Arg Asn Ser Ser Thr Lys Gly Leu Tyr Thr Leu
20 25 30
Ser Leu Tyr Thr Lys Val Pro His Pro His Val Lys His Tyr His Ile
35 40 45
Lys Gln Asn Ser Arg Gly Glu Phe Phe Leu Ser Glu Lys His Cys Cys
50 55 60
Ser Ser Ile Pro Asp Leu Val Asn Tyr His Arg His Asn Ser Gly Gly
65 70 75 80
Leu Ala Ser Arg Leu Lys Ala Ser Pro Cys Asp Arg Pro Val Pro Ala
85 90 95
Thr Ala Gly Leu Ser His Asp Lys Trp Glu Ile Asp Pro Gln Glu Leu
100 105 110
Met Leu Leu Glu Glu Leu Gly Ser Gly Gln Phe Gly Val Val Arg Arg
115 120 125
Gly Lys Trp Arg Gly Ser Ile Asp Val Ala Val Lys Met Met Lys Gln
130 135 140
Gly Thr Met Ser Glu Asp Asp Phe Ile Glu Glu Ala Lys Val Met Thr
145 150 155 160
Arg Leu Gln His Leu Asn Leu Val Gln Leu Tyr Gly Val Cys Ser Lys
165 170 175
His Arg Pro Ile Tyr Ile Val Thr Glu Tyr Met Arg His Gly Ser Leu
180 185 190
Leu Asn Tyr Leu Arg Arg His Glu Ala Ser Leu Gly Gly Asn Thr Gly
195 200 205
Leu Leu Leu Asp Met Cys Ile Gln Val Cys Asn Gly Met Ala Tyr Leu
210 215 220
Glu Arg His Asn Tyr Ile His Arg Asp Leu Ala Ala Arg Asn Cys Leu
225 230 235 240
Val Gly Ser Glu Asn Val Val Lys Val Ala Asp Phe Gly Leu Ala Arg
245 250 255
Tyr Val Leu Asp Asp Gln Tyr Thr Ser Ser Gly Gly Thr Lys Phe Pro
260 265 270
Ile Lys Trp Ala Pro Pro Glu Val Leu Asn Tyr Thr Arg Phe Ser Ser
275 280 285
Lys Ser Asp Val Trp Ala Tyr Gly Val Leu
290 295
<210>3
<211>586
<212>RNA
<213>Artificial sequence (Artificial Sequence)
<400>3
uaauacgacu cacuauagga cgauucacag gaacauuggu ggaaggugaa ggaugagcau 60
ggaaacauag guuacauccc uaguaacuau gugaaggaga aagaauuacu gggacuucaa 120
aaguaugaau gguacgucgg agacaugucc aggcagagag cagagucacu ucuaaaacag 180
gaagacaagg aagguugcuu ugugguucgg aauucaucca caaaaggucu cuauacacuc 240
ucacuauaua ccaaaguucc ucacccccau gugaaacauu aucacauuaa gcagaacucu 300
cggggagaau uuuuccuguc ugagaagcac ugcugcagcu ccaucccaga ccuggucaac 360
uaccaccgcc acaacagugg cggccucgca ucaaggcuca aggcgagccc cugugaccgc 420
ccuguuccug ccacugcugg ccucagccau gauaaguggg agaucgaccc acaagaacug 480
auguuguugg aagagcucgg uucugggcag uucggugucg ugcgacgugg caaguggcgc 540
ggauccauag augucgcugu caagaugccu auagugaguc guauua 586
<210>4
<211>769
<212>RNA
<213>Artificial sequence (Artificial Sequence)
<400>4
uaauacgacu cacuauaggu acgacucacu auaggaguaa aggagaagaa cuuuucacug 60
gaguugugac aauucuuguu gaauuagaug gugauguuaa uggucacaaa uuuucuguua 120
guggagaggg ugaaggugau gcaacauacg gaaaacuuac ccuuaaauuu auuuguacua 180
cuggaaaacu accuguuccc uggccaacac uuguuacuac uuugacuuau gguguucaau 240
guuuuucaag auacccagau cacaugaaac ggcacgacuu uuucaagagu gcaaugcccg 300
aagguuaugu acaagaaaga acuauuuuuu ucaaagauga cgguaacuac aagacacgug 360
cugaaguuaa guuugaaggu gauacccuug uuaauagaau cgaguuaaaa gguauugauu 420
uuaaagaaga uggaaacauu cuuggacaca aauuggaaua caacuauaac ucacacaaug 480
uauacauuau ggcagacaaa caaaagaaug gaaucaaagu uaacuucaaa auuagacaca 540
acauugaaga uggaaguguu caacuagcag accauuauca acaaaauacu ccaauuggcg 600
auggcccugu ucuuuuacca gacaaccauu accuguccac acaaucugcu cuuucuaaag 660
aucccaacga aaagagagac cauauggugc uucuugaguu uguaacagcu gcugguauua 720
cacacgguau ggaugaacua uacaaaccua ccuauaguga gucguauua 769
Claims (10)
1. protein is following protein a) or b) or c) or d)：
A) amino acid sequence is the protein shown in sequence 2；
B) fused protein obtained in N-terminal and/or C-terminal the connection label of the protein shown in sequence 2；
C) by the amino acid sequence shown in sequence 2 by the substitution of one or several amino acid residues and/or missing and/or addition
The obtained protein with identical function；
D) with sequence 2 shown in homology of the amino acid sequence with 75% or more than 75% and the albumen with identical function
Matter.
Any one of 2. it is following A 1 with the relevant biomaterial of protein described in claim 1) to A8)：
A1 the nucleic acid molecules of protein described in claim 1) are encoded；
A2 A1) is contained) expression cassettes of the nucleic acid molecules；
A3 A1) is contained) recombinant vectors of the nucleic acid molecules；
A4 A2) is contained) recombinant vector of the expression cassette；
A5 A1) is contained) recombinant microorganisms of the nucleic acid molecules；
A6 A2) is contained) recombinant microorganism of the expression cassette；
A7 A3) is contained) recombinant microorganism of the recombinant vector；
A8 A4) is contained) recombinant microorganism of the recombinant vector.
3. relevant biological material according to claim 2, it is characterised in that：A1) nucleic acid molecules for it is following 1) or 2)
Or 3) shown in gene：
1) its coded sequence is cDNA molecules or the genomic DNA molecule shown in sequence 1；
2) nucleotide sequence with 1) limiting has 75% or more than 75% homogeneity, and encodes albumen described in claim 1
The cDNA molecules or genomic DNA molecule of matter；
1) or 2) 3) and protein described in claim 1 is encoded with the nucleotide sequence hybridization limited under strict conditions
CDNA molecules or genomic DNA molecule.
4. the biomaterial described in protein described in claim 1 or Claims 2 or 3 is in following a1)-a6) in it is any
In application：
A1 Insect Diapause) is regulated and controled；
A2 the product of regulation and control Insect Diapause) is prepared；
A3) pest control；
A4 the product of pest control) is prepared；
A5 Insect Diapause rate) is improved；
A6 the product for improving Insect Diapause rate) is prepared.
5. a kind of method for improving Insect Diapause rate, expression quantity and/or activity including reducing protein tyrosine kinase in insect
The step of, so as to fulfill Insect Diapause rate is improved.
6. according to the method described in claim 5, it is characterized in that：The expression quantity for reducing protein tyrosine kinase in insect
And/or the method for activity is that the substance that the encoding gene for inhibiting protein tyrosine kinase in insect is expressed is imported insect；
Or, the substance of the encoding gene expression for inhibiting protein tyrosine kinase in insect is protein-tyrosine in inhibition insect
The dsRNA of the encoding gene expression of kinases；
Or, the protein tyrosine kinase is protein described in claim 1；
Or, the dsRNA of the encoding gene expression for inhibiting protein tyrosine kinase in insect is as shown in sequence in sequence table 3
Nucleotide and its reverse complementary sequence shown in nucleotide composition double-stranded RNA；
Or, the mode of the importing is injection.
7. application of the method described in claim 5 or 6 in pest control.
It is as the core shown in sequence in sequence table 3 8. inhibiting the substance of the encoding gene expression of protein described in claim 1
The double-stranded RNA of nucleotide composition shown in thuja acid and its reverse complementary sequence.
9. inhibit application of the substance of the encoding gene expression of protein described in claim 1 in pest control；
Or, application of the substance of the encoding gene expression of protein described in inhibition claim 1 in Insect Diapause rate is improved.
10. answering described in application according to claim 4 or method described in claim 5 or 6 or claim 7 or 9
With, it is characterised in that：The insect or pest are migratory locusts.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810140810.5A CN108060147A (en) | 2018-02-11 | 2018-02-11 | Migratory locusts protein tyrosine kinase PTK and its encoding gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810140810.5A CN108060147A (en) | 2018-02-11 | 2018-02-11 | Migratory locusts protein tyrosine kinase PTK and its encoding gene and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108060147A true CN108060147A (en) | 2018-05-22 |
Family
ID=62134388
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810140810.5A Pending CN108060147A (en) | 2018-02-11 | 2018-02-11 | Migratory locusts protein tyrosine kinase PTK and its encoding gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108060147A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110195073A (en) * | 2019-06-12 | 2019-09-03 | 华中农业大学 | Protein, RNA interfering and the application of a kind of trypsase precursor-gene and its coding |
| CN112094836A (en) * | 2020-09-24 | 2020-12-18 | 中国农业科学院植物保护研究所 | Migratory locust serine protease 1, and coding gene and application thereof |
-
2018
- 2018-02-11 CN CN201810140810.5A patent/CN108060147A/en active Pending
Non-Patent Citations (4)
| Title |
|---|
| NCBI: "tyrosine-protein kinase Btk29A isoform X2 [Cryptotermes secundus]", 《GENBANK DATABASE》 * |
| 朱涛涛: "马铃薯甲虫受体酪氨酸激酶基因Torso的分子克隆及功能验证", 《万方学位论文数据库》 * |
| 王洁: ""反式激活胰岛素信号调控飞蝗卵滞育"", 《万方数据库》 * |
| 陈晓昂等: "昆虫类胰岛素及其功能研究进展", 《中国生物防治学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110195073A (en) * | 2019-06-12 | 2019-09-03 | 华中农业大学 | Protein, RNA interfering and the application of a kind of trypsase precursor-gene and its coding |
| CN112094836A (en) * | 2020-09-24 | 2020-12-18 | 中国农业科学院植物保护研究所 | Migratory locust serine protease 1, and coding gene and application thereof |
| CN112094836B (en) * | 2020-09-24 | 2022-11-22 | 中国农业科学院植物保护研究所 | Migratory locust serine protease 1, coding gene and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108610427A (en) | Migratory locusts diapause hormone gene and its application in regulating and controlling Insect Diapause | |
| CN109734798A (en) | Migratory locusts serpin 7 and its encoding gene and application | |
| CN107012174A (en) | Application of the CRISPR/Cas9 technologies in silkworm zinc finger protein gene mutant is obtained | |
| CN108546694A (en) | Oedaleus asiaticus B Protein-tyrosine-phosphatase PTPN4 and its encoding gene and application | |
| CN110055273B (en) | Application of GhMAH1 protein and coding gene thereof in regulating and controlling cotton fiber length | |
| CN110028566A (en) | The application of GhPRXR1 albumen and its encoding gene in regulation cottonseed oil content | |
| CN102453716B (en) | Clone and application of pig skeletal muscle specificity expression gene alpha-actin promoters | |
| CN106754948A (en) | Brown paddy plant hopper NlMLP genes, encoding proteins and its application | |
| CN108611338A (en) | Oedaleus asiaticus B lactase-Phlorizin hydrolase LPH and its encoding gene and application | |
| CN114957426A (en) | SP6RARS and application thereof in preventing and controlling blattaria insects | |
| CN108060147A (en) | Migratory locusts protein tyrosine kinase PTK and its encoding gene and application | |
| CN102187845A (en) | Transgenic method for improving silk yield | |
| CN108374003A (en) | Migratory locusts Protein-tyrosine-phosphatase PTP1B and its encoding gene and application | |
| CN109734789A (en) | Migratory locusts FK506 binding protein 46 and its encoding gene and application | |
| CN109879947A (en) | 2 gene of moso bamboo transcription factor PheDof and application | |
| CN111925429B (en) | Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm1 and coding gene application thereof | |
| CN111534501B (en) | Rhizoctonia solani MAPK protein kinase gene target fragment Rsmapk and application thereof | |
| CN108060146A (en) | Migratory locusts peroxiredoxin PRX5 and its encoding gene and application | |
| CN110295169A (en) | A kind of miRNA and its application for killing brown paddy plant hopper | |
| CN108546692A (en) | Oedaleus asiaticus B protein tyrosine kinase PTK and its encoding gene and application | |
| CN112458080B (en) | siRNA fishing method for obtaining lncRNA LOC157273 | |
| CN110791503B (en) | Low-phosphorus inducible promoter and application thereof | |
| CN109438565A (en) | Migratory locusts plug transcription factor LmFoxO and its encoding gene and application | |
| CN109913480A (en) | A kind of locust uridine diphosphate glucuronatetransferase gene and its application | |
| CN109234290B (en) | Brassica napus BnKAT2 gene and promoter and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180522 |
|
| RJ01 | Rejection of invention patent application after publication |