CN111925429B - Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm1 and coding gene application thereof - Google Patents

Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm1 and coding gene application thereof Download PDF

Info

Publication number
CN111925429B
CN111925429B CN202010741384.8A CN202010741384A CN111925429B CN 111925429 B CN111925429 B CN 111925429B CN 202010741384 A CN202010741384 A CN 202010741384A CN 111925429 B CN111925429 B CN 111925429B
Authority
CN
China
Prior art keywords
glu
leu
lys
arg
bemisia tabaci
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010741384.8A
Other languages
Chinese (zh)
Other versions
CN111925429A (en
Inventor
吕志创
冀顺霞
王晓迪
申晓娜
刘万学
万方浩
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Original Assignee
Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Plant Protection of Chinese Academy of Agricultural Sciences filed Critical Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Priority to CN202010741384.8A priority Critical patent/CN111925429B/en
Publication of CN111925429A publication Critical patent/CN111925429A/en
Application granted granted Critical
Publication of CN111925429B publication Critical patent/CN111925429B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N57/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
    • A01N57/10—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds
    • A01N57/16—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds containing heterocyclic radicals

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Insects & Arthropods (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Toxicology (AREA)
  • Genetics & Genomics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Agronomy & Crop Science (AREA)
  • Pest Control & Pesticides (AREA)
  • Plant Pathology (AREA)
  • Engineering & Computer Science (AREA)
  • Dentistry (AREA)
  • Wood Science & Technology (AREA)
  • Environmental Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention relates to the technical field of agricultural biology, in particular to a bemisia tabaci MED cryptic chromatin remodeling factor Btbrm1, and a coding gene and application thereof. The amino acid sequence of the chromatin remodeling factor Btbrm1 is shown in SEQ ID No. 2. The invention defines the expression mode of Btbrm1 gene in bemisia tabaci MED cryptic species at different temperatures. The reduction of the expression of the gene directly reduces the high temperature resistance of the hidden MED. The obtained result lays a foundation for further researching the relationship between the temperature tolerance mechanism of the hidden species of the bemisia tabaci MED and the chromatin remodeling of the epigenetic inheritance, and provides a basis for a method for controlling the harm of the bemisia tabaci by temperature adaptability in the future.

Description

Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm1 and coding gene application thereof
Technical Field
The invention relates to the technical field of agricultural biology, in particular to a bemisia tabaci MED cryptic chromatin remodeling factor Btbrm1 and an application of a coding gene thereof.
Background
Bemisia tabaci (Gennadius)) belongs to the phylum Arthropoda, Insecta, Hemiptera, Bemisia, and is an important agricultural pest worldwide. The most suitable development temperature of the bemisia tabaci is 26-30 ℃, the development critical temperature is 10.8-12.5 ℃, and the lethal high-temperature area is 37-42 ℃. 17 ℃ and 35 ℃ are the lowest and highest temperature limits for normal growth and development of bemisia tabaci. The strong temperature stress adaptability is the reason that bemisia tabaci is widely distributed in the world. With the increase of greenhouse effect, the global temperature is increasing year by year, and the tobacco whitefly can gradually expand the protection area due to the strong temperature stress adaptability, thereby providing places for resisting temperature stress and continuing populations.
With the change of global temperature, the successful adaptation of the hidden species of bemisia tabaci MED under different geographic environments has widely led people to the theoretical discussion of the invasion mechanism, and the molecular mechanism of the temperature adaptability is one of the research hotspots in recent years. The experiment for carrying out heat shock selection on bemisia tabaci shows that the survival rate of bemisia tabaci is remarkably improved within 2 generations, and the rapid improvement of the survival capability is an important strategy for survival in a severe environment. The mechanism of response of organisms to environmental variations within this short period of time is epigenetic related. Epigenetic processes increase the organism's response to the evolutionary potential for non-temperature stress and other environmental challenges, which are highly correlated with the background of global environmental warming.
Chromatin remodelling (chromatin remodelling) is one of the current research hotspots in the field of epigenetics, driving the replacement or rearrangement of nucleosomes, altering the spatial conformation of chromatin. ATP-dependent chromatin remodeling is an important epigenetic regulation mechanism for chromatin remodeling complex to utilize energy released by ATP hydrolysis to change chromatin structure, thereby regulating eukaryotic gene expression. Chromatin remodeling plays a key role in the regulation of expression of genes related to biological defense, while chromatin remodeling factor brm can participate in the regulation of environmental stress on biological adversity and plays an important role in regulating the expression of genes related to abiotic stress, but the role in temperature stress of bemisia tabaci is still unknown.
The phenomenon of RNA interference (RNAi) is an evolutionarily conserved defense mechanism against transgene or foreign virus invasion. Double-stranded RNA (dsRNA) having a sequence homologous to and complementary to mRNA, which is the transcription product of a target gene, is introduced into a cell and specifically degrades the mRNA, resulting in a loss of the corresponding functional phenotype. RNAi is widely existed in biology world, and can silence some genes in insect body by RNAi technology to enhance or lose some abilities of insect, and also can inhibit the expression of functional gene in specific time to make the development of insect stay at a certain stage, so as to achieve the purpose of utilizing or preventing the damage of insect. The dsRNA is fed to the bemisia tabaci, so that the dsRNA has the characteristics of simplicity, convenience, easiness in operation and the like, and can be applied to the research of the bemisia tabaci.
Disclosure of Invention
The invention aims to provide a bemisia tabaci MED cryptic chromatin remodeling factor.
It is yet another object of the present invention to provide bemisia MED cryptic chromatin remodeling genes.
Still another object of the present invention is to provide a recombinant expression vector of the bemisia tabaci MED cryptic chromatin remodeling gene.
Still another object of the present invention is to provide a recombinant strain containing the above-mentioned bemisia tabaci MED cryptic chromatin remodeling gene.
The invention further aims to provide application of the bemisia tabaci MED cryptic chromatin remodeling factor.
According to the specific embodiment of the invention, the bemisia tabaci MED recessive chromatin remodeling gene Btbrm1 is cloned for the first time, and the full-length nucleotide sequence of cDNA is shown as SEQ ID No. 1:
ATGGGTCCTGATAATACAAATCCGGGCCGAAATGTTTTCAGCCCGAACCAGATCCAGCAACTACGAGCCCAAATCCTTGCTTATCGGACTCTAGCACGGAATCTCCCGCTGAATCAAAGTATACCTCTCAACCCGCAGGACAAATGGATGGCACCAGAGTCGCAACCAATGCCACCTCAAGGGATGCAGCCACCTGAGCAAAATTTTAACCAGCCGTACCCCCCAAGTGAGCAAAGTGAGATGCAGATGCCCCCAGGAGCCTCGGGTCCTCCTGGGCCGCCCGGTCCTCCAATGCATATGCAGCGCCCACCTATGCCTAATTCTTCCATTCCACTTGATTCACCCTCTGCAATTAGGGGCAGATCACCCGGTCCCATAGGTCCTGGTATTCCTACAGTTGGTCCAGTTGGTCCTGGTGGGCCCGTCGGTCCAGTTGTTCCAAATTCTCATGGAATGCCTGGTCATATGATTCCTGTAGGTCCTGGAGGTCCAGTCGGTCCTGTTGGTACAATGCCTCCTGGCAGTCCTGTCCTTCCTGGTGGCCCTGTTGGTATGCCACCTCCTGGTGCAACGGTGGGTCCAGTAGCAACAGTTGGCCCCGGTCCTATACCTGTACCGGTTATCCCAGGTCCAGGAGGTCAGGTTGTTCCCATTCAACCGGGACAACCACCTCTTCCCAATCAGCAACAATTCAATCAAAAACAACAAGCCCAATTGAAACTTAATCGTGTAACTACAGTGTCTCGACCCACTGGAATAGATCCGCTTCAGTTGCTCGAAGAGAAGGAGAATCGAATTAACGCTCGAATTGCTCACCGAATGATTGAGCTGTACAATCTACCCACCAATATGTCAGAAGATTTACGAATAAAAGCACAAATAGAGCTCAAAGCGCTGCGATGTTTAAATTTCCAAAGGCAATTGAGGCGTGAAATAGTTGCCTGCACTCGACGTGACACCACTCTAGAAACTGCCGTGGACCCCAGAGCATACAAACGTATCAAGAGGCAGAGTTTGAGAGAAGCTCGTGCCACTGAAAAGCTTGAGAAACAACGAAGAATCGAAGCTGAGAGGAATCGTCGTCAGAAACACCAAGAATATTTATGTGCTGTTTTACAACATTGCAAAGACTTTAAAGACTTCCATAACAGTAACAGGACAAAATTGGTCAACATCAACAAAGCTGTACTTAATTATCATGTCAATGCTGAACGAGAACAAAAGAAAGAGCAAGAAAGAATTGAAAAGGAACGTATGCGCCGCCTGATGGCAGAAGATGAAGAAGGTTACAGGAAACTTATCGATCAGAAGAAAGACAAACGCTTGGCTTTCCTCCTTTCCCAAACAGATGAATATATCAGTAATTTAACAGAAATGGTGAAACAGCACAAGCTTGAACAAGAGCGGAAACACAAAGAAGCAATGAGAAAGAAAGAAGAACAACAAAAAGATAATGATACAGATGCGGCTGATGAAAATGAAAAAGAAAAGAGCGAGGAAGAAAAAGCAAAAGCTGAGCCTATTGTCAAAGCCCCTGAGGTGAAAAAGGAGGGGGAGAATGCTGAGGAAGCGATAGACACTGAGGAGGCGAAGCAAGTGATAACGAAAGCAAAAGCTGAAGATGACGAGTACAAAACTACATCTGAGGAGTTAAGTTATTACAGCATTGCTCACACAATATCAGAAATTGTGATGGAGCAAGCTTCCATAATGGTCAATGGTAAATTGAAAGAATATCAAATTAAAGGTCTTGAGTGGCTGGTTTCTCTGTACAATAATAATTTAAATGGCATTTTAGCAGATGAAATGGGTCTTGGCAAAACCATTCAGACAATTGCTTTAATTACTTATCTAATGGAGAAGAAAAAGCTTAATGGACCTTTCTTGATCATTGTACCCCTCTCAACTTTATCGAACTGGGTCCTCGAGTTCGAAAAATGGGCGCCCTCTGTTTCTATTGTTGCCTACAAAGGTTCACCCGGTGTCAGGCGAGCTTTGCAAAGCCAAATGAATTCATCCCTATTCAATGTTCTCATCACTACTTATGAATATGTCCTGAAGGATAAATCTGTGCTAACCAAGTTCGACTGGAAGTATATGATAATGGACGAAGGACATCGGATGAAGAACCACCATTGTAAATTGACACAAGTTTTGAATTCGCATTACAATACATCGCATCGTTTGCTTCTCACCGGCACCCCTCTTCAGAATAAACTGCCAGAATTGTGGGCCCTTTTGAATTTCCTGCTTCCCTCAATTTTCAAGTCTTGCTCCACCTTCGAGCAGTGGTTTAATGCTCCTTTTGCAACCACTGGTGAAAAGGTTGAACTTAATGAAGAAGAAACTATCCTCATTATTCGGCGTCTACATAAAGTATTGAGGCCTTTCCTTCTGCGTCGTTTGAAGAAAGAAGTAGAATCGCAGCTGCCTGATAAGGTTGAACACATTATCAAATGTGAAATGTCAGGACTTCAACGAGTTTTGTATAGACATATGCAGAGCAAAGGTGTGCTCCTTACTGATGGTTCAGAAAAAGGAAAATCAGGATCTGGTAGTACAAAGGCACTTATCAATACAATTATGCAGCTGCGGAAACTATGCAATCATCCATTCATGTTCCAAAACATTGAAGAAAAGTACTCGGAGCATGTTGGCTTCACCGCTGGTTTTGTCACTGGTCCTGATCTGTATCGCTCATCTGGGAAGTTCGAGCTACTTGATCGTATTTTGCCAAAGTTTAAGGAAACTGGTCACAAGGTTTTAATGTTCTGTCAAATGACTCAGCTCATGACTGTCCTGGAAGACTTCTTGAACTGGCGCGGTTTTACTTACCTGAGATTGGATGGCTCAACCAAATCTGAAGATCGTGGTGAGCTCCTGCGAAAATTCAATCACCCTGACAGCGAATACTTCTTATTCTTACTCAGTACCAGAGCTGGTGGTCTAGGTCTCAATTTGCAGTCCGCTGACACTGTCATCATCTTTGACTCAGATTGGAATCCTCATCAGGACTTACAAGCTCAAGACAGAGCCCATCGAATCGGACAAAAGAATGAAGTGCGTGTGCTTCGGTTGATGACGGTCAACTCAGTTGAAGAGCGTATCCTTGCTGCTGCTCGATATAAGTTGAACATGGATGAAAAGGTTATTCAAGCTGGTATGTTCGATCAGAAATCTACCGGGAGTGAACGGCAGCAGTTCTTGCATGACATCTTGCATCAGGATGAATCTGATGATGAGGAAGAAAATGAAGTACCTGATGATGAAACTGTCAACCGGATGATAGCGCGTAGTGAAGGTGAGTTCGAGTTATTCCAAAAGATGGACTTGGAAAGGCGAAGAGAAGAAGCGAAACTGGGAGCAGCACGTAAATCTCGACTGATCGAAGAATCGGAACTTCCTGCTTGGCTGATTAAAGAAGATGACGAGGTTGATGCATGGGAGTGCCAAGAAGAAGAAAATGTTCAGATGGGAAGAGGCTCCAGGGCTCGAAAAGAAGTTGATTACACTGATGGCCTCACTGAAAAGGAGTGGCTAAACATGATTGATGAAGGAATAGAGGATGAAGATGACTTGAAAGTTTCGAAAAAATCTCGCAAGCGCCGCCGAGAGAAAGATGATGAAGATGGTGGGCGGTCGAGCAAAGCATCTAGATCAAGTGATTATGAATATAAGTCTGGATCTGGTGGATCTTCAGGATCTGGTGACAAACGCCTGAGGAAACAGATGCGTAAACTGATGAACATAGTTGTTAAGTACAAAGACAGTGACCAACGAGTATTGAGTGAGCCTTTCATGAAACTGCCATCTCGAAAAGAATTACCGGACTATTATGAAGTAATCAAAAAACCTATGGATATAAAGAAAATATTGACAAAGATTGATGCTGGCAAATACAATGATCTAGATGATCTAGAAAAGGATTTCATGCAGTCATGTAAGAATGCTCAAGTGTATAACGTTGAAGGATCCCTCATTTATGAAGATTCCATTATTTTGCAATCAGTCTTCACAAACGCAAGGCAGAGATTGGACACCGAAGGAGACGGAGGTGGAGAAGAGGAAGAAGAATAG
the amino acid sequence of the tobacco whitefly MED cryptic chromatin remodeling gene Btbrm1 is shown in SEQ ID NO. 2:
MGPDNTNPGRNVFSPNQIQQLRAQILAYRTLARNLPLNQSIPLNPQDKWMAPESQPMPPQGMQPPEQNFNQPYPPSEQSEMQMPPGASGPPGPPGPPMHMQRPPMPNSSIPLDSPSAIRGRSPGPIGPGIPTVGPVGPGGPVGPVVPNSHGMPGHMIPVGPGGPVGPVGTMPPGSPVLPGGPVGMPPPGATVGPVATVGPGPIPVPVIPGPGGQVVPIQPGQPPLPNQQQFNQKQQAQLKLNRVTTVSRPTGIDPLQLLEEKENRINARIAHRMIELYNLPTNMSEDLRIKAQIELKALRCLNFQRQLRREIVACTRRDTTLETAVDPRAYKRIKRQSLREARATEKLEKQRRIEAERNRRQKHQEYLCAVLQHCKDFKDFHNSNRTKLVNINKAVLNYHVNAEREQKKEQERIEKERMRRLMAEDEEGYRKLIDQKKDKRLAFLLSQTDEYISNLTEMVKQHKLEQERKHKEAMRKKEEQQKDNDTDAADENEKEKSEEEKAKAEPIVKAPEVKKEGENAEEAIDTEEAKQVITKAKAEDDEYKTTSEELSYYSIAHTISEIVMEQASIMVNGKLKEYQIKGLEWLVSLYNNNLNGILADEMGLGKTIQTIALITYLMEKKKLNGPFLIIVPLSTLSNWVLEFEKWAPSVSIVAYKGSPGVRRALQSQMNSSLFNVLITTYEYVLKDKSVLTKFDWKYMIMDEGHRMKNHHCKLTQVLNSHYNTSHRLLLTGTPLQNKLPELWALLNFLLPSIFKSCSTFEQWFNAPFATTGEKVELNEEETILIIRRLHKVLRPFLLRRLKKEVESQLPDKVEHIIKCEMSGLQRVLYRHMQSKGVLLTDGSEKGKSGSGSTKALINTIMQLRKLCNHPFMFQNIEEKYSEHVGFTAGFVTGPDLYRSSGKFELLDRILPKFKETGHKVLMFCQMTQLMTVLEDFLNWRGFTYLRLDGSTKSEDRGELLRKFNHPDSEYFLFLLSTRAGGLGLNLQSADTVIIFDSDWNPHQDLQAQDRAHRIGQKNEVRVLRLMTVNSVEERILAAARYKLNMDEKVIQAGMFDQKSTGSERQQFLHDILHQDESDDEEENEVPDDETVNRMIARSEGEFELFQKMDLERRREEAKLGAARKSRLIEESELPAWLIKEDDEVDAWECQEEENVQMGRGSRARKEVDYTDGLTEKEWLNMIDEGIEDEDDLKVSKKSRKRRREKDDEDGGRSSKASRSSDYEYKSGSGGSSGSGDKRLRKQMRKLMNIVVKYKDSDQRVLSEPFMKLPSRKELPDYYEVIKKPMDIKKILTKIDAGKYNDLDDLEKDFMQSCKNAQVYNVEGSLIYEDSIILQSVFTNARQRLDTEGDGGGEEEEE
the amino acid sequence has the typical structural characteristics of brm protein: HSA domain (located at 352-424aa), ATPase domain (DEXDc: located at 572-764aa, HELICC at 932-1016aa), SnaC domain (located at 1111-1180aa), and Bromo domain (located at 1237-1347 aa).
The expression mode of the Btbrm1 gene under temperature stress is analyzed, and the real-time fluorescent quantitative PCR result shows that the Btbrm1 can be over-expressed under high-temperature stress, but the expression level is in a descending trend under low-temperature stress.
The invention provides application of the bemisia tabaci MED cryptic chromatin remodeling gene Btbrm 1. RNAi is carried out on the cryptophyte of the bemisia tabaci MED, and the result shows that the high-temperature knockdown time of the cryptophyte MED imagoes fed with dsBtbrm1 is obviously reduced, which indicates that the Btbrm1 gene plays a key role in the high-temperature tolerance of the cryptophyte MED of the bemisia tabaci. The bemisia tabaci MED recessive chromatin remodeling gene Btbrm1 can be used for destroying the high-temperature tolerance of bemisia tabaci, and further can be used for preventing and treating the bemisia tabaci.
The invention clones the chromatin remodeling gene Btbrm1 from the aleyrodids MED hidden seed for the first time, and defines the expression mode of the Btbrm1 gene in the aleyrodids MED hidden seed under the stress of temperature. In addition, reducing the expression of the gene directly reduces the high temperature resistance of the hidden MED. The obtained result lays a foundation for further researching the relationship between the temperature tolerance mechanism of the hidden species of the bemisia tabaci MED and the chromatin remodeling of the epigenetic inheritance, and provides a basis for a method for controlling the harm of the bemisia tabaci by temperature adaptability in the future.
Drawings
FIG. 1 conserved domain in the Bemisia tabaci MED cryptic Btbrm1 gene;
FIG. 2 shows the expression pattern analysis of Btbrm1 gene at gradient temperature in Bemisia tabaci MED cryptic;
FIG. 3 shows the expression level changes of Btbrm1 under the conditions of feeding Btbrm1 gene dsRNA, feeding dsEGFP, feeding 10% sucrose solution and CK;
figure 4 shows the effect of dsRNA treatment of Btbrm1 gene on heat resistance of bemisia tabaci MED cryptophyte adults: comparing the high-temperature knockdown time of the Bemisia tabaci MED cryptomorphic adults fed with Btbrm1 gene dsRNA, dsEGFP, 10% sucrose solution and CK.
Detailed Description
Example 1: full-length cDNA sequence clone of Bemisia tabaci MED cryptic Btbrm1 gene
Respectively putting 200 heads of bemisia tabaci adults under different temperature stress conditions into a 1.5mL centrifuge tube, freezing the bemisia tabaci adults by using liquid nitrogen, grinding the bemisia tabaci adults into powder by using a grinding rod, extracting RNA, and storing the RNA at minus 80 ℃ for later use. The extracted RNA was reverse transcribed to synthesize cDNA according to the instructions of the full-scale gold reverse transcription kit (One-Step gDNA Removal and cDNA Synthesis SuperMix). And (3) designing a primer by taking the cDNA as a template, and carrying out PCR amplification. Primers were designed as shown in table 1:
TABLE 1 primer sequences for cloning of Btbrm1 Gene full-Length cDNA
Figure BDA0002606855480000061
The sequence in Table 1 is utilized to obtain the cDNA sequence full length of the Btbrm1 gene through PCR amplification, the obtained gene has the nucleotide sequence shown in SEQ ID No.1, and the gene codes 1358 amino acid sequences shown in SEQ ID No. 2. The conserved domain analysis of the amino acid sequence encoded by the gene obtained by cloning shows that the gene has the typical structural characteristics of brm protein: comprises an HSA domain at 352-424 site, a DEXDc domain at 572-764 site, a HELICC domain at 932-1016 site, an SnAC domain at 1111-1180 site and a Bromo domain at 1237-1347 site. The conserved domain of the gene is shown in FIG. 1.
Example 2: analysis of expression characteristics of Btbrm1 Gene
(1) Extracting RNA and synthesizing cDNA of bemisia tabaci adults under different temperature stresses
Selecting the primarily-emerged MED cryptophyte adults, and respectively carrying out stress treatment on the bemisia tabaci adults at the temperatures of 0, 12, 26, 35 and 40 ℃. Each of the 3 biology is repeated, 3000 adults are obtained, and after the stress is finished, the adults are immediately placed in liquid nitrogen to be frozen for 3 minutes and then stored at the temperature of minus 80 ℃. RNA was extracted and reverse transcribed into cDNA according to the method of example 1.
(2) Detecting Btbrm1 expression levels at different temperatures by fluorescent quantitative PCR:
primers for Btbrm1 gene and two internal reference genes (EF 1-alpha, beta-tublin) of fluorescent quantitative PCR were designed:
brm1-QF：AACGCTTGGCTTTCCTCCTTTC
brm1-QR：ATCGCTTCCTCAGCATTCTCCC
EF1-α-F：TAGCCTTGTGCCAATTTCCG
EF1-α-R：CCTTCAGCATTACCGTCC
β-tub-F：TGTCAGGAGTAACGACGTGTTTG
β-tub-R：TTCGGGAACGGTAAGTGCTC
the reaction system is 20 μ L: 2 × TransStartTM Green qPCR 10.0 μ L, ROA 0.4 μ L, cDNA template 1.0 μ L, Primer-F0.4 μ L, Primer-R0.4 μ L, ddH2O 7.8. mu.L.
Reaction conditions are as follows: 30s at 95 ℃; 5s at 95 ℃, 30s at 60 ℃ and 40 cycles; and drawing a melting curve.
(3) Data analysis
The relative expression quantity of the gene is calculated by a 2-delta-Ct method. Data were statistically analyzed using SAS9.4 software, differences between different temperature treatments were analyzed using one-way analysis of variance (ANOVA), and Duncan's test was performed. Data are expressed as mean ± standard error with significance test level P < 0.05.
As shown in FIG. 2, the real-time fluorescent quantitative PCR result shows that the expression level of the MED cryptomorphic Btbrm1 gene is remarkably increased after short-time high-temperature stress treatment, and the expression level of the MED cryptomorphic Btbrm1 gene is in a down-regulation trend after short-time low-temperature stress treatment.
Example 3: analyzing the influence of Btbrm1 gene on the heat resistance of Bemisia tabaci MED cryptic species
3.1 Synthesis of dsRNA
(1) Primer sequences were designed to synthesize plus the T7 promoter (sequence underlined):
T7+Btbrm1-F：5’-TAATACGACTCACTATAGGGCCTTGCTTATCGGACTC-3’
T7+Btbrm1-R：5’-TAATACGACTCACTATAGGGATTGGGCTTGTTGTTTT-3'. Synthesized by Shanghai Biotechnology service, Inc.
(2) Total RNA extraction and cDNA synthesis: the same as in example 1.
(3) And (3) carrying out PCR amplification and product purification on the T7 primer, wherein the purified PCR product is the template for synthesizing dsRNA. dsRNA was synthesized and purified using the kit, following the kit instructions.
3.2dsRNA feeding
The Parafilm membrane was previously treated with DEPC water to remove RNase. Adding dsRNA into sucrose solution with the concentration of 10%, wherein the concentration is 0.3-0.5 mu g/mu L. According to the feeding characteristics of the bemisia tabaci, the method for clamping the nutrient solution by the Parafilm membrane is correspondingly improved: taking about 200 heads of the primary eclosion bemisia tabaci adults, putting the initial eclosion bemisia tabaci adults into a glass tube with two transparent ends, covering the upper end of the glass tube with a double-layer Parafilm, adding 200 mu L of 10% sucrose solution between the two films, adding dsRNA to enable the final concentration to be 0.3-0.5 mu g/mu L, covering the lower end of the glass tube with gauze, and keeping ventilation. The periphery and the lower end of the glass tube are wrapped by black plastic, so that the bemisia tabaci can gather to a parafilm at the top end to take dsRNA better, the device is placed into an artificial climate box (the temperature is 26 +/-0.5 ℃, the illumination is carried out for 24 hours, the relative humidity is 60-70 percent), and feeding is carried out for 3 hours. Dividing the fed Bemisia tabaci into two groups, wherein one group is stored after being frozen by liquid nitrogen to detect the silencing efficiency of a target gene, the other group is collected in a finger-shaped pipe, and is put into a preheated high-temperature water bath for hot knock down, and the time until the Bemisia tabaci can not stand independently is recorded, and the treatment temperature is 45 ℃. Bemisia tabaci without any treatment (CK), fed with a 10% sucrose solution and fed with a 10% sucrose mixed solution containing dsEGFP (final concentration of dsEGFP 0.3-0.5. mu.g/. mu.L) was used as a control, and 4 biological replicates were set for each treatment.
The relative expression amount of the gene is calculated by a 2-delta CT method, and the result is shown in figure 3, and the expression of the Btbrm1 gene can be obviously knocked down by feeding dsBtbrm 1. Analyzing the high-temperature knockdown time of the Bemisia tabaci MED hidden seeds fed with different solutions by using SAS9.4 statistical software, wherein the results are shown in figure 4, and the knockdown time of the Bemisia tabaci MED hidden seeds fed with Btbrm1 gene dsRNA is obviously lower than that of a CK group, a dsEGFP group and a sucrose group (P is less than 0.05); meanwhile, NCBI (http:// BLAST. NCBI. nlm. nih. gov /) BLAST shows that the fed target sequence has a sequence specific to Btbrm1 gene, so that the interference effect generated by the Btbrm1 gene of the target Bemisia tabaci MED cryptic species is ensured, and therefore, the invention proves that the Btbrm1 gene plays a key role in the high-temperature tolerance of the Bemisia tabaci MED cryptic species.
The full-length cDNA of the Btbrm1 gene is cloned from the bemisia tabaci MED hidden seed, and the difference of the expression quantity of the Btbrm1 gene at different temperatures is displayed by fluorescent quantitative PCR; and finally, the high-temperature knockdown time of the bemisia tabaci MED cryptophyte adults is obviously shortened by feeding Btbrm1 gene dsRNA. According to the specific embodiment of the invention, the test result confirms that the Btbrm1 gene plays a key role in the high-temperature resistance of the Bemisia tabaci MED cryptic species. The method lays a foundation for further researching the relationship between the temperature tolerance mechanism of the hidden species of the bemisia tabaci MED and the chromatin remodeling of the epigenetic inheritance, and provides a basis for a method for controlling the harm of the bemisia tabaci by temperature adaptability in the future.
Sequence listing
<110> institute of plant protection of Chinese academy of agricultural sciences
<120> bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm1 and coding gene application thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 4077
<212> DNA
<213> Bemisia tabaci (Bemis tabaci)
<400> 1
atgggtcctg ataatacaaa tccgggccga aatgttttca gcccgaacca gatccagcaa 60
ctacgagccc aaatccttgc ttatcggact ctagcacgga atctcccgct gaatcaaagt 120
atacctctca acccgcagga caaatggatg gcaccagagt cgcaaccaat gccacctcaa 180
gggatgcagc cacctgagca aaattttaac cagccgtacc ccccaagtga gcaaagtgag 240
atgcagatgc ccccaggagc ctcgggtcct cctgggccgc ccggtcctcc aatgcatatg 300
cagcgcccac ctatgcctaa ttcttccatt ccacttgatt caccctctgc aattaggggc 360
agatcacccg gtcccatagg tcctggtatt cctacagttg gtccagttgg tcctggtggg 420
cccgtcggtc cagttgttcc aaattctcat ggaatgcctg gtcatatgat tcctgtaggt 480
cctggaggtc cagtcggtcc tgttggtaca atgcctcctg gcagtcctgt ccttcctggt 540
ggccctgttg gtatgccacc tcctggtgca acggtgggtc cagtagcaac agttggcccc 600
ggtcctatac ctgtaccggt tatcccaggt ccaggaggtc aggttgttcc cattcaaccg 660
ggacaaccac ctcttcccaa tcagcaacaa ttcaatcaaa aacaacaagc ccaattgaaa 720
cttaatcgtg taactacagt gtctcgaccc actggaatag atccgcttca gttgctcgaa 780
gagaaggaga atcgaattaa cgctcgaatt gctcaccgaa tgattgagct gtacaatcta 840
cccaccaata tgtcagaaga tttacgaata aaagcacaaa tagagctcaa agcgctgcga 900
tgtttaaatt tccaaaggca attgaggcgt gaaatagttg cctgcactcg acgtgacacc 960
actctagaaa ctgccgtgga ccccagagca tacaaacgta tcaagaggca gagtttgaga 1020
gaagctcgtg ccactgaaaa gcttgagaaa caacgaagaa tcgaagctga gaggaatcgt 1080
cgtcagaaac accaagaata tttatgtgct gttttacaac attgcaaaga ctttaaagac 1140
ttccataaca gtaacaggac aaaattggtc aacatcaaca aagctgtact taattatcat 1200
gtcaatgctg aacgagaaca aaagaaagag caagaaagaa ttgaaaagga acgtatgcgc 1260
cgcctgatgg cagaagatga agaaggttac aggaaactta tcgatcagaa gaaagacaaa 1320
cgcttggctt tcctcctttc ccaaacagat gaatatatca gtaatttaac agaaatggtg 1380
aaacagcaca agcttgaaca agagcggaaa cacaaagaag caatgagaaa gaaagaagaa 1440
caacaaaaag ataatgatac agatgcggct gatgaaaatg aaaaagaaaa gagcgaggaa 1500
gaaaaagcaa aagctgagcc tattgtcaaa gcccctgagg tgaaaaagga gggggagaat 1560
gctgaggaag cgatagacac tgaggaggcg aagcaagtga taacgaaagc aaaagctgaa 1620
gatgacgagt acaaaactac atctgaggag ttaagttatt acagcattgc tcacacaata 1680
tcagaaattg tgatggagca agcttccata atggtcaatg gtaaattgaa agaatatcaa 1740
attaaaggtc ttgagtggct ggtttctctg tacaataata atttaaatgg cattttagca 1800
gatgaaatgg gtcttggcaa aaccattcag acaattgctt taattactta tctaatggag 1860
aagaaaaagc ttaatggacc tttcttgatc attgtacccc tctcaacttt atcgaactgg 1920
gtcctcgagt tcgaaaaatg ggcgccctct gtttctattg ttgcctacaa aggttcaccc 1980
ggtgtcaggc gagctttgca aagccaaatg aattcatccc tattcaatgt tctcatcact 2040
acttatgaat atgtcctgaa ggataaatct gtgctaacca agttcgactg gaagtatatg 2100
ataatggacg aaggacatcg gatgaagaac caccattgta aattgacaca agttttgaat 2160
tcgcattaca atacatcgca tcgtttgctt ctcaccggca cccctcttca gaataaactg 2220
ccagaattgt gggccctttt gaatttcctg cttccctcaa ttttcaagtc ttgctccacc 2280
ttcgagcagt ggtttaatgc tccttttgca accactggtg aaaaggttga acttaatgaa 2340
gaagaaacta tcctcattat tcggcgtcta cataaagtat tgaggccttt ccttctgcgt 2400
cgtttgaaga aagaagtaga atcgcagctg cctgataagg ttgaacacat tatcaaatgt 2460
gaaatgtcag gacttcaacg agttttgtat agacatatgc agagcaaagg tgtgctcctt 2520
actgatggtt cagaaaaagg aaaatcagga tctggtagta caaaggcact tatcaataca 2580
attatgcagc tgcggaaact atgcaatcat ccattcatgt tccaaaacat tgaagaaaag 2640
tactcggagc atgttggctt caccgctggt tttgtcactg gtcctgatct gtatcgctca 2700
tctgggaagt tcgagctact tgatcgtatt ttgccaaagt ttaaggaaac tggtcacaag 2760
gttttaatgt tctgtcaaat gactcagctc atgactgtcc tggaagactt cttgaactgg 2820
cgcggtttta cttacctgag attggatggc tcaaccaaat ctgaagatcg tggtgagctc 2880
ctgcgaaaat tcaatcaccc tgacagcgaa tacttcttat tcttactcag taccagagct 2940
ggtggtctag gtctcaattt gcagtccgct gacactgtca tcatctttga ctcagattgg 3000
aatcctcatc aggacttaca agctcaagac agagcccatc gaatcggaca aaagaatgaa 3060
gtgcgtgtgc ttcggttgat gacggtcaac tcagttgaag agcgtatcct tgctgctgct 3120
cgatataagt tgaacatgga tgaaaaggtt attcaagctg gtatgttcga tcagaaatct 3180
accgggagtg aacggcagca gttcttgcat gacatcttgc atcaggatga atctgatgat 3240
gaggaagaaa atgaagtacc tgatgatgaa actgtcaacc ggatgatagc gcgtagtgaa 3300
ggtgagttcg agttattcca aaagatggac ttggaaaggc gaagagaaga agcgaaactg 3360
ggagcagcac gtaaatctcg actgatcgaa gaatcggaac ttcctgcttg gctgattaaa 3420
gaagatgacg aggttgatgc atgggagtgc caagaagaag aaaatgttca gatgggaaga 3480
ggctccaggg ctcgaaaaga agttgattac actgatggcc tcactgaaaa ggagtggcta 3540
aacatgattg atgaaggaat agaggatgaa gatgacttga aagtttcgaa aaaatctcgc 3600
aagcgccgcc gagagaaaga tgatgaagat ggtgggcggt cgagcaaagc atctagatca 3660
agtgattatg aatataagtc tggatctggt ggatcttcag gatctggtga caaacgcctg 3720
aggaaacaga tgcgtaaact gatgaacata gttgttaagt acaaagacag tgaccaacga 3780
gtattgagtg agcctttcat gaaactgcca tctcgaaaag aattaccgga ctattatgaa 3840
gtaatcaaaa aacctatgga tataaagaaa atattgacaa agattgatgc tggcaaatac 3900
aatgatctag atgatctaga aaaggatttc atgcagtcat gtaagaatgc tcaagtgtat 3960
aacgttgaag gatccctcat ttatgaagat tccattattt tgcaatcagt cttcacaaac 4020
gcaaggcaga gattggacac cgaaggagac ggaggtggag aagaggaaga agaatag 4077
<210> 2
<211> 1358
<212> PRT
<213> Bemisia tabaci (Bemis tabaci)
<400> 2
Met Gly Pro Asp Asn Thr Asn Pro Gly Arg Asn Val Phe Ser Pro Asn
1 5 10 15
Gln Ile Gln Gln Leu Arg Ala Gln Ile Leu Ala Tyr Arg Thr Leu Ala
20 25 30
Arg Asn Leu Pro Leu Asn Gln Ser Ile Pro Leu Asn Pro Gln Asp Lys
35 40 45
Trp Met Ala Pro Glu Ser Gln Pro Met Pro Pro Gln Gly Met Gln Pro
50 55 60
Pro Glu Gln Asn Phe Asn Gln Pro Tyr Pro Pro Ser Glu Gln Ser Glu
65 70 75 80
Met Gln Met Pro Pro Gly Ala Ser Gly Pro Pro Gly Pro Pro Gly Pro
85 90 95
Pro Met His Met Gln Arg Pro Pro Met Pro Asn Ser Ser Ile Pro Leu
100 105 110
Asp Ser Pro Ser Ala Ile Arg Gly Arg Ser Pro Gly Pro Ile Gly Pro
115 120 125
Gly Ile Pro Thr Val Gly Pro Val Gly Pro Gly Gly Pro Val Gly Pro
130 135 140
Val Val Pro Asn Ser His Gly Met Pro Gly His Met Ile Pro Val Gly
145 150 155 160
Pro Gly Gly Pro Val Gly Pro Val Gly Thr Met Pro Pro Gly Ser Pro
165 170 175
Val Leu Pro Gly Gly Pro Val Gly Met Pro Pro Pro Gly Ala Thr Val
180 185 190
Gly Pro Val Ala Thr Val Gly Pro Gly Pro Ile Pro Val Pro Val Ile
195 200 205
Pro Gly Pro Gly Gly Gln Val Val Pro Ile Gln Pro Gly Gln Pro Pro
210 215 220
Leu Pro Asn Gln Gln Gln Phe Asn Gln Lys Gln Gln Ala Gln Leu Lys
225 230 235 240
Leu Asn Arg Val Thr Thr Val Ser Arg Pro Thr Gly Ile Asp Pro Leu
245 250 255
Gln Leu Leu Glu Glu Lys Glu Asn Arg Ile Asn Ala Arg Ile Ala His
260 265 270
Arg Met Ile Glu Leu Tyr Asn Leu Pro Thr Asn Met Ser Glu Asp Leu
275 280 285
Arg Ile Lys Ala Gln Ile Glu Leu Lys Ala Leu Arg Cys Leu Asn Phe
290 295 300
Gln Arg Gln Leu Arg Arg Glu Ile Val Ala Cys Thr Arg Arg Asp Thr
305 310 315 320
Thr Leu Glu Thr Ala Val Asp Pro Arg Ala Tyr Lys Arg Ile Lys Arg
325 330 335
Gln Ser Leu Arg Glu Ala Arg Ala Thr Glu Lys Leu Glu Lys Gln Arg
340 345 350
Arg Ile Glu Ala Glu Arg Asn Arg Arg Gln Lys His Gln Glu Tyr Leu
355 360 365
Cys Ala Val Leu Gln His Cys Lys Asp Phe Lys Asp Phe His Asn Ser
370 375 380
Asn Arg Thr Lys Leu Val Asn Ile Asn Lys Ala Val Leu Asn Tyr His
385 390 395 400
Val Asn Ala Glu Arg Glu Gln Lys Lys Glu Gln Glu Arg Ile Glu Lys
405 410 415
Glu Arg Met Arg Arg Leu Met Ala Glu Asp Glu Glu Gly Tyr Arg Lys
420 425 430
Leu Ile Asp Gln Lys Lys Asp Lys Arg Leu Ala Phe Leu Leu Ser Gln
435 440 445
Thr Asp Glu Tyr Ile Ser Asn Leu Thr Glu Met Val Lys Gln His Lys
450 455 460
Leu Glu Gln Glu Arg Lys His Lys Glu Ala Met Arg Lys Lys Glu Glu
465 470 475 480
Gln Gln Lys Asp Asn Asp Thr Asp Ala Ala Asp Glu Asn Glu Lys Glu
485 490 495
Lys Ser Glu Glu Glu Lys Ala Lys Ala Glu Pro Ile Val Lys Ala Pro
500 505 510
Glu Val Lys Lys Glu Gly Glu Asn Ala Glu Glu Ala Ile Asp Thr Glu
515 520 525
Glu Ala Lys Gln Val Ile Thr Lys Ala Lys Ala Glu Asp Asp Glu Tyr
530 535 540
Lys Thr Thr Ser Glu Glu Leu Ser Tyr Tyr Ser Ile Ala His Thr Ile
545 550 555 560
Ser Glu Ile Val Met Glu Gln Ala Ser Ile Met Val Asn Gly Lys Leu
565 570 575
Lys Glu Tyr Gln Ile Lys Gly Leu Glu Trp Leu Val Ser Leu Tyr Asn
580 585 590
Asn Asn Leu Asn Gly Ile Leu Ala Asp Glu Met Gly Leu Gly Lys Thr
595 600 605
Ile Gln Thr Ile Ala Leu Ile Thr Tyr Leu Met Glu Lys Lys Lys Leu
610 615 620
Asn Gly Pro Phe Leu Ile Ile Val Pro Leu Ser Thr Leu Ser Asn Trp
625 630 635 640
Val Leu Glu Phe Glu Lys Trp Ala Pro Ser Val Ser Ile Val Ala Tyr
645 650 655
Lys Gly Ser Pro Gly Val Arg Arg Ala Leu Gln Ser Gln Met Asn Ser
660 665 670
Ser Leu Phe Asn Val Leu Ile Thr Thr Tyr Glu Tyr Val Leu Lys Asp
675 680 685
Lys Ser Val Leu Thr Lys Phe Asp Trp Lys Tyr Met Ile Met Asp Glu
690 695 700
Gly His Arg Met Lys Asn His His Cys Lys Leu Thr Gln Val Leu Asn
705 710 715 720
Ser His Tyr Asn Thr Ser His Arg Leu Leu Leu Thr Gly Thr Pro Leu
725 730 735
Gln Asn Lys Leu Pro Glu Leu Trp Ala Leu Leu Asn Phe Leu Leu Pro
740 745 750
Ser Ile Phe Lys Ser Cys Ser Thr Phe Glu Gln Trp Phe Asn Ala Pro
755 760 765
Phe Ala Thr Thr Gly Glu Lys Val Glu Leu Asn Glu Glu Glu Thr Ile
770 775 780
Leu Ile Ile Arg Arg Leu His Lys Val Leu Arg Pro Phe Leu Leu Arg
785 790 795 800
Arg Leu Lys Lys Glu Val Glu Ser Gln Leu Pro Asp Lys Val Glu His
805 810 815
Ile Ile Lys Cys Glu Met Ser Gly Leu Gln Arg Val Leu Tyr Arg His
820 825 830
Met Gln Ser Lys Gly Val Leu Leu Thr Asp Gly Ser Glu Lys Gly Lys
835 840 845
Ser Gly Ser Gly Ser Thr Lys Ala Leu Ile Asn Thr Ile Met Gln Leu
850 855 860
Arg Lys Leu Cys Asn His Pro Phe Met Phe Gln Asn Ile Glu Glu Lys
865 870 875 880
Tyr Ser Glu His Val Gly Phe Thr Ala Gly Phe Val Thr Gly Pro Asp
885 890 895
Leu Tyr Arg Ser Ser Gly Lys Phe Glu Leu Leu Asp Arg Ile Leu Pro
900 905 910
Lys Phe Lys Glu Thr Gly His Lys Val Leu Met Phe Cys Gln Met Thr
915 920 925
Gln Leu Met Thr Val Leu Glu Asp Phe Leu Asn Trp Arg Gly Phe Thr
930 935 940
Tyr Leu Arg Leu Asp Gly Ser Thr Lys Ser Glu Asp Arg Gly Glu Leu
945 950 955 960
Leu Arg Lys Phe Asn His Pro Asp Ser Glu Tyr Phe Leu Phe Leu Leu
965 970 975
Ser Thr Arg Ala Gly Gly Leu Gly Leu Asn Leu Gln Ser Ala Asp Thr
980 985 990
Val Ile Ile Phe Asp Ser Asp Trp Asn Pro His Gln Asp Leu Gln Ala
995 1000 1005
Gln Asp Arg Ala His Arg Ile Gly Gln Lys Asn Glu Val Arg Val Leu
1010 1015 1020
Arg Leu Met Thr Val Asn Ser Val Glu Glu Arg Ile Leu Ala Ala Ala
1025 1030 1035 1040
Arg Tyr Lys Leu Asn Met Asp Glu Lys Val Ile Gln Ala Gly Met Phe
1045 1050 1055
Asp Gln Lys Ser Thr Gly Ser Glu Arg Gln Gln Phe Leu His Asp Ile
1060 1065 1070
Leu His Gln Asp Glu Ser Asp Asp Glu Glu Glu Asn Glu Val Pro Asp
1075 1080 1085
Asp Glu Thr Val Asn Arg Met Ile Ala Arg Ser Glu Gly Glu Phe Glu
1090 1095 1100
Leu Phe Gln Lys Met Asp Leu Glu Arg Arg Arg Glu Glu Ala Lys Leu
1105 1110 1115 1120
Gly Ala Ala Arg Lys Ser Arg Leu Ile Glu Glu Ser Glu Leu Pro Ala
1125 1130 1135
Trp Leu Ile Lys Glu Asp Asp Glu Val Asp Ala Trp Glu Cys Gln Glu
1140 1145 1150
Glu Glu Asn Val Gln Met Gly Arg Gly Ser Arg Ala Arg Lys Glu Val
1155 1160 1165
Asp Tyr Thr Asp Gly Leu Thr Glu Lys Glu Trp Leu Asn Met Ile Asp
1170 1175 1180
Glu Gly Ile Glu Asp Glu Asp Asp Leu Lys Val Ser Lys Lys Ser Arg
1185 1190 1195 1200
Lys Arg Arg Arg Glu Lys Asp Asp Glu Asp Gly Gly Arg Ser Ser Lys
1205 1210 1215
Ala Ser Arg Ser Ser Asp Tyr Glu Tyr Lys Ser Gly Ser Gly Gly Ser
1220 1225 1230
Ser Gly Ser Gly Asp Lys Arg Leu Arg Lys Gln Met Arg Lys Leu Met
1235 1240 1245
Asn Ile Val Val Lys Tyr Lys Asp Ser Asp Gln Arg Val Leu Ser Glu
1250 1255 1260
Pro Phe Met Lys Leu Pro Ser Arg Lys Glu Leu Pro Asp Tyr Tyr Glu
1265 1270 1275 1280
Val Ile Lys Lys Pro Met Asp Ile Lys Lys Ile Leu Thr Lys Ile Asp
1285 1290 1295
Ala Gly Lys Tyr Asn Asp Leu Asp Asp Leu Glu Lys Asp Phe Met Gln
1300 1305 1310
Ser Cys Lys Asn Ala Gln Val Tyr Asn Val Glu Gly Ser Leu Ile Tyr
1315 1320 1325
Glu Asp Ser Ile Ile Leu Gln Ser Val Phe Thr Asn Ala Arg Gln Arg
1330 1335 1340
Leu Asp Thr Glu Gly Asp Gly Gly Gly Glu Glu Glu Glu Glu
1345 1350 1355

Claims (1)

1. A method for shortening the high-temperature knockdown time of the aleyrodids MED cryptophyte adults is characterized by comprising the step of feeding dsRNA of an aleyrodids MED cryptophyte remodeling gene Btbrm1 to the aleyrodids MED cryptophyte, wherein the nucleotide sequence of the aleyrodids MED cryptophyte remodeling gene Btbrm1 is shown as SEQ ID No.1, and the dsRNA is obtained by amplifying the following primers:
Btbrm1-F：5’-TAATACGACTCACTATAGGGCCTTGCTTATCGGACTC-3’，
Btbrm1-R：5’-TAATACGACTCACTATAGGGATTGGGCTTGTTGTTTT-3’。
CN202010741384.8A 2020-07-29 2020-07-29 Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm1 and coding gene application thereof Active CN111925429B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010741384.8A CN111925429B (en) 2020-07-29 2020-07-29 Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm1 and coding gene application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010741384.8A CN111925429B (en) 2020-07-29 2020-07-29 Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm1 and coding gene application thereof

Publications (2)

Publication Number Publication Date
CN111925429A CN111925429A (en) 2020-11-13
CN111925429B true CN111925429B (en) 2022-03-25

Family

ID=73315528

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010741384.8A Active CN111925429B (en) 2020-07-29 2020-07-29 Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm1 and coding gene application thereof

Country Status (1)

Country Link
CN (1) CN111925429B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114437192B (en) * 2022-01-17 2023-09-29 中国农业科学院植物保护研究所 Tomato leaf miner chromatin remodelling factor ISWI, and encoding gene and application thereof
CN114380899B (en) * 2022-01-17 2023-09-29 中国农业科学院植物保护研究所 Tomato leaf miner chromatin remodelling factor BRM, and encoding gene and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
NCBI Reference Sequence:XM_019041659.1;NCBI;《NCBI》;20161109;第1-2页 *

Also Published As

Publication number Publication date
CN111925429A (en) 2020-11-13

Similar Documents

Publication Publication Date Title
MX2012007855A (en) Identification of diurnal rhythms in photosynthetic and non-photosynthetic tissues from zea mays and use in improving crop plants.
CN111925429B (en) Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm1 and coding gene application thereof
CN110684756B (en) Bemisia tabaci MED cryptophyte soluble trehalase, gene BtTreh1 and application thereof
CN110041416A (en) GmABCA9 gene is improving the application in soybean protein content and grain weight
CN111763252B (en) Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm2 and coding gene and application thereof
CN111763253B (en) Chromatin remodeling factor ISWI, coding gene and role in diaphorina tabaci MED cryptic temperature tolerance
CN108588082B (en) Bemisia tabaci MED cryptomorphic high-temperature tolerance related gene BtDnmt3 and application thereof
CN110669750B (en) Bemisia tabaci MED cryptomorphic dopamine decarboxylase, coding gene BtDDC and application thereof
KR20170106314A (en) Parental rnai suppression of chromatin remodeling genes to control hemipteran pests
CN111909911B (en) Bemisia tabaci MED cryptohistone acetyltransferase gene gcn5, application thereof and method for reducing temperature tolerance of Bemisia tabaci
CN106434694B (en) Application of cotton GbDREB gene in verticillium wilt resistance
CN111848768B (en) BtISWI gene and application thereof in regulating and controlling cryptogenic temperature preference of bemisia tabaci MEAM1
CN108060146A (en) Migratory locusts peroxiredoxin PRX5 and its encoding gene and application
CN111893101B (en) Bemisia tabaci MED cryptic acetyltransferase gene mof, application thereof and method for reducing low-temperature tolerance of Bemisia tabaci
CN114507674A (en) Application of tea tree circadian rhythm gene LUX in improving cold resistance of plants
CN109053870B (en) Application of AtERF49 gene in plant response high-temperature stress process
CN113564200A (en) Application of tea tree CsCIPK20 gene in improving cold resistance of plants
CN111690665A (en) Gene PpAHSP 21 separated from Chinese pear and having black spot resisting function and application thereof
CN111100868A (en) Female promotion gene FERR and female inhibition gene FERR-R of populus deltoides and application thereof
CN112391389B (en) Migratory locust C-type scavenger receptor gene and targeting dsRNA and application thereof
CN113846105B (en) Application of GhAIF3 gene in regulating plant phenotype and method for regulating plant phenotype
CN111893102A (en) Bemisia tabaci MED cryptohistone acetyltransferase gene gcn5, application thereof and method for reducing temperature tolerance of Bemisia tabaci
CN110760521B (en) Transcription factor for improving expression of wheat storage protein geneNAC1And uses thereof
Zhao et al. Molecular cloning and characterization of a group 3 LEA gene from Agropyron mongolicum Keng
CN109553670B (en) Agapanthus praecox gibberellin negative regulatory factor ApGAI protein and encoding gene

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant