CN111100868A - Female promotion gene FERR and female inhibition gene FERR-R of populus deltoides and application thereof - Google Patents

Abstract

The invention discloses a female promotion gene FERR and a female inhibition gene FERR-R of populus deltoides and application thereof, belonging to the technical field of plant genetic engineering. According to the method, family linkage analysis is used for finely positioning the sex-determining gene locus of the populus tremuloides, then natural population materials are used for carrying out whole genome correlation analysis, transcriptome and genome methylation sequencing are combined, the female promotion gene FERR and the female inhibition gene FERR-R of the populus tremuloides are disclosed for the first time, the FERR-R genes do not encode protein, the siRNAs are generated to carry out methylation on the start sequence of the female promotion gene FERR and cut the transcript of the female promotion gene FERR, and therefore the expression of the female promotion gene FERR in a male populus tremuloides is inhibited. The female poplar strain does not contain FERR-R gene, and FERR expression is not inhibited by FERR-R, so that the female plant develops female flowers. The female promoting gene and female suppressing gene of poplar provided by the invention can be applied to early sex identification and molecular breeding of poplar.

Description

Female promotion gene FERR and female inhibition gene FERR-R of populus deltoides and application thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a female promotion gene FERR and a female inhibition gene FERR-R of Populus deltoids (Populsdeltoides) and application thereof.

Background

The vegetative chromosome origin hypothesis states that sex chromosomes originate from an autosomal chromosome. The evolution of sex chromosomes begins with the occurrence of a male or female sterile mutation on one chromosome of the pair of autosomes. The vegetative chromosome origin hypothesis states that sex chromosomes originate from an autosomal chromosome. The sex chromosome evolves from the generation of a male or female sterile mutation on one chromosome of the pair of autosomes, the recombination of the mutation part is inhibited due to some unknown reason, and the non-recombination region gradually expands to finally form the heterotypic sex chromosome. The heterogynic plants are evolutionarily appeared in a shorter time than the closely related homogynic plants, which have evolved from the homogynic plants. Theoretically, the evolution of plants from hermaphrodite to hermaphrodite involves two genes with opposite functions, namely a female suppression gene and an androgenesis promotion gene, which act on the development of female flowers or male flowers independently.

In recent years, research on cloning of plant-specific genes has been advanced, for example, in the 2014 SCIENCE journal, sex-determining gene OGI of persimmon is published, the gene OGI is a Y-specific hemizygous element and encodes an miRNA, the regulated target gene is a MeGI gene located on an autosome, and the MeGI gene encodes a transcription factor which has a homeotropic domain and regulates anther fertility. Thus female sex of persimmons occurs due to the inhibition of the target gene MeGI located on the autosome by miRNA encoded by the OGI gene located on the Y chromosome. However, only one sex-regulating gene is found in persimmons, and the authors of the paper believe that there may be another sex-determining gene in persimmons that is not found. In addition, in 2017 and 2018 published researches on sex differentiation of asparagus and kiwi, two sex-determining candidate genes are respectively found, and the results of gene function researches show that the two sex-determining candidate genes are independent and opposite in function and respectively act on the development of female or male floral organs. Asparagus and Chinese gooseberry are both pseudo-male and female, i.e. female flower and male flower have normal structure of the floral organs of opposite sex respectively, but two sex-determining genes cause the floral organs of opposite sex to be aborted respectively, resulting in male and female differentiation. The sex differentiation of the two plants was not significantly different at the early stage of flower development, and the sex difference between male and female was found at the later stage of flower development.

Poplar is a typical hermaphrodite plant, and neither male nor female flowers develop in floral organs of opposite sex. Dynamic observation of the development process of the flower buds of the poplar shows that although the poplar blooms in early spring, microscopic observation of paraffin sections shows that the flower bud differentiation of the poplar is completed in the 6 months of the last year. Thus, the poplar sex-determining gene functions early in flower development, determining the formation of female and male flower primordia, respectively. The cytological observation and research carried out in the past shows that the poplar genome has no sex chromosome with obvious morphological difference, and the sex chromosome is still in the early stage of evolution. Although the sex-type two-sex of poplar is mainly shown in the morphological difference of flower organs, a lot of researches show that the female and male strains of poplar have significant difference in environmental adaptability, growth speed and biomass yield traits. Sex has significant influence on growth traits, and male plants are generally superior to female plants. After sexual maturity, female plants can generate a large amount of flying flocs, which causes serious air pollution, and has triggered more and more social concerns. Therefore, the important influence of sex should be fully considered when using poplar for afforestation or greening. However, the sex-determining genes of poplar have not been cloned and identified.

The poplar is widely distributed, grows rapidly, is tall and straight, has wide application range, is an important artificial forest planting tree species, and the wood is mainly used for industrial materials and becomes an important processing raw material in the industries of plywood, fiberboard, papermaking and the like. China is the world with the largest poplar cultivation area, and the area of poplar artificial forests reaches 853 ten thousand hectares (the eighth national forest resource clearing result). As the juvenile period of the poplar is very long and reaches 6-7 years, the molecular basis for sex regulation is clarified, the method has important application value for early sex identification and molecular breeding of the poplar and is beneficial to development and utilization of poplar resources with different sexes.

Disclosure of Invention

In view of the above problems in the prior art, the present invention provides a female-promoting gene FERR of Populus deltoides. Another technical problem to be solved by the present invention is to provide female suppression gene FERR-R of Populus deltoides. The invention also aims to solve the technical problem of providing the application of the female promotion gene FERR of the populus deltoides. The last technical problem to be solved by the invention is to provide the application of female suppression gene FERR-R of populus deltoides.

In order to solve the technical problems, the technical scheme adopted by the invention is as follows:

a female promotion gene FERR of Populus deltoides has a nucleotide sequence shown in SEQ ID NO. 1.

The amino acid sequence of the expression protein of the female promotion gene FERR of the populus tremuloides is shown in SEQ ID No. 2.

The carrier, the recombinant bacterium or the host cell containing the female promotion gene FERR of the populus deltoides.

The female promoting gene FERR of the populus tremuloides is applied to early sex identification of the populus tremuloides and molecular breeding of the populus tremuloides.

Preferably, the application of the female promotion gene FERR of the populus tremuloides in the molecular breeding of the populus tremuloides comprises the following steps:

1) preparing a knockout vector of the FERR gene;

2) knocking out a female promotion gene FERR in a female poplar plant;

3) cultivating and screening to obtain the poplar plant with female flowers which do not develop or produce flying floc.

The application of the female promotion gene FERR of the populus tremuloides in promoting the development of female flowers of plants comprises the following steps:

1) constructing a female promotion gene FERR vector of the poplar;

2) transforming the constructed female promotion gene FERR vector into plants or plant cells;

3) and culturing and screening to obtain plants with increased pistil or enhanced pistil development.

An estrin gene FERR-R of populus deltoids has a nucleotide sequence shown in SEQ ID No.3, contains an action site sequence, and a target gene thereof is the estrin gene FERR of the populus deltoids.

A carrier, a recombinant bacterium or a host cell containing the female suppression gene FERR-R of the populus tremuloides or an action site sequence thereof.

The female suppression gene FERR-R of the populus tremuloides or the action site sequence thereof is applied to early sex identification of populus tremuloides and molecular breeding of populus tremuloides.

Preferably, the application of the female suppressing gene FERR-R of the populus tremuloides or the action site sequence thereof in the molecular breeding of the populus tremuloides comprises the following steps:

1) constructing a recombinant vector of an oestrogen FERR-R of populus tremuloides or an action site sequence thereof;

2) transforming the constructed female suppression gene FERR-R of the populus tremuloides or the recombinant vector of the action site sequence thereof into a female poplar plant or a female poplar plant cell;

3) cultivating and screening to obtain the poplar plant with female flowers which do not develop or produce flying floc.

Has the advantages that: compared with the prior art, the invention has the advantages that:

the invention carries out family linkage analysis by constructing a Populus tremula holomorphic mapping population, finely positions the sex-determining gene locus of the Populus tremula, then carries out genome-wide association analysis by utilizing natural population materials, combines transcriptome and genome methylation sequencing, and firstly discloses a female promotion gene FERR of the Populus tremula and a female inhibition gene FERR-R specific to the male of the Populus tremula, wherein the FERR-R genes do not encode protein, but methylate a start sequence of the female promotion gene FERR by generating siRNAs and cut a transcript thereof, thereby inhibiting the expression of the female promotion gene FERR in a male strain of the Populus tremula. The female poplar strain does not contain FERR-R gene, and FERR expression is not inhibited by FERR-R, so that the female plant develops female flowers. The FERR gene was overexpressed in Arabidopsis, indicating that this gene promotes plant pistil development. The FERR is a female promotion gene, the FERR-R is a female inhibition gene, and genetic operation is carried out on the female promotion gene or the female inhibition gene to obtain a poplar plant with female flowers which do not develop or produce catkin.

Drawings

FIG. 1 is a schematic diagram showing the location of a sex-determining gene in poplar;

FIG. 2 is a schematic diagram showing the fine mapping of poplar sex-determining gene and the construction of chromosome haplotype in the sex-determining region; FIG. 2A shows the fine positioning of the sex-determining gene of poplar, wherein the characters above the vertical line show the name of the marker, and the numbers below the vertical line show the number of the recombination individuals detected in the corresponding interval; the right dark red region indicates the position of the oestrogen FERR; FIG. 2B shows the construction of chromosomal haplotypes for the sex-determining region of poplar. The orange part at the left end shows the telomere region, and the gray segment on SDR-X shows that the sequence change of the region and the corresponding region of SDR-Y is larger than that of other parts of chromosome; the cyclic fragment on SDR-Y is a Y-specific hemizygous region, and the black broken line indicates that the length of SDR-Y between sequencing individuals in the corresponding region is shorter than that of SDR-X. The green part indicates the position of the three genes TCP, CLC and MET 1;

FIG. 3 is a diagram showing the result of genome-wide association analysis of poplar sex-determining genes;

FIG. 4 is a transcriptional dynamic expression profile of TCP, CLC, and MET1 and FERR-R; FERR repressor (FERR-R) is an oestrogen-suppressing gene; T1-T9 represent 9 sampling time points, T1 (No. 6/3 in 2018), T2 (No. 6/18 in 2018), T3 (No. 7/3 in 2018), T4 (No. 7/18 in 2018), T5 (No. 8/3 in 2018), T6 (No. 8/18 in 2018), T7 (No. 9/3 in 2018), T8 (No. 12/1 in 2018), T9 (No. 1/15 in 2019) T5 show the expression levels of the corresponding genes in the buds with and without scales removed;

FIG. 5 is a homology relationship diagram of the poplar FERR gene and the specific female-suppressing gene site in the male poplar;

FIG. 6 is the differentiation process of male and female flower buds of poplar; 6A shows the morphological changes of the female and male flower buds at the corresponding period; 6B, displaying longitudinal section microscopic observation of the paraffin sections of the female and male flower buds at the corresponding period; the lower right arrow indicates the anthers of the male flowers, the remaining arrows indicate the floret primordium of the female, male flower buds;

FIG. 7 is a graph showing the results of measurement of dynamic expression of FERR gene in male and female flower buds of poplar;

FIG. 8 is a diagram showing the result of functional verification of the poplar FERR gene transformed in Arabidopsis; 8A shows the effect of FERR overexpression on pistil elongation, 8B shows the extreme phenotype of increased pistil with FERR overexpression;

FIG. 9 is a graph of FERR-R regulatory analysis based on transcriptional expression and genomic methylation sequencing; e1-e6 represent exons of the FERR gene, respectively, and the mapped regions in the figure represent homologous replication fragments between FERR-R and FERR, respectively;

FIG. 10 is a diagram of a molecular regulatory model of the FERR-R gene; e1-e6 represent exons replicated between the FERR-R and FERR genes, respectively; the broken line on Chr19_ X indicates that X chromatid lacks the FERR-R gene locus; the regions indicated by the DRM2 line show that siRNAs produced by ferrr-R have methylation modifications in the corresponding regions of the ferrr gene; red small brushes represent siRNAs, the corresponding lines indicate that siRNAs produced by ferrr-R also clipped exons of the ferrr gene transcript;

FIG. 11 shows the interaction between FERR gene and female-suppressing gene locus specific to male poplar; SiFERR: a sequence of siRNA is generated at the FERR-R site; FERR': a gene in ferrr that alters the DNA sequence of the siFERR target site but does not alter the amino acid sequence.

Detailed Description

The invention is further described with reference to specific examples.

Example 1:

(1) construction of full sibling mapping population of populus deltoids and primary positioning of sex-determining gene

In 2012, we constructed a pansy full sib mapping population consisting of 1077 progeny, which was planted in the heusu flood area at a row spacing of 6 × 6 m, and all reached the age of sexual maturity. A genetic map covering the whole genome is constructed for the population, partial individuals are randomly extracted from the mapping population, and the whole genome scanning of the poplar sex-determining gene is carried out. The sex-determining gene is located at the end of the nineteenth chromosome, between the telomere and the N110 marker (fig. 1). Sex linkage analysis also found that the poplar sex determinant was male heterozygous, indicating that the populus tremuloides sex was the XY determinant system.

(2) Fine positioning of sex-determining gene and construction of sex-determining region chromosome haplotype

Whole genome sequencing was performed on the female parent and one male progeny of the mapping population, respectively, yielding more than 75 × PacBio reads per individual. The genomes of the sequenced individuals are assembled and annotated respectively to obtain the reference genomes of the female and male populus deltoides individuals. Wherein the contig N50 of the female individual is 1.4Mb, the assembled genome size is 431Mb, the contig N50 of the male individual is 2.8Mb, and the assembled genome size is 414 Mb. The male plant is not selected from the male parent but is selected from a male offspring because 1 chromosome in the male plant of the offspring is derived from the female parent, so that the difference between X chromosomes of the sequenced individuals can be reduced. An SSR marker is designed in a sex determination region by referring to a genome sequence of a male plant, and then genotype analysis is carried out on all 1077 progeny plants including 550 female plants and 527 male plants, so that fine positioning of a sex determination gene is realized. The sex-determining gene is located between the telomere and the N362 marker, corresponding to a physical length of 236kb (fig. 2A), which is the sex-determining region (SDR) of the poplar. Based on sequencing the SNP information in this region in individuals, we constructed haplotypes of X and Y chromatids in the SDR region, respectively (FIG. 2B). Comparing SDR-X and SDR-Y haplotypes, the telomere of the X chromatid is shorter than that of the Y chromatid, and the sequence close to the telomere is more differentiated between the two chromatids than other regions. In addition, the Y chromatid has a Y-specific hemizygous fragment.

(3) Whole genome association analysis of poplar sex determination gene

Second generation sequencing was performed on 45 male and 53 female plants, each with a sequencing depth of more than 23 x. The genome of the sequenced individual is taken as a reference, SNP loci are searched for carrying out whole genome association analysis of sex genes, and the result of the SNP association analysis shows that all SNPs completely associated with the sex are derived from TCP, CLC and MET1 genes positioned in an SDR region (figure 3). Haplotype construction results showed that both X and Y chromatids contained these three genes, and transcriptome dynamic expression sequencing results showed that these three genes were expressed in both male and female individuals, but they did not have a stable differential expression pattern between male and female individuals (FIG. 4). Thus, these three genes are independent of sex determination, and the signals associated therewith are due to their localization in the recombination-inhibiting region, which results in the sequence differentiation of the X and Y chromatids in this region, thereby allowing differences in the degree of heterozygosity between male and female plants.

(4) Discovery of FERR-R and FERR genes

The sex of poplar is XY determining system, theoretically Y chromatid should evolve into specialized region, and the result of haplotype construction also shows that Y chromatid has a section of Y specific hemizygous fragment. Therefore, re-sequencing data was used to perform correlation analysis of whole genome Reads coverage with sex genes (rc-GWAS). rc-GWAS analysis showed that no female-specific hemizygous fragment was present in the female strain, whereas the Y-specific hemizygous fragment detected by haplotype construction was conserved at the population level, i.e. all male individuals contained this Y-specific hemizygous fragment. Two non-coding genes were obtained by sequence annotation from the Y-specific hemizygous fragment, one of which (designated FERR-R) was homologous to one of the genes of the recombination region at the other end of chromosome 19 (designated FERR), and there were 7 homologous copies between the two gene loci (FIG. 5). It has been shown that paralogous genes generated by gene replication may exert a regulatory effect on the gene itself. Therefore, one of the genes is supposed to be an estragogue gene FERR (the total length is 498bp, the specific sequence is shown as SEQ ID NO.1, and the amino acid sequence of the expression protein is shown as SEQ ID NO. 2); the other is an estrin gene FERR-R (the total length is 18614bp, and the specific sequence is shown in SEQ ID NO. 3).

(5) Analysis of FERR Gene expression by transcriptome dynamic expression sequencing

In order to measure the expression of the FERR gene in the male and female poplar plants, female and male populus tremuloides are sampled from 6 months in 2018 until 1 month in 2019, and 9 sampling time points are set, namely T1 (6 months and 3 days in 2018), T2 (18 days in 6 months and 18 days in 2018), T3 (3 days in 7 months and 3 days in 2018), T4 (18 days in 7 months and 18 days in 2018), T5 (3 days in 8 months and 3 days in 2018 months), T6 (18 days in 8 months and 18 days in 2018), T7 (3 days in 9 months and 3 days in 2018), T8 (1 day in 12 months and 1 day in 2018) and T9 (15 days in 1 month and 15 months in 2019). Morphological changes in flower bud development are shown in fig. 6A, and microscopic examination of paraffin sections shows that male flower buds are distinguishable within 3 days of 6 months, while female flowers differentiate later than male flowers and are distinguishable within samples collected within 18 days of 6 months (fig. 6B). The expression of the FERR gene was measured in the samples taken at the above-mentioned different time points by using a real-time quantitative analysis technique. In the above collected samples, the proportion of floral organs to the whole flower buds before 7 months and 18 days was very low, and the flower buds were not peeled off. The samples were flaked at 8 months and 3 days later when they were taken. To compare the peeled and non-peeled scale samples, the T5 time point samples were compared with the peeled and non-peeled scale flower buds, respectively. After RNA is extracted from the collected sample, gDNA is removed by adopting a one-step method and cDNA reverse transcription synthesis is carried out. Designing a quantitative primer N809F for the target gene FERR: 5'-AAACGGAAAGAGAGCATTGGA-3', respectively; N809R: 5'-TCATAACCTGTCATTCCTGGCA-3' are provided. Taking PtUBQ gene as an internal reference gene, wherein the primer sequence of the internal reference gene is PtUBQF: 5'-GTTGATTTTTGCTGGGAAGC-3', respectively; PtUBQR: 5'-GATCTTGGCCTTCACGTTGT-3' are provided. The real-time quantitative PCR experiment program is as follows: prepare 20. mu.L reaction system including 100ng cDNA, 4pmol upstream and downstream primers, 10. mu.L AceQ qPCR SYBR Green Master Mix, sterile ultrapure water to make up to 20. mu.L. The reaction step, first 95 ℃ denaturation for 3 minutes, then 40 reaction cycles including 95 ℃ denaturation for 15 seconds, 60 ℃ annealing for 15 seconds, 72 ℃ extension for 30 seconds. Calculation of Gene expression Using 2-^ΔCTMethod, i.e. Δ CT ═ CT_{Target gene}-CT_{Internal reference gene}. And (3) detecting whether the expression difference between the male sample and the female sample is significant at the same sampling point by using a T test method.

The measurement result shows that the FERR gene is not expressed all the time in the development process of the male flower buds. Indicating that the gene is completely inhibited by the female suppression gene in the male flowers of the poplar. In the female flower buds, the flower bud control with peeled and non-peeled scales at T5 time point showed that the ferrr gene was highly expressed until that time point, maintaining a high expression level until 3 days 9 months ago, but was hardly expressed in the samples of 12 months and 1 month (fig. 7). The gene is shown to be highly expressed in female flowers of the poplar in the early period of female flower primordium formation and female flower development, and the expression level is very low in the later period of female flower development. The FERR gene is not expressed in leaves and is not expressed in flower bud scales, so that the FERR gene has strong tissue specificity and sex specificity, is expressed only in female plants, and has space-time specificity in the female plants. FERR gene expression analysis shows that the gene determines the formation of female flower primordia and controls the early development of female flowers. Since FERR in the poplar male plant is inhibited by FERR-R, pistil in the male plant does not develop, and FERR in the female plant is normally expressed and pistil develops.

(6) Functional verification of transformed poplar FERR gene in Arabidopsis thaliana

The Arabidopsis transformation receptor used Col-0. Before transformation, Arabidopsis thaliana was cultured at 19-23 ℃ and given 16 hours of light during the day. The CDS sequence of the FERR gene was cloned into the p2301-35Splus vector, which was then introduced into Agrobacterium tumefaciens GV3101(pMP 90). The wild arabidopsis transformation adopts a floral organ dip-dyeing method. Positive plants were selected on MS medium containing 50mg/mL kanamycin, and plants positive for kanamycin selection were further confirmed by GUS staining. Positive plants were cultured at 19-23 ℃ and given 16 hours of light during the day. When the plant blossoms, the flower organ is observed by using a body type microscope. Phenotypic observation of flower organs of transformed plants shows that when the common pistil flowers are exposed when not opened, compared with wild type, the transformed FERR gene has a significant influence on pistil elongation of the flower organs of Arabidopsis (FIG. 8), and even the phenotype of multiple pistils or sepal gynoecia appears. The results of the Arabidopsis thaliana transformed by the FERR gene show that the FERR gene has obvious promotion effect on the development of pistils and is a female promotion gene.

(7) FERR-R regulation and control analysis based on transcription expression and genome methylation sequencing

Since the FERR-R gene homologous to the FERR on the Y-specific hemizygous fragment is a non-coding gene, its transcript does not contain a polyA tail. Therefore, the lncRNA-Seq technology is adopted to detect the expression level of the gene. Sequencing results showed that this gene was constitutively expressed only in the male flower buds (FIG. 4). The analysis of its copy fragment with FERR site shows that the gene may code siRNAs, and the sequencing result of siRNAs confirms that the gene produces siRNAs. siRNAs may suppress the target gene by methylation and cleavage of the target gene transcript, so we name the gene as FERR-R, which suppresses the expression of the estragous gene FERR. Genomic methylation sequencing revealed that siRNAs produced by ferrr-R were methylation modified in the promoter, 3' UTR and first exon regions of the ferrr gene, which resulted in gene silencing (fig. 9). At the same time, siRNAs produced by ferrr-R also spliced to exons 1, 2 and 3 of the ferrr gene transcript (fig. 9). Therefore, the FERR-R gene of poplar is an estrin gene, and the molecular regulation model is shown in FIG. 10. The FERR-R gene exists in a male poplar strain in a hemizygous form and exists only on a Y chromatid, so that the gene inhibits the expression of FERR in the male poplar strain; the X staining monomer does not contain the FERR-R gene, and the female gene FERR is promoted to be expressed in female plants, so that female flowers of the female plants are developed. After the female poplar plants reach the sexual maturity age, a large amount of flying cotton buds can be generated in 5-7 months every year, the duration is long, and the FERR-R gene can be used for cultivating non-flying poplar.

(8) Interaction verification of female promotion gene FERR and female inhibition gene FERR-R of poplar

The interaction between FERR-R and FERR is subjected to transient expression verification by using poplar protoplast. Firstly, taking the middle part of a leaf blade with good growth state on a sterile seedling of Nanlin 895, cutting the leaf blade into small strips with the diameter of 0.5-1mm, putting the small strips into an enzymolysis solution containing cellulase (3%) and macerozyme (0.8%), performing vacuum infiltration for 30min under the dark condition, continuing dark enzymolysis for 5h, and avoiding cell breakage without shaking a culture dish in the enzymolysis process. After the enzymolysis is finished, filtering by using a 70-micron cell screen, removing undigested leaves and impurities, collecting complete protoplasts, and finally suspending the protoplasts in a transfection buffer solution.

Constructing gene transient expression vector. The ferrr gene sequence was obtained in the populus deltoids genome annotation. By comparing the sequence homology of FERR-R and FERR, the sequence of the action site of siFERR is obtained as follows: 5'-TGCGATCTATCA-3' are provided. The target sequence in the ferrr corresponding to the siferrr site of action sequence is: 5'-TTTGATAGATCGCA-3' are provided. The DNA sequence of the corresponding target site in the FERR was altered to obtain a FERR ' resistant to cleavage by siRNA produced by siFERR (target sequence: 5'-TCTTATCGACCGGA-3'). In contrast to ferrr, ferrr' is a modification of the target sequence described above, but does not alter the translated amino acid sequence. The three gene sequences are synthesized by an artificial synthesis method and then are connected into a p2GWF7 vector by a homologous recombination method, and the vector carries a GFP green fluorescent protein gene. Transforming the poplar protoplast by the constructed vector for four times, comprising the following steps: the FERR expression vector transforms poplar protoplast, the FERR 'expression vector transforms poplar protoplast, the siFERR expression vector and the FERR expression vector co-transform poplar protoplast and the siFERR expression vector and the FERR' expression vector co-transform poplar protoplast. The results show that the FERR expression vector transformed poplar protoplast, the FERR 'expression vector transformed poplar protoplast, and the coforming of the siFERR expression vector + the FERR' expression vector into poplar protoplast all produced green fluorescent signals, but no green fluorescent signal was produced when the coforming of the siFERR expression vector + the FERR expression vector into poplar protoplast, indicating that sirnas produced by siFERR can degrade transcripts of FERR (fig. 11). The poplar protoplast transient expression experiment proves the molecular interaction between poplar female inhibiting gene FERR-R and female promoting gene FERR.

Sequence listing

<110> Nanjing university of forestry

<120> female promotion gene FERR and female inhibition gene FERR-R of populus deltoides and application thereof

<130>100

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>498

<212>DNA

<213>Poplus deltoides

<400>1

atggccagct cttcttcttc cttaccatca atggagtttg attttgatga gaaaccacat 60

gtgttagctg ttgatgatag tttgatagat cgcaaagtca ttgaaagatt acttatcaac 120

tctacatgca gagtgaccac agcagaaaac ggaaagagag cattggagta tttgggctta 180

gctgatggac aacatcccag tcatagtgat ttgaaggtga atatgatcat caccgattat 240

agtatgccag gaatgacagg ttatgagctg ttgaaaagaa ttaaggaatc acctaccatg 300

aaggagatac cggtggttgt agtgtcatct gagaacatcc ctacacgaat taatcagtgc 360

atggagggag gagctcaaga attcttgctg aagcctcttc agctatcaga tgcgacaaag 420

ctgaggtgcc atataaaaaa gctgaataat caatcgatat tacaaggggg ctttgcagga 480

gaagacgaac atgcataa 498

<210>2

<211>165

<212>PRT

<213>Poplus deltoides

<400>2

Met Ala Ser Ser Ser Ser Ser Leu Pro Ser Met Glu Phe Asp Phe Asp

1 5 10 15

Glu Lys Pro His Val Leu Ala Val Asp Asp Ser Leu Ile Asp Arg Lys

20 25 30

Val Ile Glu Arg Leu Leu Ile Asn Ser Thr Cys Arg Val Thr Thr Ala

35 40 45

Glu Asn Gly Lys Arg Ala Leu Glu Tyr Leu Gly Leu Ala Asp Gly Gln

50 55 60

His Pro Ser His Ser Asp Leu Lys Val Asn Met Ile Ile Thr Asp Tyr

65 70 75 80

Ser Met Pro Gly Met Thr Gly Tyr Glu Leu Leu Lys Arg Ile Lys Glu

85 90 95

Ser Pro Thr Met Lys Glu Ile Pro Val Val Val Val Ser Ser Glu Asn

100 105 110

Ile Pro Thr Arg Ile Asn Gln Cys Met Glu Gly Gly Ala Gln Glu Phe

115 120 125

Leu Leu Lys Pro Leu Gln Leu Ser Asp Ala Thr Lys Leu Arg Cys His

130 135 140

Ile Lys Lys Leu Asn Asn Gln Ser Ile Leu Gln Gly Gly Phe Ala Gly

145 150 155 160

Glu Asp Glu His Ala

165

<210>3

<211>18614

<212>DNA

<213>Poplus deltoides

<400>3

acataatgtg acattaaaat gaattataat gattgggatt agatgtgttg cgaaatgatg 60

agttcattgg acaataattg ggctttgttt gatggtatat tgaagtgttg ctggtatttg 120

tcgataaatt gagatctctt ggtataggag atactcttct gaaatttttg tcgatccttg 180

aggatctctt gaggcactac aaagagagat tcctcaatag ggagaactat ctcctcccct 240

gcgaggagag gacattgaag gtctacctct aaagattatc taaagatttc atgtttttaa 300

attaaggaaa aggtacccat caccatgtca ttattgccca tcaattcttt atcatgtctg 360

ttttctatga ggttatcctc attccatgac tagaatcatg agtatggcga gttaacattg 420

attgattcgg gtcttttttt gtgttttttt aatcattttt tttcaatttc atattttaaa 480

attgagttga ttgataaatg agctttataa tttgtttcaa tttacttttt attgggttat 540

cccggtctca tgacctagat tgtggtttga taggttgact tggatcattt gttttcctct 600

tttttttaat tgattttttt tacaacttca tttttcaaca ttgtgtttaa cagaaattga 660

gtattgtaat ttgttttgat tttctttcta cggagttatt atgatctcat ggtttggtat 720

gcagattgaa aagttaaccg ggttttccaa attgatctaa tatgttgttg tcttaatgtt 780

tattaaaaca atctcaattt aaatatttat tttgagttaa actatgtttt tatcggttat 840

ccatgttgca tttggaattg ccaagaggac cgagtcatat cggatcaatt ctcgcatgat 900

ttattttttt ctactaaaaa acattaataa catcttaatg ttttttatat ttaaaaaata 960

ttaatctcac tatagcagag tacaagtcaa tgatattaac ataagtgtgt gtatgtatca 1020

aaaattattt ttgtgaattt tagctttttc ataacccttg cacttaatgt ccttgcaaat 1080

agtgacaatt ctttcaacat catccattgc tttaacaatt atctaccgtg ttatttattt 1140

agggttattt gagattttga tgttgttttt aaaagtattt tttattttaa aatatattaa 1200

tatatgtatc atgtttttct aaaacaattt aattttgata ttaatatatc aaaataattt 1260

aaaaatacaa aaaaaataat ttgaaattaa aatttttttc aaaaagtttt aaaaacatta 1320

tccttatcat gttcccaaat acatttcctt cttacagcat actgtactag attaccttct 1380

tagtcttgca agcaaattgg taatttatag aaatgagacc tctttctaaa gcaacaacag 1440

taccatttgt tatcaattca ctccataaat attaatattg tgtgtgttac taatatagta 1500

ctatgttatg tggtacatag atgtaggtta caaacatgaa aggattggtc ttgtgattaa 1560

agtgatttat tatattattt tatttttaaa attaagttaa tacttttatg atgtggggtg 1620

ctgtaattaa gattctaaag aaggggtaaa agaaaaatga atggacatgc atggaatgca 1680

tatccgaagc cctacaagta aggcaggaag gaatacatgg agatggaata ggaagtacgt 1740

acaagtgtgt taaaatatac aatggttttg agcatggaga tcacttgaag aaagggaaaa 1800

acaaaaacaa ggtatctatt tcgcttttac tgcttctgca atcaaatccc aaagactaaa 1860

aagatcagca attatctcca actcatgatt ttattaggat ttatctacta ttcttctctg 1920

ataataataa taatgagctc acttctatga ctgggatgtt gtccatcagt taagcccaaa 1980

tactcaaatg ctctctttca attttttgtt gtggtcactg caatcatagg aaccaaattg 2040

tgaatcataa aaactttagt caattctcta aaactcaaga cttctgtctc tgtttgctaa 2100

ttaattggga ttaattaaaa aaccatggat ttgcaatgtt atgagttatt ttctagagta 2160

ctctaacctt ctgtcacctc tagcatccaa acgaatggat ccctaacaaa aaataccaga 2220

aatgacagga tattcttttt cttttcaatt tcctcaaatg ataaaaataa aagcagaaga 2280

agtggggtct agttcttgtt aatctccatt ttggtcatga gttctcatat atttgccatc 2340

gtggtaactt ccatggtgtc atagccaact tatggcagtg acaatcatgt tctccattaa 2400

attagcccta gcctagccta ggaatgagag cctagccaac gtggtaaact tttttttact 2460

ccttcatgtg ttctacgttt ttttcttttt gcaaatgatg acatttactc taataagaca 2520

atatattata aataagaaca ccatattatc agaaatcata tttctcttta atcttaatca 2580

tacaaaaccg tggatagaaa ctagagaatt aagatataat gttcaccaaa atcccatgaa 2640

aacaaagata aaaatatgat aaaacatgtt atagctagaa actttaattt aattaacaaa 2700

ttataccaac atataatgag caaagtttct atgaacaaag aaaataataa ataaaaagag 2760

gccaggactt ttttgttctt ttcatacctc tgcatgtaga gttgatgagt aacctttcaa 2820

tgattttgcg atctgttaaa ctatgatcaa cagctaagac atgtggtttc tcatcaaaat 2880

caaaatccat tgatggtaag gaagaaaaag agctggtcat atataccttc aaagaacaca 2940

ccacaatgtc taaccgcctc aacaaaacac aaaaaaaaaa aaaaagaaga aggaaacttt 3000

gagggaaaaa gaaaaaacta gttaggaaga aaagaatgcc aaaaagggaa caaacaagac 3060

aagaagaaaa acaaggcagc gagggtaatg taatgtaatg tgataatcct tgtcaataca 3120

agttatgact gggatactta tatatcgata tcctgactta gcagatactg aatttatagt 3180

aaaatatgaa ggataataag aaaaggtaaa gaataaaagg gtgaggtgag ctcattatta 3240

tcattatcag agaagaatag aaaacaaatc ctaataaaat catgagtcaa agataattgc 3300

tgatcttttc ggtctttagg atttgattgc agaagcagta aaagcgaaat agatacctta 3360

tttttgtgtt tccctttttt caagagatct gcatgctcaa aaccattgta tattttaaca 3420

cacttgtatg tacttcctat tccgtctcca cacagacaac acacggttgt tcaaatatta 3480

tatattcctt cctgccttac ttgtagggct tcggatatgc attccatgca tgtccattta 3540

tttttctttt accccttctt tagaatctta attacaccac cccacgtcat aaaagtatta 3600

acttaatttt aaaaataaaa aaaatataat aaatctcttt aatcataaga ccaatccttt 3660

catatttata acctagatcc atgtaccaca caacatagta ctatattaat aacacacatg 3720

atattaatat ttgtggagtg agttgatgac aaatgatact gttgttgtct tagaaagaga 3780

tctcatttct atacattacc aatttgcttg taagactaag aagagagtct ggtacagtat 3840

gctgtaagaa ggaaatgtat atgggaacat gattgggata atgttcttaa aactttttga 3900

aataaaatta ttatttcaaa ttattatttt tttgtatttt tggataattt tgatatatta 3960

atatcaaaat taattttttt agaaaaacat gatacatata ttaatatatt ttaaaataaa 4020

aaatacttta aaaaacaaca ttaaaatcgc aaataaccct aaataaataa cacggtagat 4080

agatgttaaa gcaatggatg atgttgaaag aattgtaact atttgcaagg acattcagtg 4140

caagggttat gaaaaagctg aaattcacaa aagtgatttt tcatatagac acacacatac 4200

actaatatca ttgatttgta ctctgctata gtaagattga tagtttttaa atataaaaaa 4260

aaaatatcta gatgttatta atgtttttta gtagaaaaaa ataaatcatg cgagaattga 4320

tccgatatga cttggtcttc ttggcaattc caaatgcaac ctggataacc agtaaaaaca 4380

tagtttgatt caaaataaat atttaaaatg agattttttt aataaacatt aagacaataa 4440

catattagat caatttggga aacccggtta acttttcaat ctgaatacta aaccatgaga 4500

tcataataac cccgtaaaaa caaaatcaaa agaaattacg agactcaatt tctaataaac 4560

gaaatgttga aaaataaagt tggaaaaaaa tcatttaaaa aaggaaggaa aataaatgac 4620

ccaagtcaac ctatcaaacc gcaatccagg tcatgagact gggataatcc aataaaaagc 4680

aaattgaaac aaattataaa actcatttct caatcaactc aattttaaaa tataaaattg 4740

aaaaaaaaat aattaaaaaa acacaaaaaa agactcgagt caatcagggt taacccgtca 4800

tactcgttat cctagtcatt gaataaggat aacctcatag aacacagaca aaaaatatca 4860

tgaagtttag ttctcgatca acccaatatt gaatgatgaa tgtgaaaaaa aagagtcaat 4920

tagaaaaata gaaaaaaaac taaagttaat ctgataactt cataaaatat taattgaata 4980

aaatatgaaa ctcaatttcc aataaacaaa gatgcaattg aattttttat aaaaaaaaat 5040

catagattat aaaaaaaaca acaacataga aatgaaggta aaaaaagcta ttatttctat 5100

aaatagtaat atgtgagaag aggtgtagta aaaactcata cttatttagt tttttcttaa 5160

tatatatata actttggggt tatttgaaac agtggtaagg attgttttta aatatgtttt 5220

ttacttagaa atatattaaa ataatttatt ttaattttta aaatttattt tgaacattag 5280

cacattaaaa taattaaaaa acacaaaaaa aaaattgatg gcaataatga catggtgatg 5340

ggtacctttc cctttccctt aatttaaatt tctaaacaca tgataaagaa tctctttatc 5400

tcaccgactt aaaattaact atagatattt atagtcgtaa aactttgact atcttcatat 5460

gtaaatttga aagctagtta gagttgaaaa ataataatac tagttagagt tgaaaaataa 5520

aaataaaaat gacccttaat tttcttattt ttttaaaaaa atatcaaaat aattttattt 5580

attatttttt taaaatatag ctaactatcc tgcaatccaa ccattagttt taaattcaca 5640

tcagattgga ttctaaagag agtaagagac ctttaaatat actttctact agagagaccc 5700

acgtggccac atgcgacgca acaaccaagc tttataattc acttctcagc ttaaacagac 5760

aatgatattt ttgtccgcat gtgacatttt cacacatcac tatacaaaca caatcaattg 5820

ctagcttttg catttcccaa tagttttttt cttcaaaata gtactgtaat tttttgaaaa 5880

aatagcataa atttaaaatt taattataaa aatagtataa tttagcaata tataaatgat 5940

atatgcaatt ctttaaaaaa ataaagttaa aagcaatttt aaaaattaga ttttaaaaat 6000

aaatcaaact ctattattat acaaacttta taacacgatt aaatgctcta ttatcataca 6060

aactctataa gttaaaaaag ttatacacgt gattttataa ctttgcatta tttaattgtt 6120

aatgaatata cttcgtagtt aatcagttaa ttatatataa cattaatttt attcatgtaa 6180

aatatattta ttattaacaa aagtgttttt tatatgtaat attcaattat atttaattaa 6240

tgaatctaga gtaaagataa agtttataga ataaaaatat tttgcattga aaattacaaa 6300

aaaaaaatat aattataaga ttcttattgc atcaaagcat tgttcataaa tgttcctgat 6360

caatgtttta ttaagtttgg atattaatta aagttattga gactgacaga ttatgttctt 6420

tcttttatga gatgaagtag ttgctctcat taaatgaggt atgagagata tatagaatta 6480

atatgtcggt gtttgtcaaa tgacatgtac actgaactaa cctgcaagag aattctatat 6540

gaggaaatca catatatcta tggaaaggtt cctatgatag ttgtgtaagt gatccttaaa 6600

cttgagatca ctaacttatc atatatgagg agtgttatgt tttgatcctg accatatgtt 6660

atcttaatca aggataacaa acatgtatat attagaaata gcgtaaacta tatgaaggta 6720

tttgagtaat caagagataa ttcatcactc taggtgaatt aagaaaaata tttcatctgt 6780

ttttaaataa tattgattgc aaaatcctta accgatgtgg aataagattt gaaaatagtt 6840

tcaaatcata tttaaacaat caatgactat agtgttgata actaaaatta ttttgacaaa 6900

gcagacatat tacatcttat attgtctaaa ttgaaacatt cttgatggag aaataataat 6960

tacactgaga aactggtcac tgaaaggtta aatcaaacaa cttatgactt tcataatatt 7020

tgggggatca tgccagattg ttagaaattg tatttgatct tcaaacataa tggataacac 7080

atataagaac catttgtcaa aagttaaaat aaaatgatta atcatgtgtg acttgattgt 7140

acatgaattt tagaaattaa gaactaaaat gtaattaata cagggggtta caattctaaa 7200

cctaaaaaaa aactaaatag agacttgatt gaataaattt ctaaaattat cttaaaataa 7260

tatatgttat attatttaag aggaaaattg atatttttgt tatttataga gtttttaggt 7320

ttccctataa ataaaatgtg atgcctctta taatagtaca ttataagaaa atatattaaa 7380

caccttaaca cataagaaaa gagctagtac ttaaaggtat gacaatccct ctctcccaaa 7440

agggtttaaa agacttctta ttgatggttt gtgaggatta ctgttagatg atggatactt 7500

gaacgacttg tggtttatga taacctaact ttgaaacaat tattaaaaga aaaaaaaaca 7560

ttaaatattt aaataatctc tatataaacc ctaaacaaca ggtctagatg tagaccttta 7620

atgtcctctc ctcgtagagg aggagatagt tctccctatc gaggaatctc tccttgtagt 7680

gcctcaagag atcctcaagg gaggaaaagg ctaccggaat gtattgtttg gggttttcat 7740

tgtttttttc ttttttttgt ttttctcaaa aatttatcaa aatattgggt aaaaaattgg 7800

atagcaacac ataatgtgac attaaaatga attataatga ttgtgatgag atgtgttgcg 7860

aaatgatgag ttcattggac aataattggg ctttgtttga tggtatattg aagtgttgca 7920

gatatttatc gataaattgg gatctcttga tatatgggat actcttctga aatttttgtt 7980

gatccttgag gatctcttgg tgaaactctt ttcaagttga ttgtgtttgt atagtgatgt 8040

gtgaaaatgt cacatgcgga caaaaatgtc attgtctgtt taagcttagt agtgaattat 8100

aaagcttggt tgttgtgtcg cttatgacca cgtgggcctc tctaatagaa attatattta 8160

caagtctctt actctcttta gaatccaatc tgacgtgaat ttaaaactaa gggttgggtt 8220

gcagctatat ttaaaaaaaa acaaattatt ttgatatttg tttttaaata agcaaattaa 8280

gggtcatttt tttttcaact ctaactagta ttattatttt tcaactctaa ctagatttca 8340

aatttatata tgaagacact caaagtttta taactataaa gacttttaat taattttaag 8400

agacggtcag agttttacaa ctataaatat ctttagctaa ctttaagtcg gttagataaa 8460

gagattcttt atcatgtttt tagaatttta aattaaggga aagggaaagg tacccatcat 8520

catgtcatta ttgcccatca attgttttgt gttttttaat tattttaatg tgctgatgtt 8580

caaaataaat tttaaaaatt aaaaaaaaaa ttattttaat gtatttctaa gtaaaaaata 8640

tatagaaaaa caatttttac cattattcca aataacccca aagttataca tatattaaga 8700

aaaaactaaa tgagtattag ttttcactac accccttctc acatattact attcatagga 8760

ataatagatt tttttacctt catttctatg ttgttgtttt ttttataatc tatgattttt 8820

taaaaaaaaa ttcaattgca tctttgttta ttggagattg agtttcatat ttttttcaat 8880

taatatttta tgaagttatc agattaaatc tagttttttt tttctatttt tctaattgac 8940

ttttttttct caaatttatc attcaatatt gggttgatcg agaaccagac ttcatgattt 9000

tttttgtctg ttttctatga ggttatcctc attccatgac taggatcacg agtatggcga 9060

gttaaccttg attgactaga gttttttttt gtattttttt taattatttt tgtttcaatt 9120

tcatatttta aaattgagtt gattgataaa taagcttcat aatttgtttc aatttacttt 9180

ttattgggtt atcccggtct catgacctgg attgcggttt gataggttga cttgggtcat 9240

ttgttttcct tcctttttta attgattttt ttccaacttt atttttcaac attgtgttta 9300

ttagaaattg agtatcgtaa tttattttga ttttctttct acgaggttat tatgatctca 9360

tggtttagta tgcagattga aaagttaacc gggtttccca aattgatcta atatgttatt 9420

gtcttaatat ttattaaaac aatctcattt taaatattta ttttgagtca aactatgttt 9480

ttaccggtta tccatgttgc atttggaatt gccaagagga ccgaatcata tcggatcaat 9540

tcccgcatga tttatttttt tctactaaaa aacattaata acatcttaat gttttttata 9600

tttaaaaaat attaatctca ctctagcaaa gtacaagcca atgatattaa cgtatgtgtg 9660

tgtatgtatc aaaaatcact tttgtgaatt tcagcttttt cataaccctt gcacttaatg 9720

tccttgcaaa tagtgacaat tctttcaaca tcatccattg ctttaacaat tatctaccgt 9780

gttatttatt tagggttatt tgagattttg atgttgtttt ttaaagtatt ttttatttta 9840

aaatatatta atatatgtat catgtttttc taaaaaaatt aattttgata ttaatatatc 9900

aaaataatca aaaaatacaa aaaaaataat aatttgaaat taaaattttt tttcaaaaag 9960

ttttaaaaac attatcccaa tcatgttctc atatacattt ccttcttaca gcatactgta 10020

ctacattatc ttcttagtct tacaagcaaa ttagtaatgt atagaaatga gacatctttc 10080

taaaacaaca acagtaccat ttgtcatcaa ctcactccac aaatattaat attatgtgta 10140

ttactaatat agtactatgt tatgtggtac atagatctag gttacaaatc tgaaaggatt 10200

ggtcttgtga ttaaagagat ttattatatt cttttatttt taaaattaag ttaatacttt 10260

tgtgaggtgg agtggtgtaa ttaagattct aaagaagggg taaaagaaaa atgaatggac 10320

atgcatggaa tgcatatccg aagccctata agtaaggcag gaaggaatgt ataatatttg 10380

aacaactgtg tgttgtttgt gtggagatgg aatacgaagt acgtacaagt gtgttaaaat 10440

atacaatggt tttgagcatg gatatctctt gaaaaaaggg aaaaacaaaa acaagaaaat 10500

atttatttcg cttttactgc ttctgcaatc aaatcctaaa gaccaaaaag atcagcaatt 10560

atctctgact catgatttta ttaggatttg tttactattc ttctatgata aagataataa 10620

taagctcatc tcaccttttt atcgttactt tttcttatta tcctttatat tttactataa 10680

attcattatc tgctaagtca ggatatcgat atataagtat ccccagtcat aacttgtatt 10740

gacttgacaa ggattattac attacattac gttaacctcg ctaccttgtt tttcttcttg 10800

ttttgtctat tcccctttta gcattctttt cttactagct agttttctct tttttttcct 10860

taaagtttcc tttacttttt gtgttttgtt gaagtggtta gatattgtgg tgtgttcttt 10920

gaaggtagat acggccaact ctttttctta tttaccatca ataaagtttg attttgatga 10980

gaaaccacat gtgttagctg ttaataatag tttgatagat cgcaaagtca ttgaaaggtt 11040

actcatcaac tctacatgca gaggtatgaa aagaacaaaa aaatcttggcctctttttat 11100

ttattatttt ctttgttcat agaaactttc ctcattatat gttggtataa tttgttaatc 11160

aaattaaagt ttatagctat aacatgtttt atcatatttt tatctttgtt ttcatggggt 11220

tttggtgaac attatatctt aattctctag tttctatcca cggttttgta tgattaagat 11280

taaagagaaa tatgatttct tataatatgg tgttcttatt tataatatat tgtcttatta 11340

gagtaaatgt caacatttgc taaaggaaaa aaacatagaa cacgtgaagg aataaaaaaa 11400

agtttatcat gctggctagg ctctcattcc taggctaggc tagggctagg gctaatttaa 11460

tggagaacat gattgtcact gccataagtt ggctatggca tcatggaagt taccacggta 11520

acaaatgtat gagaactcat gactaaagta gagattaaca agaactagac cccacttttt 11580

tgtttttatt tttatcattt tgaggaaatt ataaagaaaa agaatatcct gtcatttttg 11640

atattttttt ttttgttaga gatccatttg tttgaatgct agagatgata aaagattaca 11700

gtagtctaaa aaataactta taacattgca aattcatgat tttttaatta attttaatta 11760

attaacaagc aaataaagag ttcttgagtt ttagagaatt cactaaagtt ttgactaaag 11820

taacagaaaa caaaaagaga gcattggagt atttgttgtc catcactaaa acactcaaaa 11880

tcagtttaaa aatccttcaa cttaataatt attaccacac aatactcaca taaccgccag 11940

catcactgtc tctttcttat ctagtaaagc taaattcaac tacctttaca aggttttcaa 12000

tctcatgctt ctaaatagaa gatatctttt tttttatcga aaatataaaa taatatgagc 12060

aaagctaaaa aaacagcctt tttgcaccac ataataaaag gaagcacaca cattatccaa 12120

tttcaaataa tcgaaataaa aaagagcaaa ctcaccgtcg attgcagaag ccttgagttg 12180

cgcaagcgcc ataacactcg atctcttcaa ttcttcctta tcgattgaat tcaaattctg 12240

agtcacactt tcacatctaa cacgaaggct ttgatttaaa gccgatgccc ttctattgtt 12300

caagggtttg tagaaggttt gcaattgagg acaagacaaa gtcgatggaa ggaggttagg 12360

atttgattgt gtagaagtag caatagaggt ggcgaaaccg aatgccgccg ccatcggcga 12420

agaaaagacg gaggccacga caagagagtt agtgaaactt gatccccgag taatgagagg 12480

attatttgga ggtggatcag agaggtgatt tgaagatgtg ctgttgggtt agagagcgga 12540

ggtttggtga agaaataaaa aaactaataa taatttgaca agggaattgc gttgcggtgg 12600

tctttgtttg ggttgtatat atatatctat tgacctgtga caactattcc catgatttta 12660

tgaccttttc caacaaggaa aaggaggaag ggaaaaggtc ggttttaggc aggaggaaaa 12720

cgggattgga atcggaaaag ggatatttac gcgttttgtc cacccgccca gcatggaggc 12780

atggactgcg ctaggagtta ggaaaggtca gatgtttgat tccttttata actaaccatg 12840

gtttgttcta atctgtcaac ctcctttatt tgtcaactat agtggccagg aagggccagt 12900

agctgattgg tgtaatggtg agctaacttt ttatattgcg gtcatttata acgttgagaa 12960

tttgaatttt ccctggaacc atagttatta cccaggtccg agcgtaagaa aattaaccca 13020

aagttatttt tatatgtttt tgataaattt gacagattaa tttattatct agttaaaatt 13080

taatttaaat ttttttaaaa atattttttt attaatttaa tttaacttgt taaatatata 13140

agttaattct tgttaaatat ctcgtttgaa cattacgaag cagatgttat tggataaaaa 13200

tataatccag gtcagcttga acaaagttaa acgtcaagaa atatctttgt tcaatttaga 13260

aaagcttata gctgcgaccg ggaatttgat actgccagtg gttttggcca agtgtacaag 13320

gtactgtttg agctcttgcg aatttcttat catcgctgaa ttgaatagtt gtcgaaagat 13380

tacggagatt ttgcagagga aattgccaga tggacaggac atggatgtga aaagactctc 13440

aagagcagct gggcaaggcc ttgaagaaat catgaataag gttgaggtga tttctaaacg 13500

gctcttttta gttagagcta ttgccctatc tctttagtaa ataccctaca attttgccga 13560

attattgtcg cttatggttt aacaaagata acaaagtaat gatagttttc tagttatatg 13620

tgaaattatt atatttatat aaatatatat ttattattat taaaatttta atttattttt 13680

aatatttatg taatattaga ttaataaata tatagtaaaa ataaagtcta tgaaataaaa 13740

atgttttgca aagaaaatta taaagttttt ataattatga aattcctatt gcatcaaagt 13800

attgtttcta aagtgttatt aattgatgat ctgttaaata ttggacattc attaaagttg 13860

taaagactga tacatattat attctttcct ttatgaaagg aagcagttgt tctcataaac 13920

tacggtataa aggataccta aaactactat gtaggtgctt gtcattatac atgtacactg 13980

aactaactcg cataagaatt acataaggac agaacactta tgtctatgga aaggctcaca 14040

tgaaagttgt aagttaccgt ttgactaata attggatggc ttgtggttta cgacaactca 14100

gcttttaaag aattatttaa aatagaagaa aattagatct tcaggtaata aatccctaaa 14160

caattttata tctgtctaac aggatcctag agattcttga aaaaatttat tttatagttt 14220

tcaccgtata tgatatttga aaaactgaac cgttagatca gaaaagacaa aggaaagtta 14280

tggtaataac tagatcattg aagatgagta atatttaccttaattctttt caacagctcg 14340

taacttgtca ttcttggcat actataatcg gtgatgatca tattcacctt caaattctcc 14400

taaaagaaat acccatgaac aacaaatgat ggagttgaat tcatagaagc aagaatcaga 14460

cctttattgt atggttactt acactatgac tgggatgttg tccatcacct aagcccaaat 14520

actccaatgc cctcttctgt tttctactgt ggtcactgcc aaattatgaa tcataaaaac 14580

tttagtcaag tctctaaaac tcaagacttc tttctctgtt tgctaattaa ttgggattaa 14640

ttaaaaaact atggattttc aatgttatga gttattttct agagtactct aaccttttgc 14700

cacctcgagc atccaatcaa atggatccct aacaaaaaat atcagaaatg acaggatatt 14760

cttttccttt tcaatttcct caaagtgata aaaaataaaa acagaaaaag tggggtctag 14820

tccatgttaa tctccatttt ggtcatgagt tctcatacat ttattaccgt ggtaacttcc 14880

atggtgccat agccaactta tggcagtgac aatcatgttc tccattaaat tagccctagc 14940

cctagcctag cataggaatg agagcctagc caaaatgata aacttttttt tattccttca 15000

cgtgttctat gtttttttcc tttagcaaat gatgacattt actctaataa gacaatatat 15060

tataaataag aacaccatat tataagaaat catatttctc tttaatctta atcatacaaa 15120

accgtggata gaaactagag aattaagata taatgttcac caaaacccca tgaaaacaaa 15180

gataaaaata tgataaaaac atgttatagc tagaaacttt tctttgatta acaaattata 15240

ccaacatata atgagcaaag tttatataaa caaagagaat aataaataaa aaaaggccaa 15300

aacttttttg ttcttttcat acctctgtat gtagagttga tgagtaacct ttcaatgact 15360

ttgcgatcta tcaaactatc atcaacagct aacacatgtg gtttctcatc aaaatcaaac 15420

tccattgatg ctaaggaaga ataagagctg gccatatcta ccttcaaaga acacaccaca 15480

atgtttaacc acctcaacaa aacacaaaag aaaaggaaaa tttgaggaaa aaaagagtaa 15540

actagctagc aagaaaagaa tgccccaagg agaacaaaca agacaagaag aaaaacaagg 15600

cagcgagggt aacgtaatgt aatgtgataa tccttgtcaa gtcaatacaa gttatgactg 15660

gggatactta tatatcgata tcctgactta gcagatactg aatttatagt aaaatatgaa 15720

ggataataag aaacattaaa gaataaaagg gtgaggtgag ctcattgtta tcattatcag 15780

agaagaatag taaacaaatc ctaataaaat catgaggcgg agataattgc taatcttttc 15840

ggtctttggg atttgattgc agaagaagta aaagcgaaat agataccttc ttatttttgt 15900

ttttaccttt cttcaagaga tctccatgct caaaaccatt gtatatttta acacacttgt 15960

acgtacttct tattccatct ccacacagaa aatacacggt tgtttaaata ttatatattt 16020

cttcctgcct tacctctagg gcttcggata tgcattccat gcatgtccat tcatttttct 16080

tttacccctt ctttagaatc ttaattacat caccccacat cataaaagta ttaaattaat 16140

tttaaaaata aaagaatata ataaacctat ttaatcacaa gaccagtcct ttcatatttg 16200

taacctaaat ctatgtacta cacaacatat tactatatta gtaacacaca caatattaat 16260

atttgtggag tgagttgatg acagatggta ctattattgt cttaaaaaga ggtctcattt 16320

ctataaatta ccaatttgct tgtaagatta agaagagaat ctagtacagt atgctgtaag 16380

aaggaaatat atatgggaac aagattggaa tagtgttttt aaaacttttt gaaaaaaaat 16440

tttaatttca aattattatt ttttttgtat tttttgatca ttttgatata cttatatcga 16500

aagtaaattg ttttagaaaa acataataca tatattaata tattttaaaa caaaaaaaac 16560

actttaaaaa acaacatcaa aatctcaaat aaccctaaat aaataacacg gtagatagtt 16620

gttaaagcaa tggatgatgt tgaaagaatt gtaactattt gcaaggacat taagtgcaag 16680

ggttatgaaa aagctgaaat tcacaaaagt gatttttgat acacacacac acacgtacgt 16740

taatatcaat gacttgtact ctactatagt gagattaata ttttttaaat gtaaaaaata 16800

tttagatgtt attaatgttt tttagtagaa aaaaaataaa tgatgcggga attgatctga 16860

tatgactcgg tcctcttggc aattccaaat gcaacatgga taaccggtaa aaatatagtt 16920

tgactcaaaa taaatattta aaatgagatt gttctaataa acattaagac aacaacatat 16980

tagatcgatt tgggaaaccc ggttaaattt tcaatctgca tactaaacca tgagatcata 17040

ataaccccat agaaaataaa cgaaatgttg aaaaataaag ttggaaaaaa atcaattaag 17100

aaagggagga aaacaaatga ccaaagtcaa cctaccaaac tgcaatccaa gtcatgagat 17160

cgggataacc caataaaaaa caaattgaaa caaattatga atctcatttc tcaatcaact 17220

caattttaaa atatgaaatt gagaaaaaat aattaaaaat gagacctcat aaaaaaaatt 17280

aaaaataatc aactcaatca acactatccc aatcatgttc ccatatacat ttccttctta 17340

caacatactg tactagagtc tcttcttagt cttacaaaca aattggtact atatagaaat 17400

gagacctctt tctaagacaa caacaatacc atttgtcatc aactcactcc acaaatatta 17460

atattatgtg tgttactaat atagtactat gttgtgtggt acatagatct aggttacaaa 17520

tctgaaagga ttggtcttgt gattaaagag atttattata ttcttttatt tttaaaatta 17580

agttaatact tttatgatgc ggggtggtgt aattaagatt ctaaagaagg ggtaaaagaa 17640

aaatgaatgg acatgcatgg aatgcatatc cgaagcccta caagtaaggc aggaaggaat 17700

atataatatt tgaacaaccg tgtgctttct gtgtggagat ggaataggaa gtacgtacaa 17760

gtgtgttaaa atatacaatg gttttgagca tggagatttc ttgaagaaag ggaaaaacaa 17820

aaacaagaaa atatttattt cgtttttact gcttctgtaa tcaaatccca aagaccgaaa 17880

agatcagcaa ttatcttcga ctcatgattt tattaggttt tgtttactat tcttctctga 17940

taatgataat aatgagctca cctcaccctt ttattcttta ctttttctta ttatccttta 18000

tattttacta taaattcact atctgctaaa tcaggatatt gatatataag tatccccagt 18060

cataacttgt attgacttga caaggattat cacattgcat tacgttaccc tctcattcct 18120

aggctaggct agggctaatt taattgaaaa catgattgtc attgccataa gttggctata 18180

gcaccatgga agttaccacg gtgataaata tatgagaact catgaccaaa gtggagatta 18240

acaaggacta gatcccactt cttctgcttt tatttttatc actttgagga aattgaaaag 18300

gaaaagaata tcctgtcatt tctggtattt tttgttaggg atccatttgt ttggatgcta 18360

gaggtggcac aaggttagag tactctagaa aataactcat aacattgcaa atccatggtt 18420

ttttaattaa tcccaattaa ttaacaagca tagaaagaag tcttgagttt tagagacttg 18480

actaaagttt ttatgattca caatttggtt cctatgattg cagtgaccac aataaaaaat 18540

ggaagagagc attggagtat gtgggcttag ctgatagata acatcccagt catagtgtaa 18600

gtaaacccta aact 18614

<210>4

<211>12

<212>DNA

<213>Poplus deltoides

<400>4

tgcgatctat ca 12

<210>5

<211>14

<212>DNA

<213>Poplus deltoides

<400>5

tttgatagat cgca 14

<210>6

<211>14

<212>DNA

<213>FERR'(Artificial)

<400>6

tcttatcgac cgga 14

Claims (10)

1. A female promotion gene FERR of Populus deltoides has a nucleotide sequence shown in SEQ ID NO. 1.

2. The protein expressed by the female-promoting gene FERR of Populus deltoides as claimed in claim 1, wherein the amino acid sequence thereof is represented by SEQ ID No. 2.

3. A vector, recombinant bacterium or host cell comprising the female-promoting gene FERR of Populus deltoides according to claim 1.

4. The use of female-promoting gene FERR of Populus deltoides according to claim 1 for early sexual identification of Populus tremula and molecular breeding of Populus tremula.

5. The use of the female-promoting gene FERR of Populus tremula as claimed in claim 1 in molecular breeding of Populus tremula, comprising the steps of:

1) preparing a knockout vector of the FERR gene;

2) knocking out a female promotion gene FERR in a female poplar plant;

3) cultivating and screening to obtain the poplar plant with female flowers which do not develop or produce flying floc.

6. The use of the female-promoting gene FERR of Populus tremuloides of claim 1 for promoting female flower development in plants, comprising the steps of:

1) constructing a female promotion gene FERR vector of the poplar;

2) transforming the constructed female promotion gene FERR vector into plants or plant cells;

3) and culturing and screening to obtain plants with increased pistil or enhanced pistil development.

7. An oestrogen suppressing gene FERR-R of populus tremuloides, the nucleotide sequence of which is shown in SEQ ID No.3, contains an action site sequence, and the target gene of the oestrogen suppressing gene FERR-R is the oestrogen promoting gene FERR of populus tremuloides as claimed in claim 1.

8. A vector, recombinant bacterium or host cell comprising the female repressing gene FERR-R of Populus deltoides according to claim 7 or a sequence of the site of action thereof.

9. The use of the female suppressing gene FERR-R of Populus tremuloides of claim 7 or its action site sequence for the early sex determination of Populus tremula and the molecular breeding of Populus tremula.

10. The use of the female repressing gene FERR-R of Populus tremuloides as claimed in claim 9, or its action site sequence, in molecular breeding of Populus tremula, comprising the steps of:

1) constructing a recombinant vector of an oestrogen FERR-R of populus tremuloides or an action site sequence thereof;

2) transforming the constructed female suppression gene FERR-R of the populus tremuloides or the recombinant vector of the action site sequence thereof into a female poplar plant or a female poplar plant cell;

3) cultivating and screening to obtain the poplar plant with female flowers which do not develop or produce flying floc.

Images