CN111848768B - BtISWI gene and application thereof in regulating and controlling cryptogenic temperature preference of bemisia tabaci MEAM1 - Google Patents

BtISWI gene and application thereof in regulating and controlling cryptogenic temperature preference of bemisia tabaci MEAM1 Download PDF

Info

Publication number
CN111848768B
CN111848768B CN202010657535.1A CN202010657535A CN111848768B CN 111848768 B CN111848768 B CN 111848768B CN 202010657535 A CN202010657535 A CN 202010657535A CN 111848768 B CN111848768 B CN 111848768B
Authority
CN
China
Prior art keywords
glu
lys
leu
arg
bemisia tabaci
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010657535.1A
Other languages
Chinese (zh)
Other versions
CN111848768A (en
Inventor
吕志创
冀顺霞
王晓迪
申晓娜
梁林
刘万学
万方浩
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Original Assignee
Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Plant Protection of Chinese Academy of Agricultural Sciences filed Critical Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Publication of CN111848768A publication Critical patent/CN111848768A/en
Application granted granted Critical
Publication of CN111848768B publication Critical patent/CN111848768B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N57/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
    • A01N57/10—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds
    • A01N57/16—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds containing heterocyclic radicals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Medicinal Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Insects & Arthropods (AREA)
  • Agronomy & Crop Science (AREA)
  • Pest Control & Pesticides (AREA)
  • Dentistry (AREA)
  • Environmental Sciences (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)

Abstract

The invention relates to the technical field of agricultural biology, in particular to a BtISWI gene and application thereof in regulating and controlling hidden temperature preference of Bemisia tabaci MEAM 1. The nucleotide sequence of the gene is shown as SEQ ID No. 1. The BtISWI gene of the hidden variety of the bemisia tabaci MEAM1 is obtained by cloning, and the function of the gene in the hidden variety of the bemisia tabaci MEAM1 temperature preference is verified by a temperature preference instrument.

Description

BtISWI gene and application thereof in regulating and controlling cryptogenic temperature preference of bemisia tabaci MEAM1
Technical Field
The invention relates to the technical field of agricultural biology, in particular to a BtISWI gene and application thereof in regulating and controlling hidden temperature preference of Bemisia tabaci MEAM 1.
Background
Bemisia tabaci, Gennadius, Arthropoda, Insecta, Hemiptera, Trialeuroviridae, Trionycis, also known as Sogatella gossypii or Ipomoea batatas.
The most suitable development temperature of the bemisia tabaci is 26-30 ℃, the development critical temperature is 10.8-12.5 ℃, and the lethal high-temperature area is 37-42 ℃. The strong temperature stress adaptability is the reason that bemisia tabaci is widely distributed in the world. With the increase of greenhouse effect, the global temperature is increasing year by year, and the tobacco whitefly can gradually expand the protection area due to the strong temperature stress adaptability, thereby providing places for resisting temperature stress and continuing populations. In nature, each animal has respective preference for the ambient temperature, the ambient temperature influences the behavior of the animal to a great extent, the most suitable development temperature of the bemisia tabaci is reported to be 26-30 ℃, but the temperature preferred by the bemisia tabaci and the mechanism preferred by the bemisia tabaci for controlling the temperature are not well understood.
Chromatin remodelling (chromatin remodelling) is one of the current research hotspots in the field of epigenetics, driving the replacement or rearrangement of nucleosomes, altering the spatial conformation of chromatin. ATP-dependent chromatin remodeling is an important epigenetic regulation mechanism for chromatin remodeling complex to utilize energy released by ATP hydrolysis to change chromatin structure, thereby regulating eukaryotic gene expression. Chromatin remodeling plays a key role in the regulation of expression of genes related to biological defense, and chromatin remodeling factors ISWI (inactivation SWI) can participate in the regulation of environmental stress on biological adversity and play an important role in regulating the expression of genes related to abiotic stress. The role of ISWI in temperature stress of bemisia tabaci is not known.
Disclosure of Invention
The invention aims to clone BtISWI genes from the hidden variety of Bemisia tabaci MEAM 1.
The invention further aims to verify the function of the BtISWI gene in the temperature preference of the bemisia tabaci and provides application of the BtISWI gene.
According to the BtISWI gene, the cDNA full-length nucleotide sequence of the BtISWI gene is shown as SEQ ID No. 1:
GGTTTTTCCTTCCGCATGAGAGACCTTTCTTCTCTTGTGTTTACAAGTCACAGTGATTTTATTGTGAATTTCTCAACACTTACGTTTTTTCTGAAGTGCGTTACCTTATAATTTTATATCAAAGACTAATTTTTAATTACCTGACGAAACATCATCCATTTTTATTGTAGTGTTGTAATCCATCGGAACTTATCCGGTATTTTTGAGTGCGTGCAAGGTATCTTTTGTCAAAATGGTTAAAACGGGGTCTGAAAACCGGTCAGACGACGGTTCCGATGGTGAAGAATTGTCGAACGAATCATCCTCTATGGAAGCTCCGCCCGCTCCGAAAAGTCTTAAAGCAGAATTCGATAAACCTGGAGTTGACCAGAGTAAGCGCTTTGAATTCTTACTAAAACAGACCGAAATTTTCTCTCACTTCATGACGAACAGCAACAAGGATAAAACTTCCCCAACAACCACTGGAAAACCTAAAGGTAGGCCTCGGAAAGAACAACCCAAATCCTCCGATTCACCCTCTAAAGATTCTGCTGATCATCGTCACCGGAAAACAGAGCAAGAGGAAGATGAAGAACTACTGGCTGAGAGTAACGCAGCCACAAAGACCATAACCATGTTTGACTCCTCACCATTCTACATTAAAAATGGTGAATTACGAGATTACCAAGTTCGTGGTCTAAACTGGATGATTTCTCTCTTTGAAAACGGCATTAACGGTATTCTTGCCGATGAGATGGGTCTAGGTAAAACCCTTCAAACCATCTCGCTACTTGGTTACATGAAGAACTTCCGCAACATCTCTGGCCCTCATATGGTCATTGTCCCTAAGTCAACCTTGATGAACTGGATGAATGAATTCAAAAAGTGGTGTCCCTCGCTGAAAGCAGTTTGTTTAATTGGAGACCAAGAAGCTCGTAATAATTTCATCAGAGACGTTTTAATGCCTGGAGACTGGGACGTTTGTGTAACTTCTTATGAAATGATCATTCGAGAGAAAAGCACCTTGAAGAAATTTAATTGGCGTTACATGGTCATTGACGAAGCTCACCGTATTAAAAACGAGAAATCCAAGTTATCAGAAATTGTTCGAGAATTCAAGACAACCAACAGATTGCTGCTAACTGGAACTCCATTACAAAACAACCTTCATGAGTTATGGTCTCTGTTGAATTTCTTGCTACCTGATGTCTTTAATTCATCAGATGATTTTGATGCATGGTTCAATACGAATACTTGTCTTGGTGACAATGCACTTGTTGAAAGATTGCATGCAGTTTTAAGACCTTTCTTGTTGCGTCGTCTCAAGTCTGAAGTGGAAAAGCGATTGAAACCCAAAAAAGAATTAAAGGTGTATGTTGGCTTAAGTAAAATGCAAAGAGAGTGGTATACTAAAGTCCTGATGAAAGATATTGACATTGTGAATGGTGCTGGAAAAATTGAGAAAATGCGGCTTCAAAACATCCTGATGCAACTGCGAAAGTGCTGTAACCACCCGTATCTTTTTGATGGCGCTGAACCTGGTCCACCATATACAACAGATGAGCACTTGGTATTTAACTGTGGCAAAATGGTCATTCTTGATAAGCTGCTGCCGAAATTACAAGAACAAGACTCAAGGGTGCTAATTTTTAGTCAAATGACGCGTATGATTGACATCCTTGAAGATTTCTGCCACTGGCGTGGATACAAGTATTGCAGGTTAGATGGTCAAACTCCCCATGAAGATCGACAGCGGCAGATCAATGAATTTAATGCCCCAAACAGCGACAAATTCATTTTCATGTTGTCAACTCGCGCTGGTGGTCTTGGTATCAACTTGGCAACTGCAGATGTAGTTATCATTTATGATTCTGACTGGAATCCTCAAATGGACTTGCAGGCCATGGACCGAGCTCATCGTATAGGTCAGAAAAAACAAGTGCGAGTTTTCCGACTAATCACCGAAAATACCGTTGAGGAAAAAATTGTTGAAAGAGCAGAAGTGAAATTACGTCTGGACAAGCTGGTCATTCAACAAGGTCGCTTAGTCGACAACAAGGCTGCTCTCCAAAAAGACGAAATGCTTAACATGATTCGGCATGGTGCCAATCATGTCTTTGCTTCAAAAGACTCAGAAATTACAGATGAAGATATTGATACAATTCTTGAGAAAGGTGAGGCTAAGACTGAAGAGATGAAGCAAAAGCTAGAAACGCTCGGGGAATCCTCTCTTCGAAATTTCACTCTCGATGCTCCCACTGAATCTGTTTATCAGTTTGAAGGGGAAGACTACCGTGAAAAGCAAAAACTCACCGGGATTGGAAATTGGATTGAGCCTCCTAAGAGAGAGAGGAAAGCAAACTATGCTGTCGATGCATATTTCCGTGAAGCGCTCCGAGTTTCAGAACCGAAAGCACCAAAAGCTCCAAGACCTCCAAAACAACCAATTGTCCAAGATTTCCAGTTCTTTCCAATGCGTCTATTTGAGCTGTTAGATCAAGAAATCTACTATTTCCGCAAGTCAGTGGGCTACCGGGTACCCAAGAACCCTGAGTTGGGTGTAGATGCAAACAAAATACAGAAAGAAGAGCAGAAGAAGATCGACGAGGCACAACCACTGACTGAAGAAGAACTATTGGAAAAAGAAGATCTTCTGACGCAAGGATTTACCAACTGGACGAAGCGTGATTTCAACCAATTCATAAAAGCTAATGAAAAATTTGGTAGAGACGATATTCACAACATTTGCAAGGAAGTCGAAGGCAAAACCCCCGAAGAAGTTATAGAGTATAGCAGTGTATTTTGGGAACGCTGTCAGGAATTACAAGATATTGAACGAATAATGGCTCAAATAGAACGTGGTGAAGCAAAAATCCAACGCCGTGCCAGTATAAAGCGAGCCTTAGATGCTAAAATGGAGAGGTATCAAGCGCCATTCCACCAGCTGAGAATATCCTACGGCACAAACAAAGGCAAAAACTACACCGAAGAAGAAGATCGGTTTTTGGTTTGTATGTTGCATCGACTTGGATTCGACAAGGAGAATGTGTATGAAGAACTCCGATCTGCAACAAGGTTTGCCCCTCAGTTCCGCTTTGACTGGTTCATCAAGAGCAGAACTGCGATGGAATTGCAGCGACGATGTAACACATTAATCACACTCATTGAGCGAGAAAATCAAGAACTAGAGGAGAAAGAGAAAGCAGCTGACAAAACAAAGAACAAGCGAGGGCCTCGTGCTGGCCAAGGCAAACGGAAAAGCGAAGCTAACGCTGTGGCCGATTCGAAACCAACCTCAGCTAAAAAGAAGAAAAAGAACTAAAAATCCTCGAGTCAGGTGTTTCTTCTCAATTTCTCGGTGTACAGTCCTGAACTTGAAAATTTTGAGCTGTTTTAATTTTGTCCAGACAGAAATTTCAGTTTGTATAAAGCACACTATTTGCTTTAAATAAGAATCCTCCTCCTTTCATCTTAATTTCTGATAAACTTATGAATTTGTAAATAGTCATTTGATATCTCTAAAGAAACAACTAAGTAAAGTGAGGATAATATTCTCAGCTGCATATTTCATGTGAGAAAAAGGGCATAACTGAGAATATATCTGATAGACTCATCTTGGCATCAATGGTATGCCCTCCTTACATTGATGAATCAGTTTCTATCAAGGTGGCCAATCAAAATGATTCGGTCTCTTTTTCCTGTACCTGTGATTACTTAGAATGTAGGTATTTAA
the amino acid sequence of the gene code is shown as SEQ ID No. 2:
MVKTGSENRSDDGSDGEELSNESSSMEAPPAPKSLKAEFDKPGVDQSKRFEFLLKQTEIFSHFMTNSNKDKTSPTTTGKPKGRPRKEQPKSSDSPSKDSADHRHRKTEQEEDEELLAESNAATKTITMFDSSPFYIKNGELRDYQVRGLNWMISLFENGINGILADEMGLGKTLQTISLLGYMKNFRNISGPHMVIVPKSTLMNWMNEFKKWCPSLKAVCLIGDQEARNNFIRDVLMPGDWDVCVTSYEMIIREKSTLKKFNWRYMVIDEAHRIKNEKSKLSEIVREFKTTNRLLLTGTPLQNNLHELWSLLNFLLPDVFNSSDDFDAWFNTNTCLGDNALVERLHAVLRPFLLRRLKSEVEKRLKPKKELKVYVGLSKMQREWYTKVLMKDIDIVNGAGKIEKMRLQNILMQLRKCCNHPYLFDGAEPGPPYTTDEHLVFNCGKMVILDKLLPKLQEQDSRVLIFSQMTRMIDILEDFCHWRGYKYCRLDGQTPHEDRQRQINEFNAPNSDKFIFMLSTRAGGLGINLATADVVIIYDSDWNPQMDLQAMDRAHRIGQKKQVRVFRLITENTVEEKIVERAEVKLRLDKLVIQQGRLVDNKAALQKDEMLNMIRHGANHVFASKDSEITDEDIDTILEKGEAKTEEMKQKLETLGESSLRNFTLDAPTESVYQFEGEDYREKQKLTGIGNWIEPPKRERKANYAVDAYFREALRVSEPKAPKAPRPPKQPIVQDFQFFPMRLFELLDQEIYYFRKSVGYRVPKNPELGVDANKIQKEEQKKIDEAQPLTEEELLEKEDLLTQGFTNWTKRDFNQFIKANEKFGRDDIHNICKEVEGKTPEEVIEYSSVFWERCQELQDIERIMAQIERGEAKIQRRASIKRALDAKMERYQAPFHQLRISYGTNKGKNYTEEEDRFLVCMLHRLGFDKENVYEELRSATRFAPQFRFDWFIKSRTAMELQRRCNTLITLIERENQELEEKEKAADKTKNKRGPRAGQGKRKSEANAVADSKPTSAKKKKKN
the invention also provides application of the BtISWI gene in regulation and control of hidden temperature preference of bemisia tabaci MEAM1, and provides a theoretical basis for discussing interaction between the BtISWI gene and other stress genes to temperature preference and adaptability of insects.
The invention further provides application of the bemisia tabaci MEAM1 recessive chromatin remodeling factor gene BtISWI in control of bemisia tabaci.
The BtISWI gene of the hidden variety of the bemisia tabaci MEAM1 is obtained by cloning, and the function of the gene in the hidden variety of the bemisia tabaci MEAM1 temperature preference is verified by a temperature preference instrument.
Drawings
FIG. 1 Effect of dsRNA treatment of BtISWI gene on temperature preference of Bemisia tabaci MEAM1 cryptophyte adults: feeding BtISWI gene dsRNA, feeding dseGFP, feeding 10% sucrose for 3h, and feeding the diaphorina tabaci MEAM1 cryptophyte adult temperature preference proportion without any treatment. All data were statistically analyzed using SPSS 16.0 statistical software with significance test level P < 0.05.
Detailed Description
Example 1 cloning of full-Length cDNA sequence of the Gene of Nicotiana tabacum MEAM1 Cryptogen ISWI
200 heads of the bemisia tabaci adults are taken and put into a centrifugal tube with the volume of 1.5mL, the bemisia tabaci adults are frozen by liquid nitrogen and ground into powder by using a grinding rod, and then RNA is extracted and stored at the temperature of minus 80 ℃ for later use.
Designing a primer and carrying out PCR amplification. The primer sequences are shown in table 1:
TABLE 1 cloning of primer sequences of BtISWI Gene full-Length cDNA
Primer Primersequence(5’to3’)
ISWI-F1 GCTTCAGCCAATATGGCGACT
ISWI-R1 CGGCAGCAGCTTATCAAGAATG
ISWI-F2 GACCTTTCTTGTTGCGTCGTCTC
ISWI-R2 GGCGCTTGATACCTCTCCATTT
ISWI-F3 ACTATTTCCGCAAGTCAGTGGGC
ISWI-R3 GACGACGCATCTCAAGGCTAAA
The sequence in Table 1 is utilized, the full length of the cDNA sequence of the BtISWI gene is 3712bp through PCR amplification, the obtained gene has a nucleotide sequence shown as SEQ ID No.1, and 1022 amino acid sequences shown as SEQ ID No.2 are coded by the gene. The conservative domain analysis of the amino acid sequence coded by the cloned gene shows that BtISWI comprises an N-terminal ATPase structural domain, a C-terminal HAND, SANT and SLIDE structural domain, and the cloned gene is determined to be a chromatin repeat factor gene of coding aleyrodids MEAM1 cryptic species.
Example 2 Effect of dsRNA treatment of Bemisia tabaci MEAM1 recessive ISWI genes on temperature preference of Bemisia tabaci MEAM1 recessive species
1. Preparing a dsRNA template:
(1) the primer sequences for dsRNA synthesis of target genes are shown in table 2:
TABLE 2 primer sequences for the synthesis of BtISWI Gene dsRNA
Figure BDA0002577287080000041
Figure BDA0002577287080000051
Synthesized by Shanghai Biotechnology service, Inc.
(2) Total RNA extraction and cDNA synthesis: total RNA extraction as in example 1; the cDNA was synthesized by reverse transcription according to the instructions of the reverse transcription kit from Transgen.
(3) And (3) carrying out PCR amplification and product purification on the T7 primer, wherein the purified PCR product is the template for synthesizing dsRNA.
2. Synthesis and purification of dsRNA
Use of
Figure BDA0002577287080000052
The RNAi Kit synthesizes and purifies dsRNA according to the Kit instruction.
3. dsRNA feeding and temperature preference test
The Parafilm membrane was previously treated with DEPC water to remove RNase. dsRNA is added into sucrose solution with the concentration of 10 percent, and the concentration is 0.3 to 0.5 mu g/mu L. Feeding insects by adopting a Parafilm nutrient solution method: taking about 200 heads of the primary eclosion bemisia tabaci adults, putting the primary eclosion bemisia tabaci adults into a glass tube with two transparent ends, covering the upper end of the glass tube with a double-layer Parafilm, adding a raised dsRNA solution between the two films, covering the lower end of the glass tube with gauze, and keeping ventilation. Wrapping the periphery and the lower end of the glass tube with black plastic to enable bemisia tabaci to gather to a parafilm at the top end to obtain a better dsRNA solution for eating, putting the device into an artificial climate box, feeding a solution of 3h BtISWI gene at the temperature of 26 +/-0.5 ℃ under 24h illumination with the relative humidity of 60-70%, collecting the bemisia tabaci, and then putting the bemisia tabaci into a temperature preference tester with the temperature gradient set to be within the temperature range of 12-30 ℃ for temperature preference test. Bemisia tabaci fed dseGFP and sterilized 10% sucrose solution was used as a positive control, and bemisia tabaci not containing dsRNA and sterilized 10% sucrose solution was used as a negative control, and bemisia tabaci not subjected to any treatment was used as a control, each group was repeated for 5 replicates, each for 200 adults.
The results of statistical analysis of the hidden seed temperature preference characteristics of bemisia tabaci MEAM1 after feeding different solutions are shown in fig. 1, and the temperatures preferred by the adult bemisia tabaci MEAM1 hidden seeds fed with BtISWI gene dsRNA are 15.7 ℃ and 17.3 ℃, while the most preferred temperatures of the bemisia tabaci fed with dseGFP and 10% sucrose, and without any treatment are 13.8 ℃. The feeding target sequence has a sequence peculiar to the BtISWI gene, so that the interference effect is ensured to be generated by the BtISWI gene with the aim of the hidden species of the Bemisia tabaci MEAM1, and therefore, the BtISWI gene plays a key role in the hidden species temperature preference of the Bemisia tabaci MEAM 1. The invention lays a foundation for further defining the action of the BtISWI gene on the temperature preference of the hidden species of the Bemisia tabaci MEAM1, and provides a basis for further researching the temperature adaptation mechanism of the hidden species of the Bemisia tabaci MEAM1 and a method for controlling the harm of the Bemisia tabaci through the temperature preference in the future.
Sequence listing
<110> institute of plant protection of Chinese academy of agricultural sciences
<120> BtISWI gene and application thereof in regulating and controlling cryptogenic temperature preference of bemisia tabaci MEAM1
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 3712
<212> DNA
<213> Bemisia tabaci (Bemis tabaci Gennadius)
<400> 1
ggtttttcct tccgcatgag agacctttct tctcttgtgt ttacaagtca cagtgatttt 60
attgtgaatt tctcaacact tacgtttttt ctgaagtgcg ttaccttata attttatatc 120
aaagactaat ttttaattac ctgacgaaac atcatccatt tttattgtag tgttgtaatc 180
catcggaact tatccggtat ttttgagtgc gtgcaaggta tcttttgtca aaatggttaa 240
aacggggtct gaaaaccggt cagacgacgg ttccgatggt gaagaattgt cgaacgaatc 300
atcctctatg gaagctccgc ccgctccgaa aagtcttaaa gcagaattcg ataaacctgg 360
agttgaccag agtaagcgct ttgaattctt actaaaacag accgaaattt tctctcactt 420
catgacgaac agcaacaagg ataaaacttc cccaacaacc actggaaaac ctaaaggtag 480
gcctcggaaa gaacaaccca aatcctccga ttcaccctct aaagattctg ctgatcatcg 540
tcaccggaaa acagagcaag aggaagatga agaactactg gctgagagta acgcagccac 600
aaagaccata accatgtttg actcctcacc attctacatt aaaaatggtg aattacgaga 660
ttaccaagtt cgtggtctaa actggatgat ttctctcttt gaaaacggca ttaacggtat 720
tcttgccgat gagatgggtc taggtaaaac ccttcaaacc atctcgctac ttggttacat 780
gaagaacttc cgcaacatct ctggccctca tatggtcatt gtccctaagt caaccttgat 840
gaactggatg aatgaattca aaaagtggtg tccctcgctg aaagcagttt gtttaattgg 900
agaccaagaa gctcgtaata atttcatcag agacgtttta atgcctggag actgggacgt 960
ttgtgtaact tcttatgaaa tgatcattcg agagaaaagc accttgaaga aatttaattg 1020
gcgttacatg gtcattgacg aagctcaccg tattaaaaac gagaaatcca agttatcaga 1080
aattgttcga gaattcaaga caaccaacag attgctgcta actggaactc cattacaaaa 1140
caaccttcat gagttatggt ctctgttgaa tttcttgcta cctgatgtct ttaattcatc 1200
agatgatttt gatgcatggt tcaatacgaa tacttgtctt ggtgacaatg cacttgttga 1260
aagattgcat gcagttttaa gacctttctt gttgcgtcgt ctcaagtctg aagtggaaaa 1320
gcgattgaaa cccaaaaaag aattaaaggt gtatgttggc ttaagtaaaa tgcaaagaga 1380
gtggtatact aaagtcctga tgaaagatat tgacattgtg aatggtgctg gaaaaattga 1440
gaaaatgcgg cttcaaaaca tcctgatgca actgcgaaag tgctgtaacc acccgtatct 1500
ttttgatggc gctgaacctg gtccaccata tacaacagat gagcacttgg tatttaactg 1560
tggcaaaatg gtcattcttg ataagctgct gccgaaatta caagaacaag actcaagggt 1620
gctaattttt agtcaaatga cgcgtatgat tgacatcctt gaagatttct gccactggcg 1680
tggatacaag tattgcaggt tagatggtca aactccccat gaagatcgac agcggcagat 1740
caatgaattt aatgccccaa acagcgacaa attcattttc atgttgtcaa ctcgcgctgg 1800
tggtcttggt atcaacttgg caactgcaga tgtagttatc atttatgatt ctgactggaa 1860
tcctcaaatg gacttgcagg ccatggaccg agctcatcgt ataggtcaga aaaaacaagt 1920
gcgagttttc cgactaatca ccgaaaatac cgttgaggaa aaaattgttg aaagagcaga 1980
agtgaaatta cgtctggaca agctggtcat tcaacaaggt cgcttagtcg acaacaaggc 2040
tgctctccaa aaagacgaaa tgcttaacat gattcggcat ggtgccaatc atgtctttgc 2100
ttcaaaagac tcagaaatta cagatgaaga tattgataca attcttgaga aaggtgaggc 2160
taagactgaa gagatgaagc aaaagctaga aacgctcggg gaatcctctc ttcgaaattt 2220
cactctcgat gctcccactg aatctgttta tcagtttgaa ggggaagact accgtgaaaa 2280
gcaaaaactc accgggattg gaaattggat tgagcctcct aagagagaga ggaaagcaaa 2340
ctatgctgtc gatgcatatt tccgtgaagc gctccgagtt tcagaaccga aagcaccaaa 2400
agctccaaga cctccaaaac aaccaattgt ccaagatttc cagttctttc caatgcgtct 2460
atttgagctg ttagatcaag aaatctacta tttccgcaag tcagtgggct accgggtacc 2520
caagaaccct gagttgggtg tagatgcaaa caaaatacag aaagaagagc agaagaagat 2580
cgacgaggca caaccactga ctgaagaaga actattggaa aaagaagatc ttctgacgca 2640
aggatttacc aactggacga agcgtgattt caaccaattc ataaaagcta atgaaaaatt 2700
tggtagagac gatattcaca acatttgcaa ggaagtcgaa ggcaaaaccc ccgaagaagt 2760
tatagagtat agcagtgtat tttgggaacg ctgtcaggaa ttacaagata ttgaacgaat 2820
aatggctcaa atagaacgtg gtgaagcaaa aatccaacgc cgtgccagta taaagcgagc 2880
cttagatgct aaaatggaga ggtatcaagc gccattccac cagctgagaa tatcctacgg 2940
cacaaacaaa ggcaaaaact acaccgaaga agaagatcgg tttttggttt gtatgttgca 3000
tcgacttgga ttcgacaagg agaatgtgta tgaagaactc cgatctgcaa caaggtttgc 3060
ccctcagttc cgctttgact ggttcatcaa gagcagaact gcgatggaat tgcagcgacg 3120
atgtaacaca ttaatcacac tcattgagcg agaaaatcaa gaactagagg agaaagagaa 3180
agcagctgac aaaacaaaga acaagcgagg gcctcgtgct ggccaaggca aacggaaaag 3240
cgaagctaac gctgtggccg attcgaaacc aacctcagct aaaaagaaga aaaagaacta 3300
aaaatcctcg agtcaggtgt ttcttctcaa tttctcggtg tacagtcctg aacttgaaaa 3360
ttttgagctg ttttaatttt gtccagacag aaatttcagt ttgtataaag cacactattt 3420
gctttaaata agaatcctcc tcctttcatc ttaatttctg ataaacttat gaatttgtaa 3480
atagtcattt gatatctcta aagaaacaac taagtaaagt gaggataata ttctcagctg 3540
catatttcat gtgagaaaaa gggcataact gagaatatat ctgatagact catcttggca 3600
tcaatggtat gccctcctta cattgatgaa tcagtttcta tcaaggtggc caatcaaaat 3660
gattcggtct ctttttcctg tacctgtgat tacttagaat gtaggtattt aa 3712
<210> 2
<211> 1022
<212> PRT
<213> Bemisia tabaci (Bemis tabaci Gennadius)
<400> 2
Met Val Lys Thr Gly Ser Glu Asn Arg Ser Asp Asp Gly Ser Asp Gly
1 5 10 15
Glu Glu Leu Ser Asn Glu Ser Ser Ser Met Glu Ala Pro Pro Ala Pro
20 25 30
Lys Ser Leu Lys Ala Glu Phe Asp Lys Pro Gly Val Asp Gln Ser Lys
35 40 45
Arg Phe Glu Phe Leu Leu Lys Gln Thr Glu Ile Phe Ser His Phe Met
50 55 60
Thr Asn Ser Asn Lys Asp Lys Thr Ser Pro Thr Thr Thr Gly Lys Pro
65 70 75 80
Lys Gly Arg Pro Arg Lys Glu Gln Pro Lys Ser Ser Asp Ser Pro Ser
85 90 95
Lys Asp Ser Ala Asp His Arg His Arg Lys Thr Glu Gln Glu Glu Asp
100 105 110
Glu Glu Leu Leu Ala Glu Ser Asn Ala Ala Thr Lys Thr Ile Thr Met
115 120 125
Phe Asp Ser Ser Pro Phe Tyr Ile Lys Asn Gly Glu Leu Arg Asp Tyr
130 135 140
Gln Val Arg Gly Leu Asn Trp Met Ile Ser Leu Phe Glu Asn Gly Ile
145 150 155 160
Asn Gly Ile Leu Ala Asp Glu Met Gly Leu Gly Lys Thr Leu Gln Thr
165 170 175
Ile Ser Leu Leu Gly Tyr Met Lys Asn Phe Arg Asn Ile Ser Gly Pro
180 185 190
His Met Val Ile Val Pro Lys Ser Thr Leu Met Asn Trp Met Asn Glu
195 200 205
Phe Lys Lys Trp Cys Pro Ser Leu Lys Ala Val Cys Leu Ile Gly Asp
210 215 220
Gln Glu Ala Arg Asn Asn Phe Ile Arg Asp Val Leu Met Pro Gly Asp
225 230 235 240
Trp Asp Val Cys Val Thr Ser Tyr Glu Met Ile Ile Arg Glu Lys Ser
245 250 255
Thr Leu Lys Lys Phe Asn Trp Arg Tyr Met Val Ile Asp Glu Ala His
260 265 270
Arg Ile Lys Asn Glu Lys Ser Lys Leu Ser Glu Ile Val Arg Glu Phe
275 280 285
Lys Thr Thr Asn Arg Leu Leu Leu Thr Gly Thr Pro Leu Gln Asn Asn
290 295 300
Leu His Glu Leu Trp Ser Leu Leu Asn Phe Leu Leu Pro Asp Val Phe
305 310 315 320
Asn Ser Ser Asp Asp Phe Asp Ala Trp Phe Asn Thr Asn Thr Cys Leu
325 330 335
Gly Asp Asn Ala Leu Val Glu Arg Leu His Ala Val Leu Arg Pro Phe
340 345 350
Leu Leu Arg Arg Leu Lys Ser Glu Val Glu Lys Arg Leu Lys Pro Lys
355 360 365
Lys Glu Leu Lys Val Tyr Val Gly Leu Ser Lys Met Gln Arg Glu Trp
370 375 380
Tyr Thr Lys Val Leu Met Lys Asp Ile Asp Ile Val Asn Gly Ala Gly
385 390 395 400
Lys Ile Glu Lys Met Arg Leu Gln Asn Ile Leu Met Gln Leu Arg Lys
405 410 415
Cys Cys Asn His Pro Tyr Leu Phe Asp Gly Ala Glu Pro Gly Pro Pro
420 425 430
Tyr Thr Thr Asp Glu His Leu Val Phe Asn Cys Gly Lys Met Val Ile
435 440 445
Leu Asp Lys Leu Leu Pro Lys Leu Gln Glu Gln Asp Ser Arg Val Leu
450 455 460
Ile Phe Ser Gln Met Thr Arg Met Ile Asp Ile Leu Glu Asp Phe Cys
465 470 475 480
His Trp Arg Gly Tyr Lys Tyr Cys Arg Leu Asp Gly Gln Thr Pro His
485 490 495
Glu Asp Arg Gln Arg Gln Ile Asn Glu Phe Asn Ala Pro Asn Ser Asp
500 505 510
Lys Phe Ile Phe Met Leu Ser Thr Arg Ala Gly Gly Leu Gly Ile Asn
515 520 525
Leu Ala Thr Ala Asp Val Val Ile Ile Tyr Asp Ser Asp Trp Asn Pro
530 535 540
Gln Met Asp Leu Gln Ala Met Asp Arg Ala His Arg Ile Gly Gln Lys
545 550 555 560
Lys Gln Val Arg Val Phe Arg Leu Ile Thr Glu Asn Thr Val Glu Glu
565 570 575
Lys Ile Val Glu Arg Ala Glu Val Lys Leu Arg Leu Asp Lys Leu Val
580 585 590
Ile Gln Gln Gly Arg Leu Val Asp Asn Lys Ala Ala Leu Gln Lys Asp
595 600 605
Glu Met Leu Asn Met Ile Arg His Gly Ala Asn His Val Phe Ala Ser
610 615 620
Lys Asp Ser Glu Ile Thr Asp Glu Asp Ile Asp Thr Ile Leu Glu Lys
625 630 635 640
Gly Glu Ala Lys Thr Glu Glu Met Lys Gln Lys Leu Glu Thr Leu Gly
645 650 655
Glu Ser Ser Leu Arg Asn Phe Thr Leu Asp Ala Pro Thr Glu Ser Val
660 665 670
Tyr Gln Phe Glu Gly Glu Asp Tyr Arg Glu Lys Gln Lys Leu Thr Gly
675 680 685
Ile Gly Asn Trp Ile Glu Pro Pro Lys Arg Glu Arg Lys Ala Asn Tyr
690 695 700
Ala Val Asp Ala Tyr Phe Arg Glu Ala Leu Arg Val Ser Glu Pro Lys
705 710 715 720
Ala Pro Lys Ala Pro Arg Pro Pro Lys Gln Pro Ile Val Gln Asp Phe
725 730 735
Gln Phe Phe Pro Met Arg Leu Phe Glu Leu Leu Asp Gln Glu Ile Tyr
740 745 750
Tyr Phe Arg Lys Ser Val Gly Tyr Arg Val Pro Lys Asn Pro Glu Leu
755 760 765
Gly Val Asp Ala Asn Lys Ile Gln Lys Glu Glu Gln Lys Lys Ile Asp
770 775 780
Glu Ala Gln Pro Leu Thr Glu Glu Glu Leu Leu Glu Lys Glu Asp Leu
785 790 795 800
Leu Thr Gln Gly Phe Thr Asn Trp Thr Lys Arg Asp Phe Asn Gln Phe
805 810 815
Ile Lys Ala Asn Glu Lys Phe Gly Arg Asp Asp Ile His Asn Ile Cys
820 825 830
Lys Glu Val Glu Gly Lys Thr Pro Glu Glu Val Ile Glu Tyr Ser Ser
835 840 845
Val Phe Trp Glu Arg Cys Gln Glu Leu Gln Asp Ile Glu Arg Ile Met
850 855 860
Ala Gln Ile Glu Arg Gly Glu Ala Lys Ile Gln Arg Arg Ala Ser Ile
865 870 875 880
Lys Arg Ala Leu Asp Ala Lys Met Glu Arg Tyr Gln Ala Pro Phe His
885 890 895
Gln Leu Arg Ile Ser Tyr Gly Thr Asn Lys Gly Lys Asn Tyr Thr Glu
900 905 910
Glu Glu Asp Arg Phe Leu Val Cys Met Leu His Arg Leu Gly Phe Asp
915 920 925
Lys Glu Asn Val Tyr Glu Glu Leu Arg Ser Ala Thr Arg Phe Ala Pro
930 935 940
Gln Phe Arg Phe Asp Trp Phe Ile Lys Ser Arg Thr Ala Met Glu Leu
945 950 955 960
Gln Arg Arg Cys Asn Thr Leu Ile Thr Leu Ile Glu Arg Glu Asn Gln
965 970 975
Glu Leu Glu Glu Lys Glu Lys Ala Ala Asp Lys Thr Lys Asn Lys Arg
980 985 990
Gly Pro Arg Ala Gly Gln Gly Lys Arg Lys Ser Glu Ala Asn Ala Val
995 1000 1005
Ala Asp Ser Lys Pro Thr Ser Ala Lys Lys Lys Lys Lys Asn
1010 1015 1020

Claims (1)

1. A method for increasing the preference temperature of the invisible species of Bemisia tabaci MEAM1 is characterized by comprising the step of feeding the invisible species of Bemisia tabaci MEAM1 with a dsRNA sequence of the invisible species of the Bemisia tabaci MEAM1 chromatin remodeling factor gene BtISWI, wherein the nucleotide sequence of the invisible species of the Bemisia tabaci MEAM1 chromatin remodeling factor gene BtISWI is shown in SEQ ID No.1, and the dsRNA sequence is obtained by amplifying the following primers,
ISWI-DF：5’TAATACGACTCACTATAGGGCTCCGATTCACCCTCT3’,
ISWI-DR:5’ TAATACGACTCACTATAGGGGTCCCAGTCTCCAGGC3’。
CN202010657535.1A 2020-01-09 2020-07-09 BtISWI gene and application thereof in regulating and controlling cryptogenic temperature preference of bemisia tabaci MEAM1 Active CN111848768B (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202010021143 2020-01-09
CN2020100211436 2020-01-09

Publications (2)

Publication Number Publication Date
CN111848768A CN111848768A (en) 2020-10-30
CN111848768B true CN111848768B (en) 2022-03-25

Family

ID=73152215

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010657535.1A Active CN111848768B (en) 2020-01-09 2020-07-09 BtISWI gene and application thereof in regulating and controlling cryptogenic temperature preference of bemisia tabaci MEAM1

Country Status (1)

Country Link
CN (1) CN111848768B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111763253B (en) * 2020-07-29 2022-03-25 中国农业科学院植物保护研究所 Chromatin remodeling factor ISWI, coding gene and role in diaphorina tabaci MED cryptic temperature tolerance

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103898122A (en) * 2014-04-16 2014-07-02 中国农业科学院植物保护研究所 Transient receptor potential ion channel gene MEAM1 BtTrap of bemisia tabaci MEAM1 (Middle East Asia Minor1) cryptic species and application thereof
CN108588082A (en) * 2017-05-27 2018-09-28 中国农业科学院植物保护研究所 Hidden kind of high temperature tolerance related gene B tDnmt3 of Bemisia tabaci MED and its application

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103898122A (en) * 2014-04-16 2014-07-02 中国农业科学院植物保护研究所 Transient receptor potential ion channel gene MEAM1 BtTrap of bemisia tabaci MEAM1 (Middle East Asia Minor1) cryptic species and application thereof
CN108588082A (en) * 2017-05-27 2018-09-28 中国农业科学院植物保护研究所 Hidden kind of high temperature tolerance related gene B tDnmt3 of Bemisia tabaci MED and its application

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
NCBI Reference Sequence: XP_018899510.1;NCBI;《NCBI》;20161109;第1-2页 *

Also Published As

Publication number Publication date
CN111848768A (en) 2020-10-30

Similar Documents

Publication Publication Date Title
CN101456909B (en) Soja bean HKT protein and coding gene thereof and application
CN109797157B (en) Abiotic stress resistant transcription factor PbrbHLH92, primer thereof, encoded protein and application
CN109232725B (en) Soybean C2H2 type single zinc finger protein transcription factor, coding gene and application
CN101775398A (en) Stress tolerance genetic engineering application of NAC protein gene DlNAC of chrysanthemum
CN114957426A (en) SP6RARS and application thereof in preventing and controlling blattaria insects
CN111848768B (en) BtISWI gene and application thereof in regulating and controlling cryptogenic temperature preference of bemisia tabaci MEAM1
CN109666675B (en) Nilaparvata lugens NlAtg3 gene, encoding protein and application thereof
CN111763253B (en) Chromatin remodeling factor ISWI, coding gene and role in diaphorina tabaci MED cryptic temperature tolerance
CN105838726B (en) A kind of Salt Tolerance Gene in Alfalfa gene M sCDPK and its coding albumen and application
CN108588082B (en) Bemisia tabaci MED cryptomorphic high-temperature tolerance related gene BtDnmt3 and application thereof
CN104593391A (en) Brown planthopper survival and growth development-associated NlPIK3R1 gene, and coded protein and application thereof
CN111763252B (en) Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm2 and coding gene and application thereof
CN111925429B (en) Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm1 and coding gene application thereof
CN109439670A (en) A kind of preparation method of the gene for improved seed size and quality and application
CN101338315B (en) Gene for enhancing draught-resistance of plant and its uses
Zhang et al. Characterization of a wheat C2 domain protein encoding gene regulated by stripe rust and abiotic stresses
CN108823220B (en) Cloning and application of waxy synthesis related gene MdCER1 in apple
CN110452290B (en) Elicitor protein from Scopulariopsis fungus and application of coding gene thereof in biocontrol of vegetables
CN107988244B (en) ATPSb gene related to survival of brown planthopper, encoded protein and application thereof
CN112266919B (en) Rice source insect-resistant related gene OsIDP1 and encoding product and application thereof
CN101514344A (en) Flavone synthetase gene and polypeptide encoded thereby
CN111909911B (en) Bemisia tabaci MED cryptohistone acetyltransferase gene gcn5, application thereof and method for reducing temperature tolerance of Bemisia tabaci
CN111499708B (en) Application of grape VabHLH036 gene in improving cold resistance of plants
CN111534539B (en) SiMYB4 protein related to plant stress resistance and related biological material and application thereof
CN113481210A (en) Application of cotton GhDof1.7 gene in promotion of salt tolerance of plants

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant