CN111909911B - Bemisia tabaci MED cryptohistone acetyltransferase gene gcn5, application thereof and method for reducing temperature tolerance of Bemisia tabaci - Google Patents

Bemisia tabaci MED cryptohistone acetyltransferase gene gcn5, application thereof and method for reducing temperature tolerance of Bemisia tabaci Download PDF

Info

Publication number
CN111909911B
CN111909911B CN202010823476.0A CN202010823476A CN111909911B CN 111909911 B CN111909911 B CN 111909911B CN 202010823476 A CN202010823476 A CN 202010823476A CN 111909911 B CN111909911 B CN 111909911B
Authority
CN
China
Prior art keywords
bemisia tabaci
med
leu
lys
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010823476.0A
Other languages
Chinese (zh)
Other versions
CN111909911A (en
Inventor
吕志创
梁林
冀顺霞
王晓迪
申晓娜
刘万学
万方浩
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Original Assignee
Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Plant Protection of Chinese Academy of Agricultural Sciences filed Critical Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Priority to CN202010823476.0A priority Critical patent/CN111909911B/en
Publication of CN111909911A publication Critical patent/CN111909911A/en
Application granted granted Critical
Publication of CN111909911B publication Critical patent/CN111909911B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N57/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
    • A01N57/10—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds
    • A01N57/16—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds containing heterocyclic radicals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12Y203/01048—Histone acetyltransferase (2.3.1.48)

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Environmental Sciences (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Dentistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Pest Control & Pesticides (AREA)
  • Agronomy & Crop Science (AREA)
  • Saccharide Compounds (AREA)

Abstract

The invention relates to the technical field of agricultural biology, in particular to a bemisia tabaci MED cryptic acetyltransferase gene gcn5, application thereof and a method for reducing temperature tolerance of bemisia tabaci. The nucleotide sequence of the gene is shown as SEQ ID No: 1 is shown. RNAi is carried out on the cryptophyte of the bemisia tabaci MED, and the result shows that the high-temperature knockdown and low-temperature recovery time of the cryptophyte MED imago fed with dsBtgcn5 are remarkably changed, which shows that the Btgcn5 gene plays a key role in the temperature tolerance of the cryptophyte of the bemisia tabaci MED. The bemisia tabaci MED cryptohistone acetylation gene gcn5 can be used for destroying temperature tolerance of bemisia tabaci, and further provides a theoretical basis for prevention and treatment of the bemisia tabaci.

Description

Bemisia tabaci MED cryptohistone acetyltransferase gene gcn5, application thereof and method for reducing temperature tolerance of Bemisia tabaci
Technical Field
The invention relates to the technical field of agricultural biology, in particular to a bemisia tabaci MED cryptic acetyltransferase gene gcn5, application thereof and a method for reducing temperature tolerance of bemisia tabaci.
Background
Bemisia tabaci is a piercing-sucking type major invasive pest in the world, and is a rapidly evolved complex species composed of at least 36 morphologically indistinguishable cryptic species. Mediterranan (med) cryptophyte is the most harmful cryptophyte, which can survive in the southwest united states and in arid desert areas of Xinjiang (day temperature up to more than 50 ℃); after the exposure for 1h at the temperature of-10 ℃, the survival rate can still reach 50 percent. In addition, the survival rate of the bemisia tabaci is remarkably improved within two generations by carrying out heat shock treatment on the bemisia tabaci. A great deal of evidence shows that the strong adaptive capacity of rapidly responding to the external environment temperature is one of the key reasons for the rapid expansion of the hidden seeds of the MED and the outbreak and disaster. The mechanism of response of organisms to environmental variations within this short period of time is epigenetic related. Therefore, the research of strengthening the hidden seed temperature tolerance of MED from the aspect of epigenetics has important significance for revealing the diffusion disaster mechanism and further exploring an innovative control technology.
Epigenetic refers to the rapid and persistent effect on gene expression without altering the DNA sequence in response to environmental changes, and the phenotypic variation caused by epigenetic changes is a reversible change which mediates the rapid and plastic response of the organism to environmental disturbances and can improve the ability of the organism to adapt to environmental stress. Epigenetic regulation includes chromatin remodeling, histone modification, DNA methylation, non-coding RNA regulation, and the like. The extensive distribution of histone acetylation in eukaryotes is an important link in the process of gene expression regulation, and histone acetylation is generally considered to regulate gene transcription through the modification effect on chromatin and transcription related factors, and is closely related to the processes of gene expression regulation, genome stability maintenance and the like. Normally, histone acetylation leaves chromatin in a looser state, and genes on the chromatin are expressed, thereby activating transcription; whereas histone deacetylation makes chromatin structure compact and genes non-expressible, thereby inhibiting transcription. Histone modification plays a key role in expression regulation of genes related to biological defense, and histone acetylation gene gcn5 participates in regulation of environmental stress to biological adversity and plays an important role in regulation of expression of genes related to abiotic stress.
RNA interference (RNAi) is widely existed in biology, some genes in the insect body are silenced by RNAi technology, so that some abilities of the insect are enhanced or lost, and the functional gene expression can be inhibited at a certain time, so that the development of the insect stays at a certain stage, and the purpose of utilizing or preventing the damage of the insect is achieved. The RNAi is commonly introduced by soaking, feeding, electroporation, injection, viral infection, stem cell transplantation, transgenosis, etc. In insects, target dsRNA enters a body mainly through feeding, dipping or microinjection, and after double-stranded RNA (dsRNA) with homologous complementary sequences with transcription product mRNA of a target gene is introduced into cells, the mRNA can be specifically degraded, so that corresponding functional phenotype deletion is generated. Because the injection method is limited by complicated operation, time consumption and the like, the dsRNA feeding method which is simple, convenient and easy to operate is widely applied to the research of tiny insects such as bemisia tabaci.
Disclosure of Invention
The invention aims to provide bemisia tabaci MED cryptohistone acetyltransferase.
Still another object of the present invention is to provide a bemisia tabaci MED cryptic acetyltransferase gene.
Still another object of the present invention is to provide a recombinant vector comprising the above-mentioned bemisia tabaci MED cryptic acetyltransferase gene.
Still another object of the present invention is to provide a recombinant cell comprising the above-described bemisia tabaci MED cryptic acetyltransferase gene.
It is a further object of the present invention to provide a method of disrupting the temperature tolerance of the bemisia tabaci MED cryptic species.
According to the specific embodiment of the invention, the aleyrodids tobacco whitefly MED cryptic acetyltransferase gene gcn5 is cloned for the first time, and the full-length nucleotide sequence of the cDNA is shown as SEQ ID No: 1, and the following components:
ATGGCCTCCTCAGCAAACGACTGCAGCAAAGCCAGCACAAGTGCCAATAAAAATCCTGCACCTGTGGACTCAACAAATGTAGCAACAAATGCATCTGCTGCACCATCGCCGTCACCTAGGCAAAATAATCTTCAACGAATTCAGCAACGAAAACAGCAAGTCTACAACTGGCAGTCAGCTAAGAAGATATTAAAACTAGCCATTTATTCAGCGTGTCAGTCAGATGGCTGCAAGTGCACAGGTTGGAAAGCGCCATTGTCACCGAACAAATCACCAAGAGTGGATGTCGCCACTCAGTTAGCTAATTTTCCGGACCCATGTCGAAATTGCACACATATCCTAGGAAATCATGTATCCCATTTGAAGACCTTGCCGGAGGAAGAAATAAACAGACTACTAGGGATGGTTGTAGATGTAGAAAATATTTTCATGTCAATGCACACGGAACAAGATGCGGACACCAAAAAAGTTTACTATTTTCTTTTTGATCTCCTTCGACAATCAATTGTGAACCTAAGGAAACCTAAAGTTGAAGGGCCCCTGGGTCATCCACCTTTCGAACAGCCCAGCATAGCCAAAGCAATTCTCAATTTCGTGTATTATAAATTTGCTGATAAACCTCAAGTGGAGTGGCAAATGATGCATGATTTAGCGAAAATGTTTTTACACTGTTTGAATCATTGGAATTTTGAAACACCCTCAACCAAAAAAGCAGATGCTTCAACAGAGGAAGATGCATCAGAAATGACTGCATATACAACAAACTACACGAGGTGGCTGATATTTTGTCAAGTTCCAGCTTTTTGTGACTCACTTCCACATTTTGAAACTGCTCTTGTGTTCGGGCGGACGTTACTTTGTGCTGTGTTCAGGACAGTTCGGAGACAGCTTATGGAAAGGTGCCGAAGTGATCGGGATAAAATGCCACCAGAAAAGAGAGATCTTGTTCTTACGCATTTCCCCAAGTTTTTAGCACTTGTAGAAGAAGAAATTTATTCAGATTCGTCTCCCATTTGGGATCCTGAATATCGACCTGCTCCACCTCGCCACCTACAGTCCTCAGAAAAAGGTGTCCGCCGTCCAGGTGAATTTGAGAAACTGACAGCTCCTACTAATGAAAAAAATAATTTTTCAACGGTTAACATCAGCTTAGGGATGGGGAAGAAGTTGAAATTAGACCCTTCCTTAGCTGATGATTCTCAAAAAGAGACTAGTGAATCAAAAAATCGCTCTGATCGAGTGAGTGGAGCTGACAGCAAAAGTCGGAAGTCGGATCCACTATGTGGCCCTGAAATAATAGGGGATCCAACAGAGGAGGAAGTTGTTGAAATCAATGCCAAAATCAACAATCTGAAACAGAACTGCGGCCTAGAGGCTGTTTTTGCTGACAATGGTCCCAGAGATGAGCTACCCAAAATAGAAGAAGCAAGAGGAATGATCGAACTTCAGTTAGTTGGTAATAGTTTATCACAGCCAGTTAGTCAAGACACTATGATGTGGCTGATAGGTCTTCAAAATCTGTTCTCTTACCAATTACCAAAGATGCCAAAACATTACATCACTAGGCTGGTTTTCGATCCGAAACAAAAAACACTAGCTTTGATAAAGCATGGTAGACCAATCGGTGGAATTTGTTTCCGCATGTTTCCAGAACAAGGATTTTCAGAAATAGTTTTCTGTGCTGTCAGCTCAAATGAGCAAGTGAAAGGATATGGTACTCATCTGATGAATCATCTTAAAGATTACCACATCCAGATAAATATTCACCACTTTTTAACTTTTGCTGATGCTTATGCCATAGGTTACTTCAAGAAACAGGGGTTCAGTAAGGATATTAAGCTGAATCGAGCCGTCTACCAAGATTTAATAAAGGATTATGATGGTGCAACGCTCATGCACTGTCAGTTGAATCCAAAGATTGTTTACACTGAATTTACCAGTGTTATTCGCAAACAGCGTGAGATCATCAAGTATATAATTGAATCAAGAAATTCACAAGCTCAACAGGTCTATCCAGGGTTGACTTGTTTCAAAGAAGGCGTTCGTCCAATTCCTGTTGAGTCAATCCCTGGTATCCAAGAAACTGGTTGGCGGCCTGCTGCGCGCATGACTCGAGTGAACAGGATGACGGAAGAATGTTCTGACCCAGATACATTAGCAAAGAATTTCAGTATTATTCTCAATACTATAAAAAATCATGATTTTGCTTGGCCTTTCTTGGAGCCTGTTAAGACTGAAATTGCTGCCGATTATTATGACCACATAAAATATCCAATGGATTTGGGCACAATGACTAAACGGCTGAAAGCTGGATACTATGTCACACGAAGATTATTCATAGCTGATATGACCCGTATATTTTCTAATTGCCGGCAATATAACAAGCCTGACACACAGTATTATACTTGGGGTAACACGCTAGAAAAATATTTTCAAACTAAAATGAAAGAAATGGGTCTGTGGGACAAATGA
the amino acid sequence of the bemisia tabaci MED cryptic acetyltransferase gene gcn5 is shown as SEQ ID NO: 2, or a pharmaceutically acceptable salt thereof.
MASSANDCSKASTSANKNPAPVDSTNVATNASAAPSPSPRQNNLQRIQQRKQQVYNWQSAKKILKLAIYSACQSDGCKCTGWKAPLSPNKSPRVDVATQLANFPDPCRNCTHILGNHVSHLKTLPEEEINRLLGMVVDVENIFMSMHTEQDADTKKVYYFLFDLLRQSIVNLRKPKVEGPLGHPPFEQPSIAKAILNFVYYKFADKPQVEWQMMHDLAKMFLHCLNHWNFETPSTKKADASTEEDASEMTAYTTNYTRWLIFCQVPAFCDSLPHFETALVFGRTLLCAVFRTVRRQLMERCRSDRDKMPPEKRDLVLTHFPKFLALVEEEIYSDSSPIWDPEYRPAPPRHLQSSEKGVRRPGEFEKLTAPTNEKNNFSTVNISLGMGKKLKLDPSLADDSQKETSESKNRSDRVSGADSKSRKSDPLCGPEIIGDPTEEEVVEINAKINNLKQNCGLEAVFADNGPRDELPKIEEARGMIELQLVGNSLSQPVSQDTMMWLIGLQNLFSYQLPKMPKHYITRLVFDPKQKTLALIKHGRPIGGICFRMFPEQGFSEIVFCAVSSNEQVKGYGTHLMNHLKDYHIQINIHHFLTFADAYAIGYFKKQGFSKDIKLNRAVYQDLIKDYDGATLMHCQLNPKIVYTEFTSVIRKQREIIKYIIESRNSQAQQVYPGLTCFKEGVRPIPVESIPGIQETGWRPAARMTRVNRMTEECSDPDTLAKNFSIILNTIKNHDFAWPFLEPVKTEIAADYYDHIKYPMDLGTMTKRLKAGYYVTRRLFIADMTRIFSNCRQYNKPDTQYYTWGNTLEKYFQTKMKEMGLWDK*
The invention provides application of the bemisia tabaci MED cryptohistone acetyltransferase gene in preventing and treating bemisia tabaci.
The method for reducing the temperature tolerance of the bemisia tabaci comprises the step of feeding the dsrnas of the bemisia tabaci MED cryptohistone acetyltransferase gene to the bemisia tabaci.
The method for reducing the temperature tolerance of bemisia tabaci is characterized in that the nucleotide sequence shown as SEQ ID No: 3 and SEQ ID No: 4 to obtain the dsRNA
The invention provides application of the bemisia tabaci MED cryptic acetyltransferase gene gcn 5. RNAi is carried out on the cryptophyte of the bemisia tabaci MED, and the result shows that the high-temperature knockdown and low-temperature recovery time of the cryptophyte MED imago fed with dsBtgcn5 are remarkably changed, which shows that the Btgcn5 gene plays a key role in the temperature tolerance of the cryptophyte of the bemisia tabaci MED. The bemisia tabaci MED cryptohistone acetylation gene gcn5 can be used for destroying temperature tolerance of bemisia tabaci, and further provides a theoretical basis for prevention and treatment of the bemisia tabaci.
The histone acetyltransferase gene gcn5 is obtained by cloning from the hidden seeds of bemisia tabaci MED for the first time; the suppression of the expression of the gene directly reduces the temperature tolerance of the hidden MED. The obtained result lays a foundation for further researching the relationship between the temperature tolerance mechanism of the hidden species of the bemisia tabaci MED and the epigenetic histone and provides a basis for a method for controlling the harm of the bemisia tabaci by temperature adaptability in the future.
Drawings
FIG. 1 shows the expression level change of gcn5 under the condition of feeding target genes dsmof, dsEGFP, 10% sucrose solution and CK;
figure 2 shows the effect of dsRNA treatment of Btgcn5 gene on temperature tolerance of bemisia tabaci MED cryptophyte adults: comparing the high-temperature knockdown time and the low-temperature recovery time of the Bemisia tabaci MED cryptophytes adults fed with Btgcn5 gene dsRNA, dsEGFP, 10% sucrose solution and CK.
Detailed Description
Example 1: full-length cDNA sequence clone of Bemisia tabaci MED cryptic Btgcn5 gene
200 heads of the bemisia tabaci adults are taken and put into a centrifugal tube with the volume of 1.5mL, the bemisia tabaci adults are frozen by liquid nitrogen and ground into powder by using a grinding rod, and then RNA is extracted and stored at the temperature of minus 80 ℃ for later use. The extracted RNA was reverse transcribed to synthesize cDNA according to the instructions of the full-scale gold reverse transcription kit (One-Step gDNA Removal and cDNA Synthesis SuperMix). PCR was performed using the primers shown in Table 1 using cDNA as a template.
TABLE 1 PCR primer sequences
Figure BDA0002635317910000041
Figure BDA0002635317910000051
The open reading frame of the obtained Btgcn5 gene sequence is 2472bp long, and the obtained gene has the nucleotide sequence shown in SEQ ID No: 1, and the gene codes 823 nucleotide sequences shown as SEQ ID No: 2, and determining the gene as the aleyrodids tobacco whitefly MED cryptic acetyltransferase gene.
Example 2: analyzing the influence of Btgcn5 gene on the temperature tolerance of the Bemisia tabaci MED cryptophyte
3.1 Synthesis of dsRNA
(1) Primer sequences were designed to synthesize plus the T7 promoter (sequence underlined):
T7+Btgcn5-F：5’-TAATACGACTCACTATAGGGTTGAAACTGCTCTTGTGTTCGGGC-3’(SEQ ID No：3)
T7+Btgcn5-R：5’-TAATACGACTCACTATAGGGGGCCGCAGTTCTGTTTCAGATTGT-3' (SEQ ID No: 4). Synthesized by Shanghai Biotechnology service, Inc.
(2) Total RNA extraction and cDNA synthesis: the same as in example 1.
(3) And (3) carrying out PCR amplification and product purification on the T7 primer, wherein the purified PCR product is the template for synthesizing dsRNA. dsRNA was synthesized and purified using the kit, following the kit instructions.
3.2dsRNA feeding
The Parafilm membrane was previously treated with DEPC water to remove RNase. Adding dsRNA into sucrose solution with the concentration of 10%, wherein the concentration is 0.3-0.5 mu g/mu L. According to the feeding characteristics of the bemisia tabaci, the method for clamping the nutrient solution by the Parafilm membrane is correspondingly improved: taking about 200 heads of the primary eclosion bemisia tabaci adults, putting the initial eclosion bemisia tabaci adults into a glass tube with two transparent ends, covering the upper end of the glass tube with a double-layer Parafilm, adding 200 mu L of 10% sucrose solution between the two films, adding dsRNA to enable the final concentration to be 0.3-0.5 mu g/mu L, covering the lower end of the glass tube with gauze, and keeping ventilation. The periphery and the lower end of the glass tube are wrapped by black plastic, so that the bemisia tabaci can gather to a parafilm at the top end to take dsRNA better, the device is placed into an artificial climate box (the temperature is 26 +/-0.5 ℃, the illumination is carried out for 24 hours, the relative humidity is 60-70 percent), and feeding is carried out for 3 hours. The whitefly fed is divided into two groups, one group is frozen by liquid nitrogen and then stored to detect the silencing efficiency of target genes, and the other group is used for temperature tolerance phenotype observation. The method is specifically used for observing the temperature tolerance phenotype, namely, the bemisia tabaci is collected in a finger-type pipe, a group of bemisia tabaci is placed in a preheated high-temperature water bath for thermal knock down, the time until the bemisia tabaci cannot stand independently is recorded, and the treatment temperature is 45 ℃; the other group is put into a low-temperature water bath kettle for cold knock down and then taken out to record the cold-induced dizziness recovery time, and the treatment temperature is-5 ℃. Control was bemisia tabaci without any treatment (CK), fed with 10% sucrose solution and fed with 10% sucrose mixed solution containing dsEGFP, each treatment was set to 4 biological replicates.
Through 2-ΔΔCTThe relative expression amount of the gene is calculated by the method, and the result is shown in figure 1, and the Btgcn5 fed by the method can obviously reduce the expression of the Btgcn5 gene. SAS 9.4 statistical software is used for analyzing the high-temperature knockdown time and the low-temperature recovery time of the tobacco whitefly MED hidden seeds fed with different solutions, and the results are shown in figure 2, wherein the high-temperature knockdown time of the tobacco whitefly MED hidden seeds fed with Btgcn5 gene dsRNA is obviously lower than that of a CK group, a dsEGFP group and a sucrose group (P is<0.05), the low temperature recovery time was significantly higher than the recovery time (P) for the CK group, the dsEGFP-fed group and the sucrose group<0.05). Meanwhile, NCBI (http:// BLAST. NCBI. nlm. nih. gov. /) BLAST shows that the fed target sequence has a sequence specific to Btgcn5 gene, so that the interference effect generated by the target Btgcn5 gene of the Bemisia tabaci MED cryptic species is ensured, and therefore, the Btgcn5 gene plays a key role in the temperature property of the Bemisia tabaci MED cryptic species.
The invention clones the full-length cDNA of Btgcn5 gene from the hidden seed of bemisia tabaci MED, feeds the target gene dsBtgcn5, and leads to the shortening of the high-temperature knockdown time and the prolonging of the low-temperature recovery time of the hidden seed adult of bemisia tabaci MED. According to the specific implementation mode of the invention, the test result confirms that the Btgcn5 gene plays a key role in the high-temperature and low-temperature resistance of the Bemisia tabaci MED cryptophyte. The method lays a foundation for further researching the relationship between the temperature tolerance mechanism of the hidden species of the bemisia tabaci MED and the histone acetylation of epigenetic inheritance, and provides a basis for a method for controlling the harm of the bemisia tabaci by temperature adaptability in the future.
Sequence listing
<110> institute of plant protection of Chinese academy of agricultural sciences
<120> bemisia tabaci MED cryptohistone acetyltransferase gene gcn5, application thereof and method for reducing temperature tolerance of bemisia tabaci
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2472
<212> DNA
<213> Bemisia tabaci (Bemis tabaci)
<400> 1
atggcctcct cagcaaacga ctgcagcaaa gccagcacaa gtgccaataa aaatcctgca 60
cctgtggact caacaaatgt agcaacaaat gcatctgctg caccatcgcc gtcacctagg 120
caaaataatc ttcaacgaat tcagcaacga aaacagcaag tctacaactg gcagtcagct 180
aagaagatat taaaactagc catttattca gcgtgtcagt cagatggctg caagtgcaca 240
ggttggaaag cgccattgtc accgaacaaa tcaccaagag tggatgtcgc cactcagtta 300
gctaattttc cggacccatg tcgaaattgc acacatatcc taggaaatca tgtatcccat 360
ttgaagacct tgccggagga agaaataaac agactactag ggatggttgt agatgtagaa 420
aatattttca tgtcaatgca cacggaacaa gatgcggaca ccaaaaaagt ttactatttt 480
ctttttgatc tccttcgaca atcaattgtg aacctaagga aacctaaagt tgaagggccc 540
ctgggtcatc cacctttcga acagcccagc atagccaaag caattctcaa tttcgtgtat 600
tataaatttg ctgataaacc tcaagtggag tggcaaatga tgcatgattt agcgaaaatg 660
tttttacact gtttgaatca ttggaatttt gaaacaccct caaccaaaaa agcagatgct 720
tcaacagagg aagatgcatc agaaatgact gcatatacaa caaactacac gaggtggctg 780
atattttgtc aagttccagc tttttgtgac tcacttccac attttgaaac tgctcttgtg 840
ttcgggcgga cgttactttg tgctgtgttc aggacagttc ggagacagct tatggaaagg 900
tgccgaagtg atcgggataa aatgccacca gaaaagagag atcttgttct tacgcatttc 960
cccaagtttt tagcacttgt agaagaagaa atttattcag attcgtctcc catttgggat 1020
cctgaatatc gacctgctcc acctcgccac ctacagtcct cagaaaaagg tgtccgccgt 1080
ccaggtgaat ttgagaaact gacagctcct actaatgaaa aaaataattt ttcaacggtt 1140
aacatcagct tagggatggg gaagaagttg aaattagacc cttccttagc tgatgattct 1200
caaaaagaga ctagtgaatc aaaaaatcgc tctgatcgag tgagtggagc tgacagcaaa 1260
agtcggaagt cggatccact atgtggccct gaaataatag gggatccaac agaggaggaa 1320
gttgttgaaa tcaatgccaa aatcaacaat ctgaaacaga actgcggcct agaggctgtt 1380
tttgctgaca atggtcccag agatgagcta cccaaaatag aagaagcaag aggaatgatc 1440
gaacttcagt tagttggtaa tagtttatca cagccagtta gtcaagacac tatgatgtgg 1500
ctgataggtc ttcaaaatct gttctcttac caattaccaa agatgccaaa acattacatc 1560
actaggctgg ttttcgatcc gaaacaaaaa acactagctt tgataaagca tggtagacca 1620
atcggtggaa tttgtttccg catgtttcca gaacaaggat tttcagaaat agttttctgt 1680
gctgtcagct caaatgagca agtgaaagga tatggtactc atctgatgaa tcatcttaaa 1740
gattaccaca tccagataaa tattcaccac tttttaactt ttgctgatgc ttatgccata 1800
ggttacttca agaaacaggg gttcagtaag gatattaagc tgaatcgagc cgtctaccaa 1860
gatttaataa aggattatga tggtgcaacg ctcatgcact gtcagttgaa tccaaagatt 1920
gtttacactg aatttaccag tgttattcgc aaacagcgtg agatcatcaa gtatataatt 1980
gaatcaagaa attcacaagc tcaacaggtc tatccagggt tgacttgttt caaagaaggc 2040
gttcgtccaa ttcctgttga gtcaatccct ggtatccaag aaactggttg gcggcctgct 2100
gcgcgcatga ctcgagtgaa caggatgacg gaagaatgtt ctgacccaga tacattagca 2160
aagaatttca gtattattct caatactata aaaaatcatg attttgcttg gcctttcttg 2220
gagcctgtta agactgaaat tgctgccgat tattatgacc acataaaata tccaatggat 2280
ttgggcacaa tgactaaacg gctgaaagct ggatactatg tcacacgaag attattcata 2340
gctgatatga cccgtatatt ttctaattgc cggcaatata acaagcctga cacacagtat 2400
tatacttggg gtaacacgct agaaaaatat tttcaaacta aaatgaaaga aatgggtctg 2460
tgggacaaat ga 2472
<210> 2
<211> 823
<212> PRT
<213> Bemisia tabaci (Bemis tabaci)
<400> 2
Met Ala Ser Ser Ala Asn Asp Cys Ser Lys Ala Ser Thr Ser Ala Asn
1 5 10 15
Lys Asn Pro Ala Pro Val Asp Ser Thr Asn Val Ala Thr Asn Ala Ser
20 25 30
Ala Ala Pro Ser Pro Ser Pro Arg Gln Asn Asn Leu Gln Arg Ile Gln
35 40 45
Gln Arg Lys Gln Gln Val Tyr Asn Trp Gln Ser Ala Lys Lys Ile Leu
50 55 60
Lys Leu Ala Ile Tyr Ser Ala Cys Gln Ser Asp Gly Cys Lys Cys Thr
65 70 75 80
Gly Trp Lys Ala Pro Leu Ser Pro Asn Lys Ser Pro Arg Val Asp Val
85 90 95
Ala Thr Gln Leu Ala Asn Phe Pro Asp Pro Cys Arg Asn Cys Thr His
100 105 110
Ile Leu Gly Asn His Val Ser His Leu Lys Thr Leu Pro Glu Glu Glu
115 120 125
Ile Asn Arg Leu Leu Gly Met Val Val Asp Val Glu Asn Ile Phe Met
130 135 140
Ser Met His Thr Glu Gln Asp Ala Asp Thr Lys Lys Val Tyr Tyr Phe
145 150 155 160
Leu Phe Asp Leu Leu Arg Gln Ser Ile Val Asn Leu Arg Lys Pro Lys
165 170 175
Val Glu Gly Pro Leu Gly His Pro Pro Phe Glu Gln Pro Ser Ile Ala
180 185 190
Lys Ala Ile Leu Asn Phe Val Tyr Tyr Lys Phe Ala Asp Lys Pro Gln
195 200 205
Val Glu Trp Gln Met Met His Asp Leu Ala Lys Met Phe Leu His Cys
210 215 220
Leu Asn His Trp Asn Phe Glu Thr Pro Ser Thr Lys Lys Ala Asp Ala
225 230 235 240
Ser Thr Glu Glu Asp Ala Ser Glu Met Thr Ala Tyr Thr Thr Asn Tyr
245 250 255
Thr Arg Trp Leu Ile Phe Cys Gln Val Pro Ala Phe Cys Asp Ser Leu
260 265 270
Pro His Phe Glu Thr Ala Leu Val Phe Gly Arg Thr Leu Leu Cys Ala
275 280 285
Val Phe Arg Thr Val Arg Arg Gln Leu Met Glu Arg Cys Arg Ser Asp
290 295 300
Arg Asp Lys Met Pro Pro Glu Lys Arg Asp Leu Val Leu Thr His Phe
305 310 315 320
Pro Lys Phe Leu Ala Leu Val Glu Glu Glu Ile Tyr Ser Asp Ser Ser
325 330 335
Pro Ile Trp Asp Pro Glu Tyr Arg Pro Ala Pro Pro Arg His Leu Gln
340 345 350
Ser Ser Glu Lys Gly Val Arg Arg Pro Gly Glu Phe Glu Lys Leu Thr
355 360 365
Ala Pro Thr Asn Glu Lys Asn Asn Phe Ser Thr Val Asn Ile Ser Leu
370 375 380
Gly Met Gly Lys Lys Leu Lys Leu Asp Pro Ser Leu Ala Asp Asp Ser
385 390 395 400
Gln Lys Glu Thr Ser Glu Ser Lys Asn Arg Ser Asp Arg Val Ser Gly
405 410 415
Ala Asp Ser Lys Ser Arg Lys Ser Asp Pro Leu Cys Gly Pro Glu Ile
420 425 430
Ile Gly Asp Pro Thr Glu Glu Glu Val Val Glu Ile Asn Ala Lys Ile
435 440 445
Asn Asn Leu Lys Gln Asn Cys Gly Leu Glu Ala Val Phe Ala Asp Asn
450 455 460
Gly Pro Arg Asp Glu Leu Pro Lys Ile Glu Glu Ala Arg Gly Met Ile
465 470 475 480
Glu Leu Gln Leu Val Gly Asn Ser Leu Ser Gln Pro Val Ser Gln Asp
485 490 495
Thr Met Met Trp Leu Ile Gly Leu Gln Asn Leu Phe Ser Tyr Gln Leu
500 505 510
Pro Lys Met Pro Lys His Tyr Ile Thr Arg Leu Val Phe Asp Pro Lys
515 520 525
Gln Lys Thr Leu Ala Leu Ile Lys His Gly Arg Pro Ile Gly Gly Ile
530 535 540
Cys Phe Arg Met Phe Pro Glu Gln Gly Phe Ser Glu Ile Val Phe Cys
545 550 555 560
Ala Val Ser Ser Asn Glu Gln Val Lys Gly Tyr Gly Thr His Leu Met
565 570 575
Asn His Leu Lys Asp Tyr His Ile Gln Ile Asn Ile His His Phe Leu
580 585 590
Thr Phe Ala Asp Ala Tyr Ala Ile Gly Tyr Phe Lys Lys Gln Gly Phe
595 600 605
Ser Lys Asp Ile Lys Leu Asn Arg Ala Val Tyr Gln Asp Leu Ile Lys
610 615 620
Asp Tyr Asp Gly Ala Thr Leu Met His Cys Gln Leu Asn Pro Lys Ile
625 630 635 640
Val Tyr Thr Glu Phe Thr Ser Val Ile Arg Lys Gln Arg Glu Ile Ile
645 650 655
Lys Tyr Ile Ile Glu Ser Arg Asn Ser Gln Ala Gln Gln Val Tyr Pro
660 665 670
Gly Leu Thr Cys Phe Lys Glu Gly Val Arg Pro Ile Pro Val Glu Ser
675 680 685
Ile Pro Gly Ile Gln Glu Thr Gly Trp Arg Pro Ala Ala Arg Met Thr
690 695 700
Arg Val Asn Arg Met Thr Glu Glu Cys Ser Asp Pro Asp Thr Leu Ala
705 710 715 720
Lys Asn Phe Ser Ile Ile Leu Asn Thr Ile Lys Asn His Asp Phe Ala
725 730 735
Trp Pro Phe Leu Glu Pro Val Lys Thr Glu Ile Ala Ala Asp Tyr Tyr
740 745 750
Asp His Ile Lys Tyr Pro Met Asp Leu Gly Thr Met Thr Lys Arg Leu
755 760 765
Lys Ala Gly Tyr Tyr Val Thr Arg Arg Leu Phe Ile Ala Asp Met Thr
770 775 780
Arg Ile Phe Ser Asn Cys Arg Gln Tyr Asn Lys Pro Asp Thr Gln Tyr
785 790 795 800
Tyr Thr Trp Gly Asn Thr Leu Glu Lys Tyr Phe Gln Thr Lys Met Lys
805 810 815
Glu Met Gly Leu Trp Asp Lys
820
<210> 3
<211> 44
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
taatacgact cactataggg ttgaaactgc tcttgtgttc gggc 44
<210> 4
<211> 44
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
taatacgact cactataggg ggccgcagtt ctgtttcaga ttgt 44

Claims (1)

1. A method for reducing temperature tolerance of bemisia tabaci, comprising the step of feeding the bemisia tabaci with dsRNA of a whitefly MED cryptic acetyltransferase gene, the nucleotide sequence of which is as set forth in SEQ ID No: 1, by using a nucleotide sequence shown as SEQ ID No: 3 and SEQ ID No: 4 to obtain the dsRNA.
CN202010823476.0A 2020-08-17 2020-08-17 Bemisia tabaci MED cryptohistone acetyltransferase gene gcn5, application thereof and method for reducing temperature tolerance of Bemisia tabaci Active CN111909911B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010823476.0A CN111909911B (en) 2020-08-17 2020-08-17 Bemisia tabaci MED cryptohistone acetyltransferase gene gcn5, application thereof and method for reducing temperature tolerance of Bemisia tabaci

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010823476.0A CN111909911B (en) 2020-08-17 2020-08-17 Bemisia tabaci MED cryptohistone acetyltransferase gene gcn5, application thereof and method for reducing temperature tolerance of Bemisia tabaci

Publications (2)

Publication Number Publication Date
CN111909911A CN111909911A (en) 2020-11-10
CN111909911B true CN111909911B (en) 2022-04-08

Family

ID=73278085

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010823476.0A Active CN111909911B (en) 2020-08-17 2020-08-17 Bemisia tabaci MED cryptohistone acetyltransferase gene gcn5, application thereof and method for reducing temperature tolerance of Bemisia tabaci

Country Status (1)

Country Link
CN (1) CN111909911B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111893102A (en) * 2020-08-19 2020-11-06 中国农业科学院植物保护研究所 Bemisia tabaci MED cryptohistone acetyltransferase gene gcn5, application thereof and method for reducing temperature tolerance of Bemisia tabaci

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110669750A (en) * 2019-09-24 2020-01-10 中国农业科学院植物保护研究所 Bemisia tabaci MED cryptomorphic dopamine decarboxylase, coding gene BtDDC and application thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110669750A (en) * 2019-09-24 2020-01-10 中国农业科学院植物保护研究所 Bemisia tabaci MED cryptomorphic dopamine decarboxylase, coding gene BtDDC and application thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
PREDICTED: Bemisia tabaci histone acetyltransferase KAT2A (LOC109037851), transcript variant X1, mRNA;anonymous;《GENBANK》;20161109;CDS、ORIGIN部分 *
温度胁迫下烟粉虱MED隐种与亚洲Ⅱ3隐种三个抗寒基因表达模式的分析;申晓娜等;《植物保护》;20181231;第44卷(第1期);全文 *

Also Published As

Publication number Publication date
CN111909911A (en) 2020-11-10

Similar Documents

Publication Publication Date Title
CN101130785B (en) Clone of rice WRKY gene relative to drought resistance and application thereof
CN110791523B (en) Cotton drought-resistant related gene GhRCHY1 and application thereof
CN103408648B (en) Application of paddy rice BG1 proteins and encoding genes of paddy rice BG1 proteins to adjusting growth and development of plants
CN111909911B (en) Bemisia tabaci MED cryptohistone acetyltransferase gene gcn5, application thereof and method for reducing temperature tolerance of Bemisia tabaci
CN110684756B (en) Bemisia tabaci MED cryptophyte soluble trehalase, gene BtTreh1 and application thereof
CN108588082B (en) Bemisia tabaci MED cryptomorphic high-temperature tolerance related gene BtDnmt3 and application thereof
CN111925429B (en) Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm1 and coding gene application thereof
CN111763253B (en) Chromatin remodeling factor ISWI, coding gene and role in diaphorina tabaci MED cryptic temperature tolerance
CN111763252B (en) Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm2 and coding gene and application thereof
CN109913473B (en) Gene for improving size and quality of seeds and application thereof
US9222102B2 (en) Inhibition of bolting and flowering of a sugar beet plant
CN102242134B (en) Cloning of soybean GmSGT (Glycine max serine glyoxylate aminotransferase) gene and 5&#39; UTR (Untranslated Regions) thereof and application thereof
CN111893102A (en) Bemisia tabaci MED cryptohistone acetyltransferase gene gcn5, application thereof and method for reducing temperature tolerance of Bemisia tabaci
CN108823220B (en) Cloning and application of waxy synthesis related gene MdCER1 in apple
CN108218969B (en) Sweet potato anthocyanin transport associated protein IbGSTF4, and coding gene and application thereof
CN114507674B (en) Application of circadian rhythm gene LUX of tea tree in improving cold resistance of plants
CN107267525B (en) Application of panax notoginseng polygalacturonase inhibitor protein gene PnPGIP
CN115927403A (en) King ZxPDS gene VIGS silencing system and construction method and application thereof
CN111848768B (en) BtISWI gene and application thereof in regulating and controlling cryptogenic temperature preference of bemisia tabaci MEAM1
CN111893101B (en) Bemisia tabaci MED cryptic acetyltransferase gene mof, application thereof and method for reducing low-temperature tolerance of Bemisia tabaci
CN101712718A (en) Protein relevant to plant drought resistance, coding gene and application thereof
CN111304220B (en) Cymbidium CgWRKY3 gene and application thereof
CN113528532B (en) Gene AtOIL3 for regulating oil content and thousand kernel weight of arabidopsis thaliana seed
CN111285926B (en) Plant stress tolerance associated protein GmTGA17, and coding gene and application thereof
CN113584051A (en) Application of GhGAI gene in regulation and control of plant flowering

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant