CN110669750A - Bemisia tabaci MED cryptomorphic dopamine decarboxylase, coding gene BtDDC and application thereof - Google Patents
Bemisia tabaci MED cryptomorphic dopamine decarboxylase, coding gene BtDDC and application thereof Download PDFInfo
- Publication number
- CN110669750A CN110669750A CN201911026516.2A CN201911026516A CN110669750A CN 110669750 A CN110669750 A CN 110669750A CN 201911026516 A CN201911026516 A CN 201911026516A CN 110669750 A CN110669750 A CN 110669750A
- Authority
- CN
- China
- Prior art keywords
- bemisia tabaci
- btddc
- med
- gene
- dopamine decarboxylase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
- A01K67/033—Rearing or breeding invertebrates; New breeds of invertebrates
- A01K67/0333—Genetically modified invertebrates, e.g. transgenic, polyploid
- A01K67/0337—Genetically modified Arthropods
- A01K67/0339—Genetically modified insects, e.g. Drosophila melanogaster, medfly
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y401/00—Carbon-carbon lyases (4.1)
- C12Y401/01—Carboxy-lyases (4.1.1)
- C12Y401/01028—Aromatic-L-amino-acid decarboxylase (4.1.1.28), i.e. tryptophane-decarboxylase
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/70—Invertebrates
- A01K2227/706—Insects, e.g. Drosophila melanogaster, medfly
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Environmental Sciences (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Animal Husbandry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention belongs to the technical field of agricultural biology, and particularly relates to bemisia tabaci MED cryptomorphic dopa decarboxylase, a coding gene BtDDC and application thereof. The amino acid sequence of the Bemisia tabaci MED cryptomorphic dopamine decarboxylase is shown as SEQ ID No. 1. The invention defines the expression modes of the BtDDC gene in different temperatures of the Bemisia tabaci MED cryptic species and the key effect of the gene on the temperature tolerance of the MED cryptic species, and can be used for destroying the temperature tolerance of the Bemisia tabaci and further preventing and controlling the harm and the diffusion of the Bemisia tabaci.
Description
Technical Field
The invention belongs to the technical field of agricultural biology, and particularly relates to bemisia tabaci MED cryptomorphic dopa decarboxylase, a coding gene BtDDC and application thereof.
Background
Bemisia tabaci (Gennadius)) belongs to the phylum Arthropoda, Insecta, Hemiptera, Bemisia, also known as Bemisia gossypii or Bemisia batatas. The most suitable development temperature of the bemisia tabaci is 26-30 ℃, the development critical temperature is 10.8-12.5 ℃, and the lethal high-temperature area is 37-42 ℃. 17 ℃ and 35 ℃ are the lowest and highest temperature limits for normal growth and development of bemisia tabaci. The strong temperature stress adaptability is the reason that bemisia tabaci is widely distributed in the world. With the increase of greenhouse effect, the global temperature increases year by year, and the tobacco whitefly MED has stronger temperature adversity adaptability to enable the tobacco whitefly MED to successfully adapt to different geographic environments, which has widely led people to discuss the theory of the invasion mechanism, and is one of the research hotspots in recent years for the molecular mechanism of the temperature adaptability.
The investigation on the distribution time and range of the mealybug MED species in China discovers that the invasion causes that the short fifteen years of China have spread to most provinces and cities, and the strong temperature adaptability of the mealybug MED species is greatly related to the content of stress-resistant substances in the mealybug MED species.
The RNA interference (RNAi) phenomenon is an evolutionarily conserved defense mechanism against transgene or foreign virus invasion. Introduction of double-stranded RNA (dsRNA) having a sequence homologous to the mRNA of the transcription product of a target gene into a cell specifically degrades the mRNA, resulting in a corresponding loss of functional phenotype. RNAi is widely existed in biology world, and can silence some genes in insect body by RNAi technology to enhance or lose some abilities of insect, and also can inhibit the expression of functional gene in specific time to make the development of insect stay at a certain stage, so as to achieve the purpose of utilizing or preventing the damage of insect. The dsRNA is fed to the bemisia tabaci, so that the dsRNA has the characteristics of simplicity, convenience, easiness in operation and the like, and can be applied to the research of the bemisia tabaci.
Disclosure of Invention
The invention aims to provide Bemisia tabaci MED cryptomorphic dopamine decarboxylase.
The invention further aims to provide the coding gene BtDDC of the bemisia tabaci MED cryptomorphic dopamine decarboxylase.
It is still another object of the present invention to provide a recombinant expression vector containing the above-mentioned coding gene.
It is still another object of the present invention to provide a recombinant strain containing the above-mentioned encoding gene.
It is still another object of the present invention to provide the use of the above-mentioned encoding gene.
It is a further object of the present invention to provide a method for reducing temperature tolerance of aleyrodids cryptica MED.
According to the specific embodiment of the invention, the amino acid sequence of the Bemisia tabaci MED cryptomorphic dopamine decarboxylase is shown as SEQ ID No. 1:
MEGTVFTPNMEVAEFQDFAKAMIDYISKYMSSIRDRPVLPKLEPGYLRPLIPESAPEEPESWHNVMEDIERVIMPGVTHWHSPRFHAYFPTACSYPAIVADMLSDAIACIGFTWIASPACTELEVVMMDWLGKMLNLPDDFLACGKKGGGGVIQGTASEATLVALLGAKTRAIRRTKEEHPDWTDLEIASKLVAYCSKQAHSSVERAGLLGSVPFRLLPTDDMYRLQGNTLEEAIKKDKADGLVPFYVVATLGTTSCCSFDLLKEIGPVCKNEEVWLHVDAAYAGSAFICPEYQYLLEGVEYAESFNFNPHKWMLINFDCSAMWLKNPDEVVNAFNVDPLYLKHDHQGAAPDYRHWQIPLGRRFRSLKLWFVLRLYGIKNLQTHIRHQIGLAHQFEAYVNEDEEFELFNEVLMGLVCFRVKGSNELNEQVLNRINKKGKIHMVPSKIKDVFFLRFAVCSRFTNAEDVKYSWSEVKATTQEIKKELAKQ
the bemisia tabaci MED cryptomorphic dopamine decarboxylase provided by the invention has the typical structural characteristics of DDC protein: comprises a conserved domain of pyrrole-dependent decarboxylase, which is positioned at 44-421 of the sequence, wherein a site for connecting the phenylpyridine is contained, and is positioned at 305-326.
According to the specific embodiment of the invention, the genome nucleotide sequence of the coding gene BtDDC of the tobacco whitefly MED cryptomorphic dopamine decarboxylase is shown as SEQ ID NO. 2:
TACTATAGGGCGAATTGGGCCCGACGTCGCATGCTCCCGGCCGCCATGGCGGCCGCGGGAATTCGATTGGATCGCCCTTCTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCGTCGTTTTATTTTTTCGTCCACCACCCATTCACCATGGAGGGCACCGTTTTTACCCCAAACATGGAGGTCGCGGAGTTCCAAGACTTTGCAAAGGCGATGATCGATTATATTAGCAAATACATGTCATCAATTCGAGACAGGCCTGTTCTACCTAAATTGGAGCCAGGATACTTGAGACCTTTGATCCCGGAGTCTGCACCAGAGGAACCAGAATCATGGCATAATGTTATGGAAGATATTGAAAGAGTTATTATGCCAGGAGTAACTCACTGGCATTCACCCCGCTTCCATGCATACTTCCCGACAGCCTGCTCTTACCCTGCCATAGTTGCTGACATGTTAAGTGACGCCATTGCTTGCATTGGATTTACCTGGATCGCAAGTCCAGCTTGCACAGAACTCGAGGTTGTGATGATGGACTGGCTCGGTAAGATGCTTAATCTCCCTGATGACTTTTTGGCCTGTGGAAAGAAAGGAGGTGGTGGTGTTATTCAGGGCACTGCTAGTGAGGCAACTCTTGTCGCCCTTCTGGGTGCCAAAACCAGAGCAATCCGCCGAACAAAAGAAGAGCATCCTGATTGGACAGATCTTGAAATCGCCTCCAAATTGGTAGCGTACTGCTCCAAACAAGCCCACTCCTCGGTGGAACGAGCAGGTCTTCTGGGAAGCGTCCCGTTCAGACTCCTACCTACAGACGATATGTACAGATTACAAGGCAACACTTTAGAAGAAGCTATCAAAAAAGACAAAGCTGACGGTCTCGTTCCTTTCTATGTTGTTGCAACTCTAGGAACGACCTCCTGCTGTTCATTTGATCTGCTCAAAGAAATTGGACCAGTGTGTAAAAATGAAGAAGTTTGGCTTCATGTTGATGCTGCGTATGCAGGATCTGCCTTCATTTGTCCCGAGTATCAGTATTTGTTAGAAGGGGTAGAGTACGCTGAGTCATTCAATTTTAATCCTCATAAGTGGATGCTCATAAACTTTGACTGCTCAGCCATGTGGTTAAAAAATCCAGATGAAGTTGTAAATGCATTCAATGTTGATCCTCTTTACCTGAAGCACGACCACCAAGGAGCTGCTCCTGATTATAGGCACTGGCAAATTCCACTCGGCAGGCGATTCCGTTCATTGAAATTGTGGTTTGTTCTGCGATTGTATGGAATAAAGAACCTTCAAACCCACATTCGTCATCAAATTGGACTCGCCCATCAGTTTGAAGCGTACGTCAATGAAGATGAGGAGTTTGAATTATTCAACGAAGTACTCATGGGTCTTGTCTGCTTCAGAGTTAAGGGCTCCAATGAATTGAACGAACAAGTGCTGAACAGGATCAACAAAAAAGGCAAAATCCACATGGTTCCCTCAAAAATCAAGGATGTCTTCTTCCTCCGTTTTGCCGTCTGTTCACGTTTCACAAACGCCGAAGATGTCAAATACTCGTGGAGTGAAGTCAAAGCCACAACCCAAGAAATCAAAAAAGAGCTAGCCAAGCAGTGATTGAAAGTTCCGACAAATATTTAAGTTATTCCACCTCCATGTATTATCTTTGTTAAGTTTTAGTACATTTAATCTCAAGATTCAATGGAAAAGCTCTCTATTTTTAGTAAGTTATTTTTACAGATTGACTATTCAAGCAGCACTAATGTTTTGTGCTCCAGGAGCCAAGCTCAAAGTTTTTAGGAACTCATTGAGTCTCACCCTATCTTGAATAACGAAATGAAAAAACTTAGCATGAAGATGAAATGGATTAAATTAAAATTTCTTCTAAGTGTAATTGAAGAATTGCGTTAAATATATATGCTTTTATTCCTCTCACTGCGAAAAGTATCAAAGACGATTCTCTAATAGCATAACTTCATAATTTCATTATTTAAAAATATTTTATACTTCAACCTCCGAACACCAAAGGGCACAGCCATGTCAACAAATCAACAACTACCAGACGGAGGAATGTATCTTAATTGCACTGTTTCAGTATGCTTGCTAATTTTTTTTCTTTCAAGGAAAACTGTTTTATGAATTTTCTTGAAAACTCTAATGATTTTTCTTTACCTTCGTGAGAAAAGACTCTAAAATTTTCAGATTGATTCGTGCGATGGTTCTTGCATGAAAATATAAAATCTTTCTAAAAACATTGAAACAGTCCAGGCAAGATATGTTCCTTTGTGCAGGAGACGGCAAAATGTCTCATTTCCTAAAAATTCGTTTGAGTGTCTGAAGAATTTGATGGATATTTCATCGTAGGCACTAAATAAAAGTGTAGCATGGCTGTTGGCATCTTCCTTTGATCAAGTGAAATTGTATCCAATAGTTTTGATTGTTAAGTTTGTTGTTTTCAATGCATTGTTCCAGTATTAGCAGAAAATTTATTATTTTACGATTACAATTATTGTTATTTATGGATGTAATTATAATTGTATGTGTAAGTGTAGATTTTAACTTTTTATGACAGGAATTGAATTTTAGACCATTCGTTTTTCAAGGGCCCTCATCCGATGCCCATTTCCTTGATTCTAGACAATTTTAATCAAATCATGATCTGTGAAAAACAAGTTTTATGATGCTTGCCAATGTGGTTTCTTTTTTTTTCTTTTTTTAAACTTATCTCACTCCGTACTTTGTGAATGATGAGCTGTGACATTATATGCTAGTATTTCAAAAATTTAATAATTTTTTGTAAAATTAAGTGTTTCTTATTTTATAGTCTTTTCATCCCTCGAAACACCATCTGTGACACCATTAATTCTTATTCTAATACACCTTAAGATCATCTCCAATTTAATGAAGATTTCATACATTTTGTTTTTTTTATAATATGAAAATTACTAATGTAAAATTTTCTTATCTTTTTGAATTGACTCATTTGCTCAAGCTACTTTTCAAAATAAAAATTCCAATTATTCTGTCAGCCTCAAAAAAAAAAAAAAATCTCAGTCGCTGAGTAGCACATAAATATTTAAAATCCTTGATTGATTGCCTAAAATTTCTAAGCTCATTTCAAAATCTGTATGTTAAATAGAATTCTATAGTCATTTGTATCATTTTGAATTGTCAAATTTTAAAAATTTCAGTCTCCTCACCTGTGTTGTCGGCTATTCTAATTCCCTCCTTAAATGTTCATCATCGGTGTTTAAAGAGCCTCAGGCAAGATTTTATGTTTGAATTGAATTGTTTTTTCAACATTCTACAATTGATATCTAGAGACAATGCATTAAAAGTTTAATGTTTTGTATGAGAAACTTTGTTCAATATTGCGCTAAAGTATTTTAGAAAAGTCAAATACCACACACCCAATCCCCCCCATTTGGATTAAATTATTGCAATCTTGTTCTAGTCTGAAAAGCAGCACAGTTTGAAGGTTTCACCAATGATCGTAAACATAAAAATCCATTTAATTAAAGAATTAACATAGAAAGGTTAGATAAGACTCTTGTAATAAAAGACACAAGACAATATAATGAATAATAATTTATTGTAAAAAGTTTAATTTATTC
the cDNA sequence of the coding gene BtDDC of the Bemisia tabaci MED cryptomorph dopamine decarboxylase is shown in SEQ ID NO. 3:
ATGGAGGGCACCGTTTTTACCCCAAACATGGAGGTCGCGGAGTTCCAAGACTTTGCAAAGGCGATGATCGATTATATTAGCAAATACATGTCATCAATTCGAGACAGGCCTGTTCTACCTAAATTGGAGCCAGGATACTTGAGACCTTTGATCCCGGAGTCTGCACCAGAGGAACCAGAATCATGGCATAATGTTATGGAAGATATTGAAAGAGTTATTATGCCAGGAGTAACTCACTGGCATTCACCCCGCTTCCATGCATACTTCCCGACAGCCTGCTCTTACCCTGCCATAGTTGCTGACATGTTAAGTGACGCCATTGCTTGCATTGGATTTACCTGGATCGCAAGTCCAGCTTGCACAGAACTCGAGGTTGTGATGATGGACTGGCTCGGTAAGATGCTTAATCTCCCTGATGACTTTTTGGCCTGTGGAAAGAAAGGAGGTGGTGGTGTTATTCAGGGCACTGCTAGTGAGGCAACTCTTGTCGCCCTTCTGGGTGCCAAAACCAGAGCAATCCGCCGAACAAAAGAAGAGCATCCTGATTGGACAGATCTTGAAATCGCCTCCAAATTGGTAGCGTACTGCTCCAAACAAGCCCACTCCTCGGTGGAACGAGCAGGTCTTCTGGGAAGCGTCCCGTTCAGACTCCTACCTACAGACGATATGTACAGATTACAAGGCAACACTTTAGAAGAAGCTATCAAAAAAGACAAAGCTGACGGTCTCGTTCCTTTCTATGTTGTTGCAACTCTAGGAACGACCTCCTGCTGTTCATTTGATCTGCTCAAAGAAATTGGACCAGTGTGTAAAAATGAAGAAGTTTGGCTTCATGTTGATGCTGCGTATGCAGGATCTGCCTTCATTTGTCCCGAGTATCAGTATTTGTTAGAAGGGGTAGAGTACGCTGAGTCATTCAATTTTAATCCTCATAAGTGGATGCTCATAAACTTTGACTGCTCAGCCATGTGGTTAAAAAATCCAGATGAAGTTGTAAATGCATTCAATGTTGATCCTCTTTACCTGAAGCACGACCACCAAGGAGCTGCTCCTGATTATAGGCACTGGCAAATTCCACTCGGCAGGCGATTCCGTTCATTGAAATTGTGGTTTGTTCTGCGATTGTATGGAATAAAGAACCTTCAAACCCACATTCGTCATCAAATTGGACTCGCCCATCAGTTTGAAGCGTACGTCAATGAAGATGAGGAGTTTGAATTATTCAACGAAGTACTCATGGGTCTTGTCTGCTTCAGAGTTAAGGGCTCCAATGAATTGAACGAACAAGTGCTGAACAGGATCAACAAAAAAGGCAAAATCCACATGGTTCCCTCAAAAATCAAGGATGTCTTCTTCCTCCGTTTTGCCGTCTGTTCACGTTTCACAAACGCCGAAGATGTCAAATACTCGTGGAGTGAAGTCAAAGCCACAACCCAAGAAATCAAAAAAGAGCTAGCCAAGCAGTGA
the invention also provides a recombinant expression vector and a recombinant strain containing the bemisia tabaci MED cryptic dopamine decarboxylase gene BtDDC.
The method for reducing the temperature tolerance of the cryptophyte MED of the bemisia tabaci comprises the step of feeding dsRNA of the cryptophyte dopamine decarboxylase gene BtDDC of the bemisia tabaci, wherein the primer sequence for amplifying the dsRNA is as follows:
BtDDC-F：5’-TAATACGACTCACTATAGGGCGCAGAACAAACCACAAT-3’；
BtDDC-R：5’-GCCAAAACCAGAGCAATC-3’。
the invention provides a pesticide for controlling bemisia tabaci, which comprises a dsRNA segment of a bemisia tabaci MED cryptic dopamine decarboxylase gene BtDDC.
The invention has the beneficial effects that:
the cDNA of the BtDDC gene is cloned from the hidden seed of Bemisia tabaci MED, and the fluorescent quantitative PCR shows that the expression quantity of the BtDDC gene is obviously increased within 5 hours of high-temperature and low-temperature stress; the BtDDC gene dsRNA is fed to discover that the high-temperature knockdown time of the Bemisia tabaci MED cryptophyte adults is obviously reduced, and the low-temperature knockdown recovery time is increased.
The invention defines the expression modes of the BtDDC gene in different temperatures of the hidden seeds of Bemisia tabaci MED and the key effect of the gene on the temperature tolerance of the hidden seeds of MED, and the BtDDC gene can be used for destroying the temperature tolerance of Bemisia tabaci and further preventing and controlling the harm and the diffusion of the Bemisia tabaci.
Drawings
FIG. 1 shows the results of analysis of expression patterns of BtDDC gene at gradient temperature in Bemisia tabaci MED cryptic species;
FIG. 2 shows the change of expression levels of BtDDC genes in three treatments of feeding BtDDC gene dsRNA, dsEGFP and feeding 10% sucrose solution;
FIG. 3 shows the high temperature knockdown time of Bemisia tabaci MED cryptomorphic adults after feeding BtDDC gene dsRNA, dsEGFP and feeding 10% sucrose solution for 3 h;
FIG. 4 shows the recovery time of Bemisia tabaci MED Cryptodermia at low temperature after feeding BtDDC gene dsRNA, dsEGFP and feeding 10% sucrose solution for 3 h.
Detailed Description
Example 1 full-Length cDNA sequence cloning of BtDDC Gene of Bemisia tabaci MED
1.1 Total RNA extraction and cDNA Synthesis
Respectively taking 200 heads of bemisia tabaci adults under different temperature stress conditions, putting the 200 heads into a centrifugal tube of 1.5mL, freezing the fluidextract by using liquid nitrogen, grinding the fluidextract into powder by using a grinding rod, and extracting RNA (ribonucleic acid) and storing the RNA at minus 80 ℃ for later use.
cDNA was synthesized by reverse transcription according to the instructions of the reverse transcription kit (Super Script First-StrandSynthesis System) from Transgen.
1.2PCR amplification of Bemisia tabaci MED cryptic BtDDC Gene
Intermediate fragment of gene
(1) Designing a middle segment primer for PCR amplification of the bemisia tabaci MED cryptic BtDDC gene:
BtDDC-F：AGCATTTTTTGTTTGAGC，
BtDDC-R：ATGAGTGAGCCTGGTCCG。
(2) and (3) PCR amplifying the intermediate segment of the bemisia tabaci MED cryptic species BtDDC gene by using cDNA as a template and the primer set in the step (1).
(3) The desired fragment is recovered and sequenced.
1.3 obtaining of Bemisia tabaci MED cryptic BtDDC gene 5 'RACE and 3' RACE
(1) Designing 5 'RACE and 3' RACE specific primers according to the intermediate fragment sequence of the Bemisia tabaci MED cryptic BtDDC gene obtained in the step (2), and carrying out PCR amplification on the 5 'and 3' end sequences of the BtDDC gene:
5’RACE Inner Primer:CGGCAGGCGATTCCGTTCATTGA，
5’RACE Outer Primer:CGCCCATCAGTTTGAAGCGTACATC；
3’RACE Inner Primer:GGGCGAGTCCAATTTGATGACGA，
3’RACE Outer Primer:GGAGCCCTTAACTCTGAAGCAGAC。
(2) obtaining the full length of the cDNA sequence of the BtDDC gene by adopting a SMARTERTM RACE cDNA Amplification Kit (Clonetch) Kit, wherein the full length of the cDNA sequence of the BtDDC gene has a nucleotide sequence shown as SEQ ID No.3, and the genome sequence 3655bp of the BtDDC is obtained; 487 amino acids are coded, and the enzyme coded by the gene has an amino acid sequence shown as SEQ ID No. 1.
Example 2 analysis of expression characteristics of BtDDC Gene
2.1 analysis of the expression patterns of the Bemisia tabaci MED cryptic species at different temperatures
Selecting the preliminarily emerged Bemisia tabaci MED cryptomorphic imagoes, and carrying out stress treatment on the Bemisia tabaci imagoes at 0, 12, 26, 35 and 40 ℃. Each of the 3 biology is repeated, 3000 adults are obtained, and after the stress is finished, the adults are immediately placed in liquid nitrogen to be frozen for 3 minutes and then stored at the temperature of minus 80 ℃. RNA was extracted and reverse transcribed into cDNA according to the method of example 1.
2.2 fluorescent quantitative PCR detection of different tissue expression levels:
(1) designing primers of BtDDC gene and two internal reference genes (EF 1-alpha, beta-tubulin) of fluorescent quantitative PCR:
BtDDC-F:CAGACAAGGGTGACAAATGGGA，
BtDDC-R:TACTGGGGTAAGAACTAGCGGC；
EF1-α-F:TAGCCTTGTGCCAATTTCCG，
EF1-α-R:CCTTCAGCATTACCGTCC；
β-tublin-F：TGTCAGGAGTAACGACGTGTTTG，
β-tublin-R：TTCGGGAACGGTAAGTGCTC。
by 2-ΔΔCtThe method calculates the relative expression level of the gene. Analysis was performed using SPSS 16.0 statistical software. Comparison of expression amounts Fisher's least significant difference (Means. + -. SE) was used to represent data, P<0.05。
Results are shown in figure 1, expression modes of the BtDDC under different temperature stresses are analyzed, and real-time fluorescence quantitative PCR results show that the expression quantity of the BtDDC is remarkably increased within 5h under high-temperature and low-temperature stresses.
2.3 influence of dsRNA treatment of BtDDC Gene on Heat resistance of Bemisia tabaci MED cryptic species
1. Preparing a dsRNA template:
(1) primer sequences were designed to synthesize plus the T7 promoter (sequence underlined):
T7+BtDDC-F：
5’-TAATACGACTCACTATAGGGCGCAGAACAAACCACAAT-3’；
BtDDC-R：5’-GCCAAAACCAGAGCAATC-3’。
(2) total RNA extraction and cDNA synthesis: the same as in example 1.
(3) And (3) carrying out PCR amplification and product purification on the T7 primer, wherein the purified PCR product is the template for synthesizing dsRNA.
2. Synthesis and purification of dsRNA
dsRNA was synthesized and purified using the RNAi Kit, and the procedure was followed according to the Kit instructions.
3. dsRNA feeding
The Parafilm membrane was previously treated with DEPC water to remove RNase. Adding dsRNA into sucrose solution with the concentration of 10%, wherein the concentration is 0.3-0.5 mu g/mu L. According to the experimental requirements, the Parafilm membrane-sandwiched nutrient solution method is correspondingly improved: taking about 200 heads of the primary eclosion bemisia tabaci adults, putting the initial eclosion bemisia tabaci adults into a glass tube with two transparent ends, covering the upper end of the glass tube with a double-layer Parafilm, adding 200 mu L of 10% sucrose solution between the two films, adding dsRNA to enable the final concentration to be 0.3-0.5 mu g/mu L, covering the lower end of the glass tube with gauze, and keeping ventilation. The periphery and the lower end of the glass tube are wrapped by black plastic, so that the bemisia tabaci gathers to a Paraflim film at the top end to obtain dsRNA better, the device is placed into an artificial climate box, the temperature is 26 +/-0.5 ℃, the illumination is carried out for 24 hours, the relative humidity is 60-70%, after the dsRNA of a 3h BtDDC gene is fed, the bemisia tabaci is collected into a finger-shaped tube, a group of the devices are placed into a preheated high-temperature water bath kettle to be subjected to heat knockdown, the time that the bemisia tabaci cannot stand vertically is recorded, and the treatment temperature is 45 ℃. The other group is put into a low-temperature water bath kettle for cold knock down for ten minutes and then taken out to record the recovery time after knock down, and the treatment temperature is-5 ℃. Bemisia tabaci fed dsEGFP and sterilized 10% sucrose solution was used as a positive control and bemisia tabaci fed no dsRNA and sterilized 10% sucrose solution was used as a negative control, 3 replicates per group.
Analyzing the BtDDC gene expression quantity change, the high-temperature knockdown time and the cold knockdown time of the hidden species of the Bemisia tabaci MED after feeding different solutions.
The results are shown in fig. 2, the expression level of BtDDC gene of Bemisia tabaci MED cryptic species fed with BtDDC gene dsRNA is significantly lower than that of dsEGFP and sucrose fed groups.
The results are shown in fig. 3, the heat stroke time of bemisia tabaci MED cryptic fed BtDDC gene dsRNA was significantly lower than the heat stroke time of the dsEGFP and sucrose fed groups (P < 0.05).
The results are shown in fig. 4, with the whitefly MED cryptic fed BtDDC gene dsRNA the cold knockdown recovery time was significantly higher than the cold knockdown recovery time for the dsEGFP and sucrose fed groups.
Therefore, the BtDDC gene plays a key role in the high-temperature and low-temperature tolerance of the bemisia tabaci MED cryptic species.
Sequence listing
<110> institute of plant protection of Chinese academy of agricultural sciences
<120> bemisia tabaci MED cryptomorphic dopamine decarboxylase, coding gene BtDDC and application thereof
<160>3
<170>SIPOSequenceListing 1.0
<210>1
<211>488
<212>PRT
<213> Bemisia tabaci (Bemis tabaci Gennadius)
<400>1
Met Glu Gly Thr Val Phe Thr Pro Asn Met Glu Val Ala Glu Phe Gln
1 5 10 15
Asp Phe Ala Lys Ala Met Ile Asp Tyr Ile Ser Lys Tyr Met Ser Ser
20 25 30
Ile Arg Asp Arg Pro Val Leu Pro Lys Leu Glu Pro Gly Tyr Leu Arg
35 40 45
Pro Leu Ile Pro Glu Ser Ala Pro Glu Glu Pro Glu Ser Trp His Asn
50 55 60
Val Met Glu Asp Ile Glu Arg Val Ile Met Pro Gly Val Thr His Trp
65 70 75 80
His Ser Pro Arg Phe His Ala Tyr Phe Pro Thr Ala Cys Ser Tyr Pro
85 90 95
Ala Ile Val Ala Asp Met Leu Ser Asp Ala Ile Ala Cys Ile Gly Phe
100 105 110
Thr Trp Ile Ala Ser ProAla Cys Thr Glu Leu Glu Val Val Met Met
115 120 125
Asp Trp Leu Gly Lys Met Leu Asn Leu Pro Asp Asp Phe Leu Ala Cys
130 135 140
Gly Lys Lys Gly Gly Gly Gly Val Ile Gln Gly Thr Ala Ser Glu Ala
145 150 155 160
Thr Leu Val Ala Leu Leu Gly Ala Lys Thr Arg Ala Ile Arg Arg Thr
165 170 175
Lys Glu Glu His Pro Asp Trp Thr Asp Leu Glu Ile Ala Ser Lys Leu
180 185 190
Val Ala Tyr Cys Ser Lys Gln Ala His Ser Ser Val Glu Arg Ala Gly
195 200 205
Leu Leu Gly Ser Val Pro Phe Arg Leu Leu Pro Thr Asp Asp Met Tyr
210 215 220
Arg Leu Gln Gly Asn Thr Leu Glu Glu Ala Ile Lys Lys Asp Lys Ala
225 230 235 240
Asp Gly Leu Val Pro Phe Tyr Val Val Ala Thr Leu Gly Thr Thr Ser
245 250 255
Cys Cys Ser Phe Asp Leu Leu Lys Glu Ile Gly Pro Val Cys Lys Asn
260 265 270
Glu Glu Val Trp Leu His Val AspAla Ala Tyr Ala Gly Ser Ala Phe
275 280 285
Ile Cys Pro Glu Tyr Gln Tyr Leu Leu Glu Gly Val Glu Tyr Ala Glu
290 295 300
Ser Phe Asn Phe Asn Pro His Lys Trp Met Leu Ile Asn Phe Asp Cys
305 310 315 320
Ser Ala Met Trp Leu Lys Asn Pro Asp Glu Val Val Asn Ala Phe Asn
325 330 335
Val Asp Pro Leu Tyr Leu Lys His Asp His Gln Gly Ala Ala Pro Asp
340 345 350
Tyr Arg His Trp Gln Ile Pro Leu Gly Arg Arg Phe Arg Ser Leu Lys
355 360 365
Leu Trp Phe Val Leu Arg Leu Tyr Gly Ile Lys Asn Leu Gln Thr His
370 375 380
Ile Arg His Gln Ile Gly Leu Ala His Gln Phe Glu Ala Tyr Val Asn
385 390 395 400
Glu Asp Glu Glu Phe Glu Leu Phe Asn Glu Val Leu Met Gly Leu Val
405 410 415
Cys Phe Arg Val Lys Gly Ser Asn Glu Leu Asn Glu Gln Val Leu Asn
420 425 430
Arg Ile Asn Lys Lys Gly Lys Ile His MetVal Pro Ser Lys Ile Lys
435 440 445
Asp Val Phe Phe Leu Arg Phe Ala Val Cys Ser Arg Phe Thr Asn Ala
450 455 460
Glu Asp Val Lys Tyr Ser Trp Ser Glu Val Lys Ala Thr Thr Gln Glu
465 470 475 480
Ile Lys Lys Glu Leu Ala Lys Gln
485
<210>2
<211>3655
<212>DNA
<213> Bemisia tabaci (Bemis tabaci Gennadius)
<400>2
tactataggg cgaattgggc ccgacgtcgc atgctcccgg ccgccatggc ggccgcggga 60
attcgattgg atcgcccttc taatacgact cactataggg caagcagtgg tatcaacgca 120
gagtactttt tttttttttt tttttttttt ttttttcgtc gttttatttt ttcgtccacc 180
acccattcac catggagggc accgttttta ccccaaacat ggaggtcgcg gagttccaag 240
actttgcaaa ggcgatgatc gattatatta gcaaatacat gtcatcaatt cgagacaggc 300
ctgttctacc taaattggag ccaggatact tgagaccttt gatcccggag tctgcaccag 360
aggaaccaga atcatggcat aatgttatgg aagatattga aagagttatt atgccaggag 420
taactcactg gcattcaccc cgcttccatg catacttccc gacagcctgc tcttaccctg 480
ccatagttgc tgacatgtta agtgacgcca ttgcttgcat tggatttacc tggatcgcaa 540
gtccagcttg cacagaactc gaggttgtga tgatggactg gctcggtaag atgcttaatc 600
tccctgatga ctttttggcc tgtggaaaga aaggaggtgg tggtgttatt cagggcactg 660
ctagtgaggc aactcttgtc gcccttctgg gtgccaaaac cagagcaatc cgccgaacaa 720
aagaagagca tcctgattgg acagatcttg aaatcgcctc caaattggta gcgtactgct 780
ccaaacaagc ccactcctcg gtggaacgag caggtcttct gggaagcgtc ccgttcagac 840
tcctacctac agacgatatg tacagattac aaggcaacac tttagaagaa gctatcaaaa 900
aagacaaagc tgacggtctc gttcctttct atgttgttgc aactctagga acgacctcct 960
gctgttcatt tgatctgctc aaagaaattg gaccagtgtg taaaaatgaa gaagtttggc 1020
ttcatgttga tgctgcgtat gcaggatctg ccttcatttg tcccgagtat cagtatttgt 1080
tagaaggggt agagtacgct gagtcattca attttaatcc tcataagtgg atgctcataa 1140
actttgactg ctcagccatg tggttaaaaa atccagatga agttgtaaat gcattcaatg 1200
ttgatcctct ttacctgaag cacgaccacc aaggagctgc tcctgattat aggcactggc 1260
aaattccact cggcaggcga ttccgttcat tgaaattgtg gtttgttctg cgattgtatg 1320
gaataaagaa ccttcaaacc cacattcgtc atcaaattgg actcgcccat cagtttgaag 1380
cgtacgtcaa tgaagatgag gagtttgaat tattcaacga agtactcatg ggtcttgtct 1440
gcttcagagt taagggctcc aatgaattga acgaacaagt gctgaacagg atcaacaaaa 1500
aaggcaaaat ccacatggtt ccctcaaaaa tcaaggatgt cttcttcctc cgttttgccg 1560
tctgttcacg tttcacaaac gccgaagatg tcaaatactc gtggagtgaa gtcaaagcca 1620
caacccaaga aatcaaaaaa gagctagcca agcagtgatt gaaagttccg acaaatattt 1680
aagttattcc acctccatgt attatctttg ttaagtttta gtacatttaa tctcaagatt 1740
caatggaaaa gctctctatt tttagtaagt tatttttaca gattgactat tcaagcagca 1800
ctaatgtttt gtgctccagg agccaagctc aaagttttta ggaactcatt gagtctcacc 1860
ctatcttgaa taacgaaatg aaaaaactta gcatgaagat gaaatggatt aaattaaaat 1920
ttcttctaag tgtaattgaa gaattgcgtt aaatatatat gcttttattc ctctcactgc 1980
gaaaagtatc aaagacgatt ctctaatagc ataacttcat aatttcatta tttaaaaata 2040
ttttatactt caacctccga acaccaaagg gcacagccat gtcaacaaat caacaactac 2100
cagacggagg aatgtatctt aattgcactg tttcagtatg cttgctaatt ttttttcttt 2160
caaggaaaac tgttttatga attttcttga aaactctaat gatttttctt taccttcgtg 2220
agaaaagact ctaaaatttt cagattgatt cgtgcgatgg ttcttgcatg aaaatataaa 2280
atctttctaa aaacattgaa acagtccagg caagatatgt tcctttgtgc aggagacggc 2340
aaaatgtctc atttcctaaa aattcgtttg agtgtctgaa gaatttgatg gatatttcat 2400
cgtaggcact aaataaaagt gtagcatggc tgttggcatc ttcctttgat caagtgaaat 2460
tgtatccaat agttttgatt gttaagtttg ttgttttcaa tgcattgttc cagtattagc 2520
agaaaattta ttattttacg attacaatta ttgttattta tggatgtaat tataattgta 2580
tgtgtaagtg tagattttaa ctttttatga caggaattga attttagacc attcgttttt 2640
caagggccctcatccgatgc ccatttcctt gattctagac aattttaatc aaatcatgat 2700
ctgtgaaaaa caagttttat gatgcttgcc aatgtggttt cttttttttt ctttttttaa 2760
acttatctca ctccgtactt tgtgaatgat gagctgtgac attatatgct agtatttcaa 2820
aaatttaata attttttgta aaattaagtg tttcttattt tatagtcttt tcatccctcg 2880
aaacaccatc tgtgacacca ttaattctta ttctaataca ccttaagatc atctccaatt 2940
taatgaagat ttcatacatt ttgttttttt tataatatga aaattactaa tgtaaaattt 3000
tcttatcttt ttgaattgac tcatttgctc aagctacttt tcaaaataaa aattccaatt 3060
attctgtcag cctcaaaaaa aaaaaaaaat ctcagtcgct gagtagcaca taaatattta 3120
aaatccttga ttgattgcct aaaatttcta agctcatttc aaaatctgta tgttaaatag 3180
aattctatag tcatttgtat cattttgaat tgtcaaattt taaaaatttc agtctcctca 3240
cctgtgttgt cggctattct aattccctcc ttaaatgttc atcatcggtg tttaaagagc 3300
ctcaggcaag attttatgtt tgaattgaat tgttttttca acattctaca attgatatct 3360
agagacaatg cattaaaagt ttaatgtttt gtatgagaaa ctttgttcaa tattgcgcta 3420
aagtatttta gaaaagtcaa ataccacaca cccaatcccc cccatttgga ttaaattatt 3480
gcaatcttgt tctagtctga aaagcagcac agtttgaagg tttcaccaat gatcgtaaac 3540
ataaaaatcc atttaattaa agaattaaca tagaaaggtt agataagact cttgtaataa 3600
aagacacaag acaatataat gaataataat ttattgtaaa aagtttaatt tattc 3655
<210>3
<211>1467
<212>DNA
<213> Bemisia tabaci (Bemis tabaci Gennadius)
<400>3
atggagggca ccgtttttac cccaaacatg gaggtcgcgg agttccaaga ctttgcaaag 60
gcgatgatcg attatattag caaatacatg tcatcaattc gagacaggcc tgttctacct 120
aaattggagc caggatactt gagacctttg atcccggagt ctgcaccaga ggaaccagaa 180
tcatggcata atgttatgga agatattgaa agagttatta tgccaggagt aactcactgg 240
cattcacccc gcttccatgc atacttcccg acagcctgct cttaccctgc catagttgct 300
gacatgttaa gtgacgccat tgcttgcatt ggatttacct ggatcgcaag tccagcttgc 360
acagaactcg aggttgtgat gatggactgg ctcggtaaga tgcttaatct ccctgatgac 420
tttttggcct gtggaaagaa aggaggtggt ggtgttattc agggcactgc tagtgaggca 480
actcttgtcg cccttctggg tgccaaaacc agagcaatcc gccgaacaaa agaagagcat 540
cctgattgga cagatcttga aatcgcctcc aaattggtag cgtactgctc caaacaagcc 600
cactcctcgg tggaacgagc aggtcttctg ggaagcgtcc cgttcagact cctacctaca 660
gacgatatgt acagattaca aggcaacact ttagaagaag ctatcaaaaa agacaaagct 720
gacggtctcg ttcctttcta tgttgttgca actctaggaa cgacctcctg ctgttcattt 780
gatctgctca aagaaattgg accagtgtgt aaaaatgaag aagtttggct tcatgttgat 840
gctgcgtatg caggatctgc cttcatttgt cccgagtatc agtatttgtt agaaggggta 900
gagtacgctg agtcattcaa ttttaatcct cataagtgga tgctcataaa ctttgactgc960
tcagccatgt ggttaaaaaa tccagatgaa gttgtaaatg cattcaatgt tgatcctctt 1020
tacctgaagc acgaccacca aggagctgct cctgattata ggcactggca aattccactc 1080
ggcaggcgat tccgttcatt gaaattgtgg tttgttctgc gattgtatgg aataaagaac 1140
cttcaaaccc acattcgtca tcaaattgga ctcgcccatc agtttgaagc gtacgtcaat 1200
gaagatgagg agtttgaatt attcaacgaa gtactcatgg gtcttgtctg cttcagagtt 1260
aagggctcca atgaattgaa cgaacaagtg ctgaacagga tcaacaaaaa aggcaaaatc 1320
cacatggttc cctcaaaaat caaggatgtc ttcttcctcc gttttgccgt ctgttcacgt 1380
ttcacaaacg ccgaagatgt caaatactcg tggagtgaag tcaaagccac aacccaagaa 1440
atcaaaaaag agctagccaa gcagtga 1467
Claims (10)
1. The Bemisia tabaci MED cryptomorphic dopamine decarboxylase is characterized in that the amino acid sequence of the Bemisia tabaci MED cryptomorphic dopamine decarboxylase is shown as SEQ ID No. 1.
2. A Bemisia tabaci MED cryptogenic dopamine decarboxylase gene BtDDC, characterized in that it encodes the Bemisia tabaci MED cryptogenic dopamine decarboxylase of claim 1.
3. The bemisia MED cryptotrophic dopamine decarboxylase gene BtDDC according to claim 2, characterized in that its nucleotide sequence is as shown in SEQ ID No.2 or SEQ ID No. 3.
4. A recombinant expression vector comprising the bemisia tabaci MED cryptogenic dopamine decarboxylase gene BtDDC of claim 2.
5. A recombinant strain comprising the bemisia tabaci MED cryptotrophic dopamine decarboxylase gene BtDDC of claim 2.
6. The use of bemisia tabaci MED cryptomorphic dopamine decarboxylase gene BtDDC according to claim 2.
7. The use of the bemisia tabaci MED cryptotrophic dopamine decarboxylase gene BtDDC of claim 2 for reducing bemisia tabaci MED temperature tolerance.
8. A method of reducing the temperature tolerance of the bemisia tabaci cryptic MED, comprising the step of feeding the bemisia tabaci MED, the dsRNA of the bemisia tabaci MED cryptic dopamine decarboxylase gene BtDDC of claim 2.
9. The method of reducing the temperature tolerance of the bemisia tabaci cryptic MED of claim 8, wherein the dsRNA is amplified using the following primers:
BtDDC-F：5’-TAATACGACTCACTATAGGGCGCAGAACAAACCACAAT-3’；
BtDDC-R：5’-GCCAAAACCAGAGCAATC-3’。
10. an agent for controlling bemisia tabaci, comprising the dsRNA fragment of bemisia tabaci MED cryptogenic dopamine decarboxylase gene BtDDC of claim 2.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910901954 | 2019-09-24 | ||
| CN2019109019542 | 2019-09-24 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110669750A true CN110669750A (en) | 2020-01-10 |
| CN110669750B CN110669750B (en) | 2021-09-21 |
Family
ID=69084078
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911026516.2A Active CN110669750B (en) | 2019-09-24 | 2019-10-26 | Bemisia tabaci MED cryptomorphic dopamine decarboxylase, coding gene BtDDC and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110669750B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111763252A (en) * | 2020-07-29 | 2020-10-13 | 中国农业科学院植物保护研究所 | Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm2 and coding gene and application thereof |
| CN111909911A (en) * | 2020-08-17 | 2020-11-10 | 中国农业科学院植物保护研究所 | Bemisia tabaci MED cryptohistone acetyltransferase gene gcn5, application thereof and method for reducing temperature tolerance of Bemisia tabaci |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108588082A (en) * | 2017-05-27 | 2018-09-28 | 中国农业科学院植物保护研究所 | Hidden kind of high temperature tolerance related gene B tDnmt3 of Bemisia tabaci MED and its application |
| US20190059364A1 (en) * | 2017-08-31 | 2019-02-28 | Cornell University | RNAi FOR CONTROL OF PHLOEM SAP-FEEDING INSECTS IN CROP PLANTS |
-
2019
- 2019-10-26 CN CN201911026516.2A patent/CN110669750B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108588082A (en) * | 2017-05-27 | 2018-09-28 | 中国农业科学院植物保护研究所 | Hidden kind of high temperature tolerance related gene B tDnmt3 of Bemisia tabaci MED and its application |
| US20190059364A1 (en) * | 2017-08-31 | 2019-02-28 | Cornell University | RNAi FOR CONTROL OF PHLOEM SAP-FEEDING INSECTS IN CROP PLANTS |
Non-Patent Citations (2)
| Title |
|---|
| TIAN-MEI DAI ET AL.: "Thermal Discrimination and Transgenerational Temperature Response in Bemisia tabaci Mediterranean (Hemiptera: Aleyrodidae): Putative Involvement of the Thermo-Sensitive Receptor BtTRPA", 《ENVIRONMENTAL ENTOMOLOGY》 * |
| 申晓娜 等: "温度胁迫下烟粉虱MED隐种与亚洲Ⅱ3隐种三个抗寒基因表达模式的分析", 《植物保护》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111763252A (en) * | 2020-07-29 | 2020-10-13 | 中国农业科学院植物保护研究所 | Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm2 and coding gene and application thereof |
| CN111763252B (en) * | 2020-07-29 | 2022-03-25 | 中国农业科学院植物保护研究所 | Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm2 and coding gene and application thereof |
| CN111909911A (en) * | 2020-08-17 | 2020-11-10 | 中国农业科学院植物保护研究所 | Bemisia tabaci MED cryptohistone acetyltransferase gene gcn5, application thereof and method for reducing temperature tolerance of Bemisia tabaci |
| CN111909911B (en) * | 2020-08-17 | 2022-04-08 | 中国农业科学院植物保护研究所 | Bemisia tabaci MED cryptohistone acetyltransferase gene gcn5, application thereof and method for reducing temperature tolerance of Bemisia tabaci |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110669750B (en) | 2021-09-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110684756B (en) | Bemisia tabaci MED cryptophyte soluble trehalase, gene BtTreh1 and application thereof | |
| CN110669750B (en) | Bemisia tabaci MED cryptomorphic dopamine decarboxylase, coding gene BtDDC and application thereof | |
| CN101265294A (en) | Disease-resistant correlated wheat MYB albumen, coding gene and application thereof | |
| CN111763252B (en) | Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm2 and coding gene and application thereof | |
| CN108588082B (en) | Bemisia tabaci MED cryptomorphic high-temperature tolerance related gene BtDnmt3 and application thereof | |
| CN111763253B (en) | Chromatin remodeling factor ISWI, coding gene and role in diaphorina tabaci MED cryptic temperature tolerance | |
| CN111925429B (en) | Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm1 and coding gene application thereof | |
| CN101215570B (en) | Tea geometrid chitin synthetase gene chsa | |
| CN104745560A (en) | Eggplant chalcone synthase SmCHS1 protein and coding gene thereof | |
| CN110452290B (en) | Elicitor protein from Scopulariopsis fungus and application of coding gene thereof in biocontrol of vegetables | |
| CN110357949B (en) | Elicitor protein from cladocera endophytic fungus and coding gene thereof | |
| CN104745561B (en) | Eggplant enzyme, namely chalcone isomerase SmCHI albumen and its encoding gene | |
| CN103146722A (en) | Gene sequence of I-type tonoplast pyrophosphatase from ammopiptanthus nanus and cloning method of gene sequence | |
| CN103484466A (en) | Diamondback moth antibacterial peptide moricin, preparation method and application thereof | |
| CN114369616A (en) | Application of tomato SISPS gene in improving high temperature resistance of plants | |
| CN103911384A (en) | Gene for controlling Sclerotinia sclerotiorum (Lib.) de Bary of Brassica napus L. and use thereof | |
| CN108642063B (en) | Sisal hemp PGIP gene and application thereof | |
| CN106811453B (en) | African agapanthus cathepsin B, coding gene and probe thereof, and application of African agapanthus cathepsin B | |
| CN112391389B (en) | Migratory locust C-type scavenger receptor gene and targeting dsRNA and application thereof | |
| CN116926085B (en) | Passiflora edulis PeERF-2 gene and application thereof | |
| CN110157714A (en) | Safflower CtXTH1 gene, its coding protein and application | |
| CN108715851A (en) | A kind of Epinephelus coioides are ingested regulation and control related gene AgRP1 and its application | |
| CN115947810B (en) | Application of transcription factor HY5 in improving quality of dendrobium nobile and method for improving quality of dendrobium nobile | |
| CN109053870A (en) | Application of AtERF49 gene during plant responding high temperature stress | |
| CN114457085B (en) | Scylla paramamosain cap 'n' collar gene and application thereof in preparation of pathological detection diagnostic reagent |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |