CN103911384A - Gene for controlling Sclerotinia sclerotiorum (Lib.) de Bary of Brassica napus L. and use thereof - Google Patents

Abstract

The invention discloses a gene for controlling Sclerotinia sclerotiorum (Lib.) de Bary of Brassica napus L. and a use thereof and especially relates to isolation and cloning, functional verification and application of a gene BnWRKY33 for controlling Sclerotinia sclerotiorum (Lib.) de Bary of Brassica napus L. The gene BnWRKY33 has the function of controlling Sclerotinia sclerotiorum (Lib.) de Bary of crops. In Sclerotinia sclerotiorum (Lib.) de Bary treatment on Brassica napus L., a BnWRKY33 expression level is substantially improved. Through the gene engineering technology, a BnWRKY33 expression level is improved and Sclerotinia sclerotiorum (Lib.) de Bary of Brassica napus L. can be controlled and thus the gene provides an important application prospect for improving Sclerotinia sclerotiorum (Lib.) de Bary resistance and yields of Brassica napus L. and other crops.

Description

A kind of gene and application thereof of controlling sclerotinia rot of colza

Technical field

The present invention relates to a kind of gene and application thereof of controlling sclerotinia rot of colza, be specifically related to a kind of gene of controlling swede type rape sclerotium disease and contain this gene or its homogenic carrier, and relate to and utilize this gene or the application of the anti-sclerotium disease of its functional analogue regulating plant in agriculture production, belong to plant genetic engineering field.

Background technology

Rape, as a kind of important oil crops, occupies an important position in Chinese oil seed production.7,000,000 hectares of China's rape Annual planting areas (100,000,000 mu), account for global 1/3, occupy first place in the world, its rapeseed oil that produces accounts for the 40%(Shen Jin hero of the whole food plant supply of oil of China etc., china rape is produced and genetic improvement potentiality and brassinosteroid biosynthesis diesel oil development prospect [J], Hua Zhong Agriculture University's journal, 2007,26 6 phase of volume 894-899 pages).In addition, rapeseed oil is to be also suitable for production biofuel, and rape is the important source material crop as the shortage of solution global energy by European and American countries.Therefore rape is not only the main source of edible oil, is also the important source material crop that solves global energy shortage, has very important strategic position.

But the vegetable seed turnout of China only can meet domestic 2/3 consumers demand at present, a large amount of dependence on import.More than 600 ten thousand tons of China's imported plants oil in 2005, it is maximum in the world oil plant importer, along with the growth of the size of population and the raising of living standards of the people, by current industrial scale, breach will become larger (Wang Hanzhong, present situation, problem and the countermeasure [J] of Chinese oil plant industry development, Chinese oil crops journal, 2005,27 4 phase of volume 100-105 pages).Within considerable time at present and in the future, China all will face the severe situation of edible oil and fossil energy shortage.

Sclerotinia rot of colza ( sclerotinia sclerotiorum(Lib.) de Bary) be one of Main Factors of restriction China rape production.In the middle and lower reach of Yangtze River and southeastern coast rape main producing region, the incidence of sclerotinia rot of colza is very high, and production loss is up to more than 50%; There is area more than 7,000 ten thousand mu in the whole nation, production loss, up to 30%, reaches 50-80% when serious.At present the method for preventing and treating of sclerotinia rot of colza is mainly the seed selection of Techniques For Chemical Control and disease-resistant variety, but the problems such as chemical prevention exists that preventive effect is not high, cause of disease is difficult to eradicate, florescence spray medicine difficulty and pesticide residue, environmental pollution; Conventional breeding, because being difficult to find the shortcomings such as effective resistant material and speed are very slow, is also difficult to effectively solve disease-resistant problem.Thus, antagonism sclerotium disease rape variety carries out molecular improvement, and the anti-sclerotium disease kind of quickly breeding is the Critical policies that improves vegetable seed yield per unit.

Gene engineering method is by pre-designed target and plan, by genetic manipulation, and the technology of improving the breed on molecular level.Institute of Crop Science, Chinese Academy of Agricultural Science has found that a plant disease resistance genes is gene a or gene b, after gene a or gene b are modified to the resistance of the plant (application number: 201110048518.9,2011) that is significantly increased.And in host plant kind, being difficult to find the disease of antigen as this class of sclerotinia rot of colza, gene engineering method provides a kind of approach of dealing with problems.

WRKY transcription factor family is the Recent study important transcription factor of a class more widely, it is present in whole green plants system, coerce in reaction and Signal Transduction approach thereof and there is vital role (Asai T et al. at regulating plant biology, MAP kinase signalling cascade in Arabidopsis innate immunity[J], Nature, 2002,415 6875 phase of volume 977-983 pages). wRKY33transcription factor is the important a member in WRKY transcription factor family, contain two WRKY protein structure domains, belong to the 1st class WRKY albumen (Eulgem et a1., The WRKY superfamily of plant transcription factors[J], Trends Plant Sci, 2000,55 phase of volume 199-206 pages).There are some researches show atWRKY33transcription factor is that saprophytic form fungus resistant is necessary, can there is specific effect with (T) TGACC (A/T) sequence (W-box) in it, regulate in promotor containing the regulatory gene of W-box element or the expression of functional gene (Lippok B et a1., Expression of atWRKY33encoding a pathogen-or PAMP-responsive WRKY transcription factor is regulated by a composite DNA motif containing W box elements[J], Mol Plant Microbe Interact, 2007,20 4 phase of volume 420-429 pages).Institute of Botany, Chinese Academy of Sciences research finds, the polypeptide Glyma02g39870 of WRKY is salicylic synthetic in can regulating plant, thereby strengthens disease resistance (Jin Jingbo etc., 2012 of plant; Application number: 201010541600.0).Arabidopis thaliana atWRKY33pass through atMKS1with atMPK4form a complex body, in the time being subject to pathogenic bacteria infringement, atWRKY33with atMPK4from atMKS1middle disengaging, thereby cause the relevant gene of some hormones of downstream, as the expression of PR1, PDF1.2 etc. (Jin-Long Qiu et al, Arabidopsis MAP Kinase 4 regulates gene expression via transcription factor release in the nucleus[J], EMBO Journal, 2008,27 2221 pages of 16 phases 2214 of volume –).By Chinese cabbage brWRKY33cross after expression, Chinese cabbage presents resistance (Fan Rongwei etc., the Chinese cabbage certain to soft rot brWRKY33the clone of regulatory sequences and functional study thereof [J], Journal of Agricultural Biotechnology,, 18 4 phase of volume 670-675 pages in 2010).And for rape bnWRKY33effect, yet there are no the report of document and patent.In this research, we find, sclerotium disease is to after rape Stress treatment, bnWRKY33expression significantly improve, and then, swede type rape bnWRKY33transgenosis is crossed expression plant and is significantly strengthened resistance to sclerotinia sclerotiorum, and this result has important application prospect in enhancing sclerotinia rot of colza resistance and raising rapeseed oil output.

Summary of the invention

The object of the present invention is to provide a kind of gene of controlling sclerotium disease bnWRKY33.

A kind of gene that derives from rape bnWRKY33, its nucleotides sequence is classified as shown in SEQ ID NO.1.

The invention also discloses bnWRKY33the protein of genes encoding, its aminoacid sequence is shown in SEQ ID NO.2.

The invention also discloses with bnWRKY33the recombinant vectors 1300-35S-WRKY33-NOS of gene.Be purchased from prosperous biotech firm of Beijing ancient cooking vessel state at carrier pCAMBIA1300() EcoRI/KpnI restriction enzyme site place, upstream add CaMV 35S strong promoter, BamHI/HindIII restriction enzyme site place, its downstream adds CaMV Nos terminator, is transformed into carrier pCAMBIA1300-35S-Nos.And recombinant vectors 1300-35S-WRKY33-NOS be with bnWRKY33-F (5 '-ggtaccATGGCTGCTTCTTCCCTTC-3 '), bnWRKY33-R (5 '-ggatccTCAAGACAAAAACGAATCAAAG-3 ') goes out goal gene for primer amplification bnWRKY33and then according to gateway test kit (Gateway LR Clonase II Enzyme Mix, Invitrogen Corporation) operate, goal gene is cloned into the restriction enzyme site KpnI/BamHI of pCAMBIA1300-35S-Nos, obtain 1300-35S-WRKY33-NOS.

Described in having the present invention further provides bnWRKY33gene is at raising rape to the application in the resistance of sclerotium disease, and the present invention is reached and improved the resistance of swede type rape to dead volume nutritional type germ sclerotium disease by this gene of overexpression.Specific experiment technological step is as follows:

Create swede type rape cDNA library, from cDNA library, pcr amplification goes out and the cDNA of AtWRKY33 homology, check order, find that this cDNA clone is 1452bp, to its Blast Nucleotide comparison, find that the transcription factor WRKY33 of this cDNA sequence and Arabidopis thaliana, tobacco etc. has very high homology on nucleotide level at GenBank database.In order tentatively to survey the reaction that WRKY33 infects sclerotium disease, with sclerotinite (separating from Zhenjiang, Jiangsu rape) inoculation rape leaf, in the time of inoculation 0,12,24,36,48 h, then sampling extracts the total RNA of blade respectively, then uses real-time fluorescence quantitative PCR to detect bnWRKY33expression amount.Transform swede type rape with flower-dipping method with the Agrobacterium that carries 1300-35S-WRKY33-NOS carrier, adopt round pcr to identify transgenic line, identify by RT-round pcr bnWRKY33expression level is significantly higher than the mistake express transgenic strain of non-transgenic strain.The disease-resistant evaluation experimental of sclerotium disease shows, compared with non-transgenic strain, bnWRKY33cross express transgenic strain and significantly improve resistance to sclerotinia sclerotiorum.These results show bnWRKY33gene has important application prospect in enhancing sclerotinia rot of colza resistance.

Advantage of the present invention:

1. what in the present invention, adopt carrys out clone gene from rape cDNA library, and reliability is high, speed is fast, efficiency is high.

2. the pollen tube passage method that adopts in the present invention transforms rape, and speed is fast, cost is low, simple to operate.

3. what in the present invention, clone obtained bnWRKY33gene, for other crop disease-resistant breeding provides new GENE SOURCES; The resistance to sclerotinia sclerotiorum that how to improve other crop for research has the reference function of guidance.

4. the transgenic line that the present invention obtains, for the new rape variety of further cultivating height resistance to sclerotinia sclerotiorum provides new breeding material.

5. bnWRKY33 transgene rape plant significantly improve resistance to sclerotinia sclerotiorum, significant to the production of rape.

6. bnWRKY33be accredited as sclerotinia rot of colza resistant gene, to illustrating bnWRKY33the biological function of gene is significant.

7 .BnWRKY33the discovery of this sclerotinia rot of colza resistant gene, for excavating and the antibacterial core ospc gene of qualification crop, and the molecular mechanisms of action of the antibacterial core ospc gene of further investigated, there is important theory directive significance; All having important practical advice at breeding practice, breed improvement and the variety popularization of the anti-sclerotium disease of crop is worth.

brief description of the drawings:

Fig. 1 is bnWRKY33compare with the aminoacid sequence of other species WRKY33; Wherein being abbreviated as of each species: Bn( brassica napus): swede type rape; Bo( brassica oleracea): Cauliflower; Cr ( capsella rubella): shepherd's purse; AtPu-protein( thellungiella halophilaunnamed protein): little salt mustard; AtPu-protein( arabidopsis thalianaputative WRKY33): Arabidopis thaliana; Al( arabidopsis lyrata): south, remote mountains is situated between; RcTF( ricinus communistranscription factor): castor-oil plant; Jc( jatropha curcas): tung tree.What black region showed be identical amino acid, gray area demonstration be similar amino acid, WRKYGQK is WRKY structural domain, marks with square frame.

Fig. 2 is bnWRKY33the reaction that sclerotinite is infected.

Fig. 3 is that BnWRKY33 expression vector 1300-35S-WRKY33-NOS builds schematic diagram;

Fig. 4 is rape bnWRKY33the qualification of transgenic line; " just " be the PCR positive control of 1300-35S-WRKY33-NOS carrier.#1 is respectively 20 transgenic lines to #20." bear " as the contrast of non-transgenic wild-type.

Fig. 5 is that RT-PCR detection transgenosis is crossed in expression strain and non-transgenic wild-type strain bnWRKY33the comparison of expression level; WT is the contrast of non-transgenic wild-type; #6, #8, #10 are transgenic line independently.

Fig. 6 was the resistance to sclerotinia sclerotiorum comparison of express transgenic strain and non-transgenic wild-type strain; WT is the contrast of non-transgenic wild-type; #8 is transgenic line.

Fig. 7 was the comparison of express transgenic strain and the expansion of non-transgenic wild-type strain sclerotium disease scab; WT is the contrast of non-transgenic wild-type; #6, #8, #10 are transgenic line independently.

Embodiment

embodiment 1: bnWRKY33the separating clone of gene

(1) bnWRKY33the separation of gene and clone

So that two No. 9 kinds are as experiment material in swede type rape, growth conditions is: temperature is 20 ± 2 ° of C; Humidity is 60-90%; Photoperiod every day is dark 16 h of illumination 8 h; Intensity of illumination is 44 μ mol m ^{– 2}s ^{– 1}.

The synthetic employing UNIQ-10 pillar Trizol test kits (being purchased from the handsome Bioisystech Co., Ltd in Shanghai) of the extraction of the total RNA of rape leaf and cDNA, use DNase I (precious biotechnology (Dalian) company limited) to remove a small amount of DNA being mixed with in total RNA, finally detect the integrity of total RNA with 1% agarose gel electrophoresis.The synthetic of cDNA carries out according to the operation instructions of MMLV ThermoScript II test kit (Pu Luomaige (Beijing) Bioisystech Co., Ltd), 50 μ mol/L Oligo (dT) 18 for primer (Thermo Fisher Scientific).Then use primer bnWRKY33-F (5 '-ATGGCTGCTTCTTCCCTTC-3 ') and bnWRKY33-R (5 '-TCAAGACAAAAACGAATCAAAG-3 ') object that increases band, then enters PCR product cloning pMD18-T carrier (precious biotechnology (Dalian) company limited).Recovery, connection and the conversion of object fragment reclaimed test kits (Sangon Biotech (Shanghai) Co., Ltd.) with reference to UNIQ-10 pillar DNA glue and operated.Object fragment with the linked system of T carrier is: 4.6 μ L object fragments, 0.4 μ L pMD-18T carrier, 5 μ L Solution I (precious biotechnology (Dalian) company limited) are connected and spend the night at 16 DEG C.Be sent to Sangon Biotech's order-checking.

(2) bnWRKY33gene order structural analysis

Through order-checking, find the long 1452bp of being of nucleotide sequence of this gene, the open reading frame that contains a total length, use ClustalX (Thompson et al., 1997) program is carried out the comparison discovery of multiple amino acids sequence, and the WRKY33 of this object band and Arabidopis thaliana, Cauliflower, shepherd's purse, little salt mustard, south, remote mountains Jie, castor-oil plant and tung tree has very high homology (Fig. 1) on amino acid levels.Therefore, this gene is named as bnWRKY33.Be submitted to GenBank, accession number is KF712488. bnWRKY33contain two WRKY structural domains, on it, carry CX separately _4-5cX _22-23hX ₁the zinc fingers of H, belongs to the I class (Eulgem et al., The WRKY superfamily of plant transcription factors[J], Trends Plant Sci,, 55 phase of volume 199-206 pages in 2000) of WRKY transcription factor family.Comparison is found, these sequences all have the Key residues aspartic acid relevant to interactions between protein (Cheng et al. in the WRKY of C-terminal conservative domain site, Structural and Functional Analysis of VQ Motif-Containing Proteins in Arabidopsis as Interacting Proteins of WRKY Transcription Factors [J], Plant Physiology, 2012,159 2 phase of volume 810-825 pages).Simultaneously, at relatively conservative N-end, all contain 4-5 Serine-proline residue site, it may be potential map kinase phosphorylation site (Sharrocks et al., Docking domains and substrate-specificity determination for MAP kinases[J], Trends Biochem Sci, 2000,25 9 phase of volume 448-453 pages).Find by software PSORT II prediction, in these protein sequences, contain the nuclear localization signal of high conservative.

embodiment 2: bnWRKY33to the reaction of sclerotinite

(1) processing of sclerotinite

Brassica Napus Seedling when one heart stage (four leaf) the 3rd leaf is carried out to the inoculation processing of sclerotium disease pathogenic bacteria sclerotinite, before processing, plant is carried out to 23 DEG C of constant temperature culture 4～5 days, then blade is placed in dark surrounds moisturizing 24 h.Then inoculate with the mycelia piece of sclerotinite, contrast connects with sterile culture matrix.0 h, 12 h, 24 h, 36 h, 48 h samplings after inoculation respectively.

(2) extraction of swede type rape RNA

Utilize the handsome Bioisystech Co., Ltd in plant Trizol(Shanghai) its total RNA of reagent extracting.

(3) real-time quantitative PCR

Quantitative fluorescent PCR uses SYBR Green Realtime PCR Master Mix – Plus – test kit (precious biotechnology (Dalian) company limited), adopts b. napusUBC21(ubiquitin-conjugating enzyme 21), as internal standard gene, primer is synthesized by Sangon Biotech (Shanghai) Co., Ltd..The primer of UBC21 is F:5 '-CCTCTGCAGCCTCCTCAAGT-3 ' and 5 '-CATATCTCCCCTGTCTTGAAATGC-3 ', bnWRKY33the primer sequence of gene: 5 '-AGAGGACGGTTACAACTGGAGAAA-3 ' and 5 '-TGTCGGACAGCTTGGGAAAG-3 '.Fluorescent quantitation reaction system is 20 μ L: contain SYBR Mix 10 μ L, the each 0.8 μ L of forward and reverse primer (10 μ mol/L), the sterilized water that template 2 μ L and DEPC processed.Amplification condition is: 95 DEG C, and 30sec; Then 95 DEG C of 5s, 60 DEG C of 30 s, 72 DEG C of 27s, 40 circulations; Eachly be circulated in 72 DEG C of renaturation ends and carry out fluoroscopic examination.Reaction finishes to be first heated to 95 DEG C afterwards, is then down to 72 DEG C, is more slowly warming up to 95 DEG C, records the variation of fluorescent signal, draws the melting curve of amplified production.Every group of experiment all completes three biology and repeats, and each biology repeats at least to do three technology and repeats.Detect bnWRKY33the Expression of the blade 0-48 h inducing rape sclerotinite respectively changes.

First taking solubility curve as standard, the software 7300 System-SDSS hell that utilize ABI (Applied biosystems) model to carry for QPCR7300 instrument, optimize internal standard gene and goal gene PCR reaction conditions, make it amplified production special.This experiment is taking rape BnUBC21 as internal standard gene, measure respectively the Ct value of BnUBC21 and goal gene, get its mean value, obtain the DCt of goal gene to internal standard gene with comparing Ct method, then taking the blade of water treatment as obtain respectively the DDCt of other processing with reference to (converting 1 to by its value), finally estimate relative expression's value of goal gene by 2-DDCt, and obtain systematic error.

Result demonstration, in the time that sclerotinite is infected 24h, bnWRKY33transcriptional level raise 9.1 times, in the time that sclerotinite is infected 48h, bnWRKY33expression amount compared to do not inoculate sclerotinite bacterial strain improve 11 times (Fig. 2).Rape is described bnWRKY33infecting of sclerotinite had to significant response.

embodiment 3: cross and express bnWRKY33the acquisition of transgene rape plant

(1) plant expression vector construction

Design primer 5 '-gaattcTTAATTAAGAGCTCGCATGCC-3 ' and 5 '-ggtaccGTCCCCGTGTTCTCTCCAA-3 ', adopt the means of PCR to increase and obtain CaMV 35S fragment from pEGAD carrier (being purchased from precious biotechnology (Dalian) company limited), be then connected to the EcoRI/KpnI restriction enzyme site of pCAMBIA1300 carrier (being purchased from Beijing DingGuo ChangSheng Biology Technology Co., Ltd); Design primer 5 '-ggatccGAATTTCCCCGATCGTTCAA '-3 ' and 5 '-aagcttGATCTAGTAACATAGATGACACCGC-3 ' simultaneously, from pEGAD carrier, increase and obtain CaMV Nos fragment with PCR, be connected to pCAMBIA1300 carrier bamhI/ hindIII restriction enzyme site, obtains pCAMBIA1300-35S-Nos carrier.Restriction endonuclease EcoRI used, KpnI, bamhI and hindIII is all purchased from precious biotechnology (Dalian) company limited, and enzyme tangent condition is 37 DEG C of standing 12h.Then design primer 5 '-ggtaccATGGCTGCTTCTTCCCTTC-3 ' and 5 '-ggatccTCAAGACAAAAACGAATCAAAG-3 ', carry out pcr amplification taking swede type rape cDNA as template, obtaining required length is the object segment of 1473kb, be connected on the KpnI/BamHI restriction enzyme site of pCAMBIA1300-35S-Nos, reaction system is: I. KpnI 1 ul, 10*Hbuffer1ul, DNA 1ul (2ug), ddH20 7ul; II. BamHI 1 ul, 10*Kbuffer1ul, DNA 1ul (2ug), ddH20 7ul, is placed on 37 DEG C of standing 12h.Thereby be created to swede type rape bnWRKY33transgenic over expression carrier 1300-35S-WRKY33-NOS, contains the selection markers of moisture resistance mycin in its T-DNA district, bnWRKY33the promotor of overexpression is 35s promotor (Fig. 3).

(2) genetic transformation of rape

1300-35S-WRKY33-NOS is proceeded to Agrobacterium GV3101, contaminate rape flower three times, each five minutes.Dip-dye step is:

(1) in the test tube that contains corresponding antibiotic LB liquid nutrient medium, cultivate the Agrobacterium GV3101 that contains recombinant plasmid, then accessing in 10% ratio the triangular flask that contains corresponding antibiotic LB liquid nutrient medium, to make Agrobacterium nutrient solution final concentration be that OD600 is about 2.0 left and right.

(2) in substratum, add conversion damping fluid:

0.1% Silwet-77

2ng/L 6-BA

8mg/L Syringylethanone

(3) the whole bud part of not opening of rape is immersed in to 3-5min in Agrobacterium solution, shake makes bud fully contact agrobacterium liquid gently simultaneously.The bud soaking is inserted in to sheepskin paper bag 24h, to keep bud to there is higher humidity, avoids bud to be exposed to the sun in excessive sunlight, prevent that Agrobacterium from losing activity.

(4) every one day repeating step (3), and whole bud is enclosed within to 48h in sheepskin paper bag.

(5) soak after bow structure bundle, remove the sheepskin paper bag on inflorescence, shear the side shoot inflorescence newly bearing and the bud of newly sprouting through soaking its top of colored inflorescence, and utilize colored silk thread to carry out anchor line (string) mark to the inflorescence of contaminating Agrobacterium, the structure of different recombinant plasmids carries out label.

(6) plant is cultivated in normal pouring, and timing wipes out newborn side shoot inflorescence and newborn bud, until stop irrigating when seed maturity.Results dry seeds.Carry out the screening of transformant by the selective marker of carrying on recombinant plasmid.Filter out a large amount of transfer-gen plants by this method.

(3) transfer-gen plant qualification

The seed sprouting of results is first used the hygromycin selection of 25mg/L later, choose the plant of moisture resistance mycin, extract genome, identify with PCR, primer used is 5 '-CTTCGCAAGACCCTTCCTC-3 ' and 5 '-ggatccTCAAGACAAAAACGAATCAAAG-3 '.Contrast is wild-type non-transgenic plant (WT).

Detected result shows (Fig. 4), positive control and #1-#2, #4-#9, #11-#15, these 17 transformed plants of #17-#20 all can amplify the big or small electrophoretic band (1021bp) of expection, negative control does not have electrophoretic band, shows to have contained in transgene rape genome foreign gene DNA fragment.

(4) cross and express bnWRKY33the RT-PCR qualification of transgene rape

In order to determine bnWRKY33overexpression whether in rape, sampling RT-PCR method is analyzed, bnWRKY33amplimer be 5'AGAGGACGGTTACAACTGGAGAAA 3' and 5'TGTCGGACAGCTTGGGAAAG 3', reference gene is UBC21, its amplimer 5 '-CCTCTGCAGCCTCCTCAAGT-3 ' and 5 '-CATATCTCCCCTGTCTTGAAATGC-3 ', the raw work in Shanghai is synthetic.PCR program: 95 DEG C of denaturation 30S, then through 40 circulations (95 DEG C of 10s, 57 DEG C of 10s, 72 DEG C of 26s).

As shown in the figure, #6, #8, #10 strain bnWRKY33expression level is significantly higher than the contrast of not genetically modified wild-type, show #6, #8, #10 strain be three independently bnWRKY33cross express transgenic strain.

embodiment 4: bnWRKY33cross the evaluation of the anti-sclerotium disease of express transgenic rape

Get the turning of four one heart stages of leaf of above-mentioned PCR test positive bnWRKY33the 4th true leaf of positive plant carries out in vitro inoculation.Blade is cut and is placed in ceramic whiteware dish, each rotaring gene plant blade contrasts with non-transgenic and is placed side by side in a dish, blade lower berth one deck wet gauze, get the φ 5mm mycelia piece of fresh preparation, there is facing down of mycelia, be inoculated in the position that master pulse is departed from blade middle part slightly, two mycelia pieces of every leaf inoculation.Cover with Pan Kou with air-permeable envelope and be beneficial to moisturizing, then put 22 DEG C of dark culturing.

After mycelium culture, 12 h start observed and recorded mycelia a situation arises, and after cultivating, 24 h start observational data bacterial plaque increment, every 24 h once, until mycelia grows in vitro limb edge.

Isolated leaf inoculation qualification result shows that transfer-gen plant obviously strengthens resistance to sclerotinia sclerotiorum.As shown in Figure 6 and Figure 7, sclerotinite scab exists bnWRKY33cross growth area in express transgenic strain medium and small more a lot of than non-transgenic strain, the area of damaged tissue is also little.Can find according to the growth area of sclerotinite, soft addling extremely occurs in sclerotinite and inoculates after 24 h, and during 36-48 h growth rapidly, in the time of 48 h, its growth area reaches maximum.#6, these three independent strains of #8 and #10 keep identical trend always, and identical to the resistant phenotype of sclerotinite.In the time inoculating 48 hours, bnWRKY33transfer-gen plant #6, the half that #8 and #10 leaf spot lesion only contrast for wild-type.Aspect the velocity of diffusion of germ, can find that the velocity of diffusion of express transgenic strain will obviously delay the velocity of diffusion of scab in non-transgenic strain, in rape bnWRKY33there is the effect that improves resistance to sclerotinia sclerotiorum.

sequence table (SWQUENCE LISTING)

<110> Jiangsu University

Mono-kind of <120> controls gene and the application thereof of sclerotinia rot of colza

<160> 2

<170> PatentIn version 3.1

<210> 1

<211> 1452

<212> DNA

<213> swede type rape ( brassica napus)

<221> CDS

<222> （1）…（1452）

atggctgctt cttcccttct tcatatagac aataacacaa ccagacaaaa catgagtggt 60

tctgctaact ggtcacgaag atcatcagca tctttggaag atcttgagat cccaaacttt 120

agatcttttg ctccttcttc agtctcaatc tctccttcaa cttgtttcag tccctctgtt 180

ttcctcgatt cccctgcgtt tgttgcctcc tctgctaacg ttcttgcttc tccaaccaca 240

ggagctctta ttacaaacga aaacaatcag aaaaatgtag ctaaggaaga gaagaacaac 300

aacattaact acttcgattt ctcatttcag acacaatcat caacactttc tgcaccaaca 360

acaacaacaa cagcgacaaa cagttctatc tttcaatcac aggaacaaga aaggaagaac 420

cagtcagatc aaaaatggaa ccaaactcta aacaacagca acactcatca agctgtatct 480

tacaatgtaa gggagcaaag gaaaggagag gacggttaca actggagaaa gtacggtcag 540

aaacaggtga aagggagcga gaatcctcgg agttattaca agtgtacttt cccaagctgt 600

ccgacaaaga agaaagtcga gagatctttg gaaggacaga tcacggagat tgtctataag 660

ggaagccata accatcctaa acctcaatcc accagaagat catcttcttc ttcttcaaca 720

tttcactcgg ctgttttcaa tgccagcctt gataatagtt tcagtcactc tgattccctt 780

gcaatccaac aagatgataa cactacttct ggttctgtcg gagacgatga gtttgaacga 840

ggctcatcgg ttgtcagcag agaagaagaa tgtgggagtg aacctgaagc aaagagatgg 900

aaaggagaaa gtgaaacaaa cggtgggaat ggtaatggaa gcaagacagt gagagagcca 960

agaattgttg tgcagacaac aagtgatatc gacattcttg acgacggtta cagatggaga 1020

aaatacggcc aaaaagtcgt taaaggaaac ccaaacccaa gaagctacta caagtgcaca 1080

accttcggtt gtccagtgag aaaacatgtt gagagagcat cacatgatat gagagcagta 1140

atcacaacct atgaagggaa acacaaccac gatgtacctg cagctcgtgg tagcggatac 1200

accacaaacc gactggcaca agatccttct tcagcaccaa ttagaccaaa tgctattgct 1260

ggtcacccta gttacactac ttcttctcaa gcaccgtata cgcttcaaat gctgcaccaa 1320

aacaacaaca ctagcgccgg gtcttttggt tacgctacga acaataataa cttcctcggt 1380

ggtggtttct ctagagcaaa agaagaaccg aacgatgatt cttcctcttt ctttgattcg 1440

tttttgtctt ga 1452

<210> 2

<211> 483

<212> PRT

<213> swede type rape ( brassica napus)

<400> 2

Met Ala Ala Ser Ser Leu Leu His Ile Asp Asn Asn Thr Thr Arg

1 5 10 15

Gln Asn Met Ser Gly Ser Ala Asn Trp Ser Arg Arg Ser Ser Ala

20 25 30

Ser Leu Glu Asp Leu Glu Ile Pro Asn Phe Arg Ser Phe Ala Pro

35 40 45

Ser Ser Val Ser Ile Ser Pro Ser Thr Cys Phe Ser Pro Ser Val

50 55 60

Phe Leu Asp Ser Pro Ala Phe Val Ala Ser Ser Ala Asn Val Leu

65 70 75

Ala Ser Pro Thr Thr Gly Ala Leu Ile Thr Asn Glu Asn Asn Gln

80 85 90

Lys Asn Val Ala Lys Glu Glu Lys Asn Asn Asn Ile Asn Tyr Phe

95 100 105

Asp Phe Ser Phe Gln Thr Gln Ser Ser Thr Leu Ser Ala Pro Thr

110 115 120

Thr Thr Thr Thr Ala Thr Asn Ser Ser Ile Phe Gln Ser Gln Glu

125 130 135

Gln Glu Arg Lys Asn Gln Ser Asp Gln Lys Trp Asn Gln Thr Leu

140 145 150

Asn Asn Ser Asn Thr His Gln Ala Val Ser Tyr Asn Val Arg Glu

155 160 165

Gln Arg Lys Gly Glu Asp Gly Tyr Asn Trp Arg Lys Tyr Gly Gln

170 175 180

Lys Gln Val Lys Gly Ser Glu Asn Pro Arg Ser Tyr Tyr Lys Cys

185 190 195

Thr Phe Pro Ser Cys Pro Thr Lys Lys Lys Val Glu Arg Ser Leu

200 205 210

Glu Gly Gln Ile Thr Glu Ile Val Tyr Lys Gly Ser His Asn His

215 220 225

Pro Lys Pro Gln Ser Thr Arg Arg Ser Ser Ser Ser Ser Ser Thr

230 235 240

Phe His Ser Ala Val Phe Asn Ala Ser Leu Asp Asn Ser Phe Ser

245 250 250

His Ser Asp Ser Leu Ala Ile Gln Gln Asp Asp Asn Thr Thr Ser

255 260 265

Gly Ser Val Gly Asp Asp Glu Phe Glu Arg Gly Ser Ser Val Val

270 275 280

Ser Arg Glu Glu Glu Cys Gly Ser Glu Pro Glu Ala Lys Arg Trp

285 290 295

Lys Gly Glu Ser Glu Thr Asn Gly Gly Asn Gly Asn Gly Ser Lys

300 305 315

Thr Val Arg Glu Pro Arg Ile Val Val Gln Thr Thr Ser Asp Ile

320 325 330

Asp Ile Leu Asp Asp Gly Tyr Arg Trp Arg Lys Tyr Gly Gln Lys

335 340 345

Val Val Lys Gly Asn Pro Asn Pro Arg Ser Tyr Tyr Lys Cys Thr

350 355 360

Thr Phe Gly Cys Pro Val Arg Lys His Val Glu Arg Ala Ser His

365 370 375

Asp Met Arg Ala Val Ile Thr Thr Tyr Glu Gly Lys His Asn His

385 390 395

Asp Val Pro Ala Ala Arg Gly Ser Gly Tyr Thr Thr Asn Arg Leu

400 405 410

Ala Gln Asp Pro Ser Ser Ala Pro Ile Arg Pro Asn Ala Ile Ala

415 420 425

Gly His Pro Ser Tyr Thr Thr Ser Ser Gln Ala Pro Tyr Thr Leu

430 435 440

Gln Met Leu His Gln Asn Asn Asn Thr Ser Ala Gly Ser Phe Gly

445 450 455

Tyr Ala Thr Asn Asn Asn Asn Phe Leu Gly Gly Gly Phe Ser Arg

460 465 470

Ala Lys Glu Glu Pro Asn Asp Asp Ser Ser Ser Phe Phe Asp Ser

475 480 485

Phe Leu Ser

Claims (4)

1. control a gene for sclerotinia rot of colza, its sequence is nucleotide sequence shown in SEQ ID No.1.

2. control a protein for the genes encoding of sclerotinia rot of colza, its sequence is aminoacid sequence shown in SEQ ID No.2.

3. a recombinant vectors 1300-35S-WRKY33-NOS, it contains nucleotide sequence claimed in claim 1.

4. a kind of gene of controlling sclerotinia rot of colza according to claim 1, is characterized in that, this gene is in the application of controlling in sclerotinia rot of colza.