CN102757969A - Phosphorus transportprotein gene GmPT5 related to phosphorus transport of soybean nodulation and application thereof - Google Patents

Abstract

The invention discloses a phosphorus transportprotein gene GmPT5 related to phosphorus transport of soybean nodulation and application thereof. The phosphorus transportprotein gene GmPT5 related to the phosphorus transport of the soybean nodulation has a nucleotide sequence as shown in SEQ ID NO:1, and coded protein nucleotide sequence is shown as SEQ ID NO:2. The gene GmPT5 regulates and controls the phosphorus transport from a root part to the nodulation, furthermore, the overexpression of the gene is favorable for increasing the size of the soybean nodulation and the plant biomass as well as the nitrogen and phosphorus contents.

Description

A kind of phosphorus transporter protein gene GmPT5 and the application thereof relevant with the soybean nodulation phosphorus transporter

Technical field

The present invention relates to plant biotechnology field, be specifically related to the phosphorus transporter protein gene relevant with the soybean nodulation phosphorus transporter GmPT5And use.

Background technology

Soybean is important oil crops and protein source, can form the cogeneration system of mutual reciprocity and mutual benefit with the root nodule bacterium in the soil, and the nitrogen in the fixed air (N) is for host plant provides lasting nitrogenous source (Unkovich and Pate, 2000).Along with agricultural sustainable development and requirement on environmental protection, utilize the legume inoculation soybean to alleviate its dependence to nitrogenous fertilizer, to the scientic planting soybean, the protection environment is significant.Phosphorus (P) is the essential nutrient element of plant-growth, also is the higher element of demand in leguminous plants growth and the biological nitrogen fixation process.Nodule nitrogen fixation is the process of highly energy-consuming, and whenever fixing 1 mole N need consume 16 moles ATP, the formation of ATP closely related with the validity of phosphorus again (Schuize et al., 1999).But in 1,300,000,000 hectares of arable lands, the whole world, about 5.8 hundred million hectares of existence soil available phosphorus in various degree lacks (Ellingtoon, 1999; Vance, 2001; Lv Bin, 1987), the soil that China's Effective phosphorus lacks accounts for 2/3 (Liu Jianzhong, 1994) of total area under cultivation, has seriously limited growth and the output of plant.

Plant has formed the environment that a series of mechanism adapts to low-phosphorous soil in the evolution of long period of time process, comprising induce or the enhancement of plant body in phosphorus transporter albumen absorb available phosphorus efficiently.Research in the past shows that root nodule is one stronger " storehouse ", and is higher to the demand of phosphorus.The low-phosphorous formation that can suppress root nodule reduces its nitrogen fixing capacity.Up to the present; Have only one piece of literature research to report two sources that leguminous crop root nodule phosphorus obtains; Comprise from root to the phosphorus of root nodule running and root nodule from the direct phosphorus (Al-Niemi, 1998) of absorption of medium, but physiology that root nodule phosphorus obtains and molecule mechanism are still unclear.Plant phosphorus transporter albumen, especially the Pht1 family protein plays an important role in the absorption and transport of plant phosphorus, still, two approach that whether exist the protein mediated leguminous crop root nodule of phosphorus transporter phosphorus to obtain is not had relevant report at present as yet.

Therefore; Seek and participate in the key gene that regulating and controlling soybean root nodule phosphorus obtains; Not only can resolve the molecule mechanism of leguminous crop root nodule phosphorus absorption/running; And can be and cultivate the two efficient new soybean varieties of nitrogen phosphorus genetic resources is provided, the friendly type sustainable agriculture of development environment is had important theory and practice significance.

To above-mentioned research background, on the basis that the order-checking of soybean gene group is accomplished, the applicant confirms soybean Pht1 phosphorus transporter protein family member through the homology comparison.According to the quantitative PCR result, the present invention has cloned the high affine phosphorus transporter protein gene of one of them low-phosphorous inductive, root nodule specifically expressing GmPT5, prove GmPT5The albumen of genes encoding have with phosphorus from root to root nodule running, promote root nodule to grow and phosphorus absorbed, finally improve the function of nodule nitrogen fixation efficient and plant living weight.

Summary of the invention

The objective of the invention is deficiency, a kind of phosphorus transporter protein gene relevant with the soybean nodulation phosphorus transporter is provided to prior art GmPT5, another object of the present invention provides said gene encoded protein matter, and further purpose of the present invention provides the application of said gene and encoded protein matter thereof.

Above-mentioned purpose of the present invention is achieved through following technical scheme:

The phosphorus transporter protein gene relevant provided by the present invention with the soybean nodulation phosphorus transporter GmPT5, can derive from soybean, it comprises or has and is selected from following nucleotide sequence:

(1) nucleotide sequence shown in the SEQ ID NO:1;

(2) with the complementary sequence of the nucleotide sequence of (1) at the low nucleotide sequence that waits stringent condition, medium stringent condition, preferably high stringency condition to hybridize down;

(3) have at least 50%, at least 60%, at least 70%, at least 75% with the nucleotide sequence of (1), the nucleotide sequence of preferred at least 80%, more preferably at least 85%, preferred especially at least 90%, especially at least 95% or 98% or 99% identity;

(4) different nucleotide sequence with the protein of the nucleotide sequence coded same acid sequence of (1) but on sequence;

(5) nucleotide sequence of one of following aminoacid sequence of coding: the aminoacid sequence shown in the SEQ ID NO:2; Perhaps; Since one or more (for example 1-25 is individual, 1-20 is individual, 1-15,1-10; 1-5; 1-3) the substituting of amino-acid residue, disappearance and/or insert and with the aminoacid sequence different amino acid sequence shown in the SEQ ID NO:2, perhaps, have at least 50%, at least 60%, at least 70%, at least 75%, an aminoacid sequence of preferred at least 80%, more preferably at least 85%, more preferably at least 90%, especially at least 95% or 98% or 99% identity with the aminoacid sequence shown in the SEQ ID NO:2;

The active fragments of any one nucleotide sequence in (6) (1)-(5);

(7) with (1)-(5) any one nucleotide sequence complementary nucleotide sequence.

SEQ ID NO:1 is by 1566 based compositions, and its open reading frame (ORF) is the 1-1566 bit base, and coding has the aminoacid sequence of sequence SEQ ID NO:2, and the protein that said aminoacid sequence is formed is called GmPT5 albumen in the present invention.

The phosphorus transporter protein gene relevant provided by the invention with the soybean nodulation phosphorus transporter GmPT5Encoded protein matter, it comprises or has and is selected from following aminoacid sequence:

(1) aminoacid sequence shown in the SEQ ID NO:2;

(2) because the substituting of one or more (for example 1-25,1-20,1-15,1-10,1-5,1-3) amino-acid residue, disappearance and/or insert and with the aminoacid sequence different amino acid sequence shown in the SEQ ID NO:2;

(3) have at least 50%, at least 60%, at least 70%, at least 75% with the aminoacid sequence shown in the SEQ ID NO:2, the aminoacid sequence of preferred at least 80%, more preferably at least 85%, preferred especially at least 90%, especially at least 95% or 98% or 99% identity;

(4) active fragments of (1) or (2) or (3) said aminoacid sequence;

(5) polynucleotide molecule amino acid sequence coded of the present invention.

Gene provided by the invention GmPT5Can regulate and control to comprise the transhipment of phosphorus in its transgenic organism with protein.

It is above-mentioned to increase GmPT5Full length gene or its arbitrary segmental primer are to belonging to protection scope of the present invention.

The present invention also provide contain above-mentioned GmPT5Expression carrier, available existing plant expression vector construction contains GmPT5The recombinant expression vector of gene.Said plant expression vector comprises double base agrobacterium vector etc.; (CAMBIA, Australia are so kind as to give by Liu Yaoguang researcher laboratory like pCAMBIA3301; Http:// www.cambia.org/), pYLRNAi (is so kind as to give by Liu Yaoguang researcher laboratory specific descriptions are seen:; Specific descriptions are seen document: Hu Xuxia and Liu Yaoguang, 2006, Molecular Plant Breeding) or other plant expression vector of deriving.

The present invention also provides a kind of genetic engineering bacterium, and it contains above-mentioned expression vector.

The invention still further relates to cell, it comprises of the present invention GmPT5Gene or recombinant vectors.Said cell can be a vegetable cell, for example leguminous plants cell, perhaps microorganism cells, for example bacterium or fungal cell, for example yeast cell.Said cell can be isolating, that exsomatize, a part that cultivate or plant.

The invention still further relates to plant or plant part, vegetable material, plant seed, it comprises cell of the present invention.Said plant can be a leguminous plants; Soybean for example; Also can be other plant, for example monocotyledons such as paddy rice, wheat, barley, corn, Chinese sorghum, sugarcane, oat or rye etc., perhaps other dicotyledonss such as tobacco, Sunflower Receptacle, beet, capsicum, yam, tomato etc.Also relate to transgenic seed from said plant.

The invention still further relates to the method for producing plant, this method comprises: from vegetable cell regeneration of transgenic plant of the present invention, perhaps with plant of the present invention and another plant hybridization.

The invention still further relates to the plant that method of the present invention is produced.

The invention still further relates to of the present invention GmPT5Purposes in the transhipment of gene or recombinant vectors phosphorus in the regulation and control plant materials comprises that preparation transgenic plant and preparation promote the preparation of plant phosphorus transporter.

The invention still further relates to the method for the transhipment of phosphorus in the regulation and control plant materials, it is of the present invention that this method comprises that preparation contains GmPT5The plant of gene or recombinant vectors, for example, said method can comprise from vegetable cell regeneration of transgenic plant of the present invention or with plant of the present invention and another plant hybridization.

A preferred embodiment provided by the present invention is with said gene GmPT5Import in the soybean, obtain the transgenic composite plant; Root nodule size, root nodule number, plant living weight and nitrogen, phosphorus content etc. are higher than said purpose control plant behind the said transgenic composite plant inoculation root nodule bacterium.

Said gene GmPT5Can for example import recipient plant through said recombinant expression vector.

Carry gene of the present invention GmPT5Plant expression vector can be transformed into through for example agriculture bacillus mediated hypocotyl conversion method soya cells or the tissue in.

Advantage of the present invention and effect:

1. gene GmPT5Though by clone and report, its biological function aspect leguminous crop phosphorus absorption running is also unclear, especially aspect the absorption running of root nodule phosphorus in Arabidopis thaliana and paddy rice for affiliated phosphorus transporter protein family.Cloned genes of the present invention GmPT5Transhipment to soybean nodulation phosphorus has remarkable influence, and this has significance to the molecular mechanism research of illustrating biological function and the root nodule phosphorus of phosphorus transporter protein gene in leguminous crop root nodule phosphorus acquisition process and absorbing running.

2. gene GmPT5Not only influenced phosphorus from the transhipment of soybean root to root nodule, this gene of overexpression has also increased soybean nodulation size (Fig. 5 D), and for example under the competent situation of phosphorus, the root nodule size of transgenic line contrasts apparently higher than empty carrier; The functional study of this gene has far-reaching Research Significance for the molecule mechanism of resolving leguminous crop root nodule phosphorus acquiring way.

3. the compound plant overexpression of the transgenic of this gene strain system contrasts with contrast, and all significantly increases of plant nitrogen, phosphorus content (Fig. 5 B, C); Gene is described GmPT5Plant phosphorus element absorbs efficient and cogeneration system nitrogen-fixing efficiency effect is obvious to improving, and improves gene through genetic engineering technique GmPT5Expression amount can improve phosphorus efficient and nitrogen-fixing efficiency simultaneously, thereby reach the purpose that the fertile fecund of Shaoshi goes out.

Description of drawings

Fig. 1: the design sketch in the field test behind the effective root nodule bacterium of soybean inoculation.

Fig. 2: phosphorus is supplied with the influence that root nodule is grown in the water culture experiment.

Fig. 3: yeast complementary assay.

Fig. 4: GmPT5The Histochemical localization of gene.

Fig. 5: GmPT5The influence that expression of gene is grown to plant strain growth, nitrogen, phosphorus content and root nodule.

Fig. 6: GmPT5The influence that gene pairs soybean nodulation phosphorus obtains two approach.

Embodiment

Among the following embodiment,, be ordinary method like no specified otherwise.

Embodiment 1

GmPT5The clone of gene

1, gene ( GmPT5) the clone

In the soybean gene group DB of having announced, through the homology comparison, dope soybean Pht1 phosphorus transporter protein family and have 14 members, through quantitative PCR technique, confirm GmPT5Gene is the high affine phosphorus transporter protein gene of low-phosphorous inductive, root nodule specifically expressing.Extract the total RNA of phosphorus efficiency genotype HN98 soybean nodulation according to the TRIzol single stage method, obtain full genome cDNA as template with reverse transcription, with upstream primer:

5’-ATGGGGAAGGAGCAAGTTCAGG-3’ (SEQ ID NO:3)

And downstream primer:

5’- TTACACCTTGGTCTCCTCTTCTTG-3’ (SEQ ID NO:4)

Be primer, carry out pcr amplification, the PCR reaction system is 50 μ L, comprises each 1 μ L of the forward and reverse primer of 10 μ M, 10 * PCR buffer, 5 μ L, and 2.5 mM dNTP, 8 μ L, Taq enzyme 0.3 μ L, cDNA template amount 1 μ L is then with sterilization ddH ₂O supplies 50 μ L.The PCR response procedures is: 94 ℃ 1 minute; 94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 2 minutes, 30 circulations of increasing; 72 ℃ were extended 10 minutes.Amplification PCR products, forms images at gel imaging system behind Golden view nucleic acid staining dye through 1% agarose gel electrophoresis.Dna gel reclaims test kit and reclaims the PCR product.Recovery obtains the PCR product cloning, and (TAKARA company, specific descriptions are seen: the evaluation of http://www.takara.com.cn/) checking order on the carrier shows that PCR product fragment has the nucleotide sequence of SEQ ID NO:1, with this fragment called after to pMD18-T GmPT5

2, the structure of carrier

The structure of yeast vector: with soybean nodulation cDNA is template, obtains through pcr amplification GmPT5The ORF fragment, use upper reaches special primer

5’-ATATGCGGCCGCATGGGGAAGGAGCAAGTTCAGG-3’ (SEQ ID NO:5)

With the downstream special primer

5’-GCGCGGATCCTTACACCTTGGTCTCCTCTTCTTG-3’ (SEQ ID NO:6)

Amplification GmPT5Total length ORF fragment; The fragment Yeast expression carrier p112A1NE that packs into (is so kind as to give by the bright phoenix associate professor of life science institute of Fudan University; Specific descriptions are seen document: Ming et al., 2006, Science in China Series C:Life Sciences); Obtain the Yp112-GmPT5 expression vector of successful connection, transform the transformant that obtains Yp112-GmPT5 through zymic.

The structure of promoter Analysis expression vector: according to ordinary method, extract soybean leaves or root genomic dna, DNA is a template with the soybean gene group, uses upper reaches special primer

5’-ATGCTCTAGAGCCTACTGCTGCCTGTGAAT-3’ (SEQ ID NO:7)

With the downstream special primer

5’-ATGCCCATGGCTTGCTCCTTCCCCATCGCT-3’ (SEQ ID NO:8)

Amplification GmPT5Promotor 2496 bp fragments, after PCR fragment recovery order-checking is errorless, through XbaI with NcoI will to after reclaiming fragment and purpose carrier and carrying out double digestion GmPT5Gene is connected to purpose carrier pCAMBIA3301.

The structure of overexpression carrier: with soybean nodulation cDNA is template, with upper reaches special primer 5 '-TGATAAAGCTTATGGGGAAGGAGCAAGTTCAGG-3 ' (SEQ ID NO:9)

With the downstream special primer

5’-ATTAAACGCGTTTACACCTTGGTCTCCTCTTCTTG-3’ (SEQ ID NO:10)

Amplification GmPT5ORF 1566 bp fragments, after PCR fragment recovery order-checking is errorless, through HindIII with MluAfter I is carried out double digestion to fragment and purpose carrier, will GmPT5Gene is connected to purpose carrier pYLRNAi.

The structure of interference vector: with soybean nodulation cDNA is template, uses upper reaches special primer

5’-TCAAGGATCCCCAAGGAGTTCATGAGTCGCCATG-3’ (SEQ ID NO:11)

With the downstream special primer

5’-TGCCAAGCTTTGGCATTAGGCCCAAAGTTTGCA-3’ (SEQ ID NO:12)

The 411 bp purpose fragments that increase are used BamHI with HindIII enzyme is respectively cut PCR product and purpose carrier pYLRNAi; Reclaim connection carrier behind the 411 bp product purifications, transformed into escherichia coli Top10F ' (is so kind as to give by Liu Yaoguang researcher laboratory, specifically describes and see document: Wang et al.; 2006; The Plant Cell), check order errorless after, use upper reaches special primer

5’-ATGCCTGCAGCCAGTGATCATAGGGAATGGCAA-3’ (SEQ ID NO:13)

With the downstream special primer

5’-ATGCACGCGTGAACATGGAGATTCAAGCCGAG-3’ (SEQ ID NO:14)

The reverse fragment that increases is used PstI with MluThe reverse fragment of I double digestion with have the segmental carrier of forward after; Reverse fragment is connected to includes among the segmental purpose carrier of the forward pYLRNAi; Transformed into escherichia coli DH10B, the errorless back transforming agrobacterium rhizogenes K599 that checks order (is so kind as to give by University of Queensland pulse family comprehensive rearch centre, is stored in root system biological study centralab of Agricultural University Of South China; Specific descriptions are seen document Kereszt A; Et al., 2007), be used for agriculture bacillus mediated soybean hypocotyl injection and carry out the hair root conversion.

3, yeast complementary assay

The proteic two mutants yeast strain of application disappearance high-affinity phosphorus transporter MB192 ( MATa pho3-1 Dpho84::HIS3 ade2 leu2-3.112 his3-532 trp1-289 ura3-1.2 can1) carry out functional study; This mutants which had is provided by the bright phoenix professor of life science institute of Fudan University; Accomplish by Agricultural University Of Nanjing Xu Guohua professor laboratory, mainly comprise covering and the ri of Yp112-GmPT5 transformant two mutants MB192 phosphorus absorptive function ³³P marker determination yeast is to the tests such as uptake rate of phosphorus.Test-results is seen Fig. 3, wherein A: the yeast growth verification experimental verification GmPT5Gene pairs lacks the complementation of the plain absorptive function of the proteic yeast mutants MB192 of the affine phosphorus transporter of endogenous height (contrast) phosphorus.Yeast count is 6X10 during original volume ⁵, successively after 10 times of dilutions of equal-volume respectively equivalent be inoculated in the 100 and 50 μ M Pi concentration YNB substratum, cultivated 3 days for 30 ℃; B: use isotropic substance ³³P measures yeast transformant Yp112-GmPT5 to the plain speed (pH 6.0) that absorbs of phosphorus.

4, GmPT5The tissue expression positioning analysis

Behind agriculture bacillus mediated soybean hypocotyl injection conversion method acquisition transgenic hairly root; Main root is cut, kept the hairly root that comes out from the callus director, hairly root is immersed in the root nodule bacterium bacterium liquid moves into water planting after 30 minutes; Mill water culture nutrient solution is handled for low nitrogen (100 μ mol/L) entirely; Low-phosphorous if (5 μ mol/L) and normal two phosphorus levels of phosphorus (250 μ mol/L), root growth is after one week, when beginning to have root nodule to occur; The lateral root of getting all hair roots of callus in the strain (general about 5) carries out GUS dyeing; Remove not genetically modified hairly root, inoculate and won root in back 15 days, 30 days respectively, root nodule carries out the tissue positioned analysis that gus reporter gene is expressed, confirm GmPT5Gene is at the tissue expression position of soybean nodulation growth different steps, and the tissue positioned of genetic expression can further be observed through paraffin section.The result sees Fig. 4, and wherein A-C is contrast: the zero load that 35S promoter drives, and A, B are root, C is a root nodule; D-I does GmPT5pro:: GUS root (do not inoculate root nodule bacterium, D-F) with root nodule in (inoculation root nodule bacterium after, expression G-I).D: the tip of a root; E and F: ripe root rip cutting and crosscut.G: root nodule forms early stage root nodule and root junction (inoculating back 15 days); H and I are respectively median size and mature nodule (inoculating back 30 days).Transform unloaded adjoining tree with GmPT5The pro::GUS transfer-gen plant is that low-phosphorous low nitrogen nutrition liquid is handled entirely.Remove A among the figure, the D scale is 500 μ m and F, and the G scale is outside the 20 μ m, and scale is 100 μ m among all the other figure.

Embodiment 2

The research of the compound plant of transgenic

1, the acquisition of the compound plant of transgenic

The expression vector plasmid that builds is converted among the Agrobacterium rhizogenes K599; Adopt agriculture bacillus mediated soybean hypocotyl injection to obtain the compound plant of transgenic (root is that transgenic hairly root, overground part are non-transgenic), follow-up phenotypic evaluation is all used this strain system.Empty carrier contrast: according to the method described above, expression vector pYLRNAi with the quadrat method soybean transformation, is obtained to change pYLRNAi unloaded contrast strain system (CK).

2, the detection of the compound plant of transgenic

Inoculate back 15 days, take root sample extraction RNA earlier, transgenic hair root selection markers is a Totomycin, available hygromycin gene ( Hyg) detect the true and false of hair root; Inoculate after 40 days, when root nodule is in the ripening stage, win two root nodules, extract RNA, further cross the effect of expressing and interfering with quantitative PCR detection, in the quantitative PCR test with the soybean house-keeping gene TefS1Be reference gene, relative expression quantity is a goal gene GmPT5Expression amount and the ratio of house-keeping gene expression amount.

The quantitative PCR step:

1) HygThe primer of gene is:

Hyg F: 5’-GCTGTTATGCGGCCATTGTC-3’ (SEQ ID NO:15)

Hyg R: 5’-GACGTCTGTCGAGAAGTTTC-3’ (SEQ ID NO:16)

TefS1The primer of gene is:

TefS1 F: 5’- TGCAAAGGAGGCTGCTAACT -3’ (SEQ ID NO:17)

TefS1 R: 5’- CAGCATCACCGTTCTTCAAA -3’ (SEQ ID NO:18)

GmPT5The primer of gene is:

GmPT5 F: 5’- GAACACTTTCAGGGCAACTC -3’ (SEQ ID NO:19)

GmPT5 R: 5’- GTCATCACAGTCTTTGCATCG -3’ (SEQ ID NO:20)

2) reaction system:

2×SYBR Green PCR master mix： 10 μL

Upstream primer. (10 mol/L): 0.6 μ L

Downstream primer. (10 mol/L): 0.6 μ L

Mili-Q water: mend to 20 μ L

The cDNA:2 μ L of dilution

3) reaction conditions:

Detection and quantitative PCR through resistant gene confirm to obtain effective different transgenic line.

3, the compound plant phenotype analytical of transgenic

1) plant fresh weight and root nodule growth indexes are measured

The different transgenic lines of results inoculation root nodule bacterium after 50 days are measured the relevant physiological index, and comprising: plant living weight, root nodule fresh weight, root nodule number, root nodule size etc., wherein the root nodule size is the fresh weight (ratio of root nodule fresh weight and root nodule number) of single root nodule.Living weight: one of percentage balance weighing overground part and root sample fresh weight, the root nodule of root taken counting after, take by weighing fresh weight with ten thousand/balance, all samples completes at 105 ℃ of baking ovens and was placed on 75 ℃ in 30 minutes and dries to constant weight, takes by weighing dry weight.

2) nitrogen, phosphorus content are measured

Earlier plant each several part sample is pulverized, used H ₂SO ₄-H ₂O ₂Method disappears and boils, and draws to disappear by a certain percentage then and boils the mensuration that liquid carries out nitrogen and phosphorus.Nitrogen concentration is measured with 2300 nitrogen auto analyzers (Kjedahl2300, FOSS, Switzerland), and phosphorus concentration is measured with molybdenum antimony resistance colorimetric method (Murphy and Riley, 1963).

Nutrient content in plant shows that with unit plant nitrogen, phosphorus scale calculation formula is:

Nitrogen content (mg/plant)=nitrogen concentration (mg/g) * plant dry weight (g/plant)

Phosphorus content (mg/plant)=phosphorus concentration (mg/g) * plant dry weight (g/plant)

Fig. 5 does GmPT5The influence that expression of gene is grown to plant strain growth, nitrogen, phosphorus content and root nodule.A wherein: plant fresh weight; B: plant nitrogen content; C: plant phosphorus content; D: root nodule number and root nodule size.(low-phosphorous: 5 μ M P behind the different transgenic line inoculation root nodule bacterium in different phosphate concentration; High phosphorus: 250 μ M P) grew 50 days in the low nitrogen nutrition liquid.CK transforms unloaded contrast strain system; OX, GmPT5Overexpression strain system; RNAi, GmPT5Interference strain system.Data are the MV and the standard error of 4 coefficient certificates of same transgenic plant among the figure.Asterisk is represented the significance of same index between OX or RNAi strain system and contrast CK strain system relatively: * representes level of signification P<0.05 the time, significant difference; * representes level of signification 0. 001< P<0.01 the time, the significance of difference between significantly with extremely remarkable between; * * representes level of signification P<0.001 the time, difference is extremely remarkable; Ns representes that difference is not remarkable.

4, the compound plant root nodule of transgenic phosphorus absorption test ( ³³The P isotope-labelling method)

1) root segment absorption [ ³³P] test of Pi isotropic substance

Different phosphate concentration was handled after 50 days GmPT5Gene overexpression, contrast, three kinds of transgenic lines of interference, keeping each strain is the root nodule (preferably near root top) that similar number is arranged on the root segment, only supplies with bottom certain-length (6 cm) root segment (not having root nodule) ³³The nutritive medium of P mark (adds 10 μ Ci in the 100 mL nutritive mediums ³³P isotropic substance stoste), guarantee not directly contact of root nodule ³³The nutritive medium of P mark (shown in Fig. 6 B).After absorbing 8 hours, put into the nutritive medium soaking and washing of the identical phosphorus concentration of cup to root system, blot, repeat about 3 times, to scavenging solution, almost detect less than till the radioactivity with thieving paper.Plant is fixed on the cardboard with transparent adhesive tape, behind 105 ℃ of 30 min that complete, carries out radioautograph after living with the compressing tablet lid, develop a film after 3 days.After developing a film sample is divided into the (contact of three parts ³³The absorption root segment of P mark nutritive medium, top root segment, root nodule); After taking by weighing weight separately; Shred and put into 5 mL centrifuge tubes; Add 4 mL scintillation solutions, put into white scintillation vial, place the cpm value (counts of unit time) of back of spending the night with LS6500 Multi-purpose Scintillation Counter BECKMAN COULTER scintillation counter (Agricultural University Of Nanjing) working sample.

2) root nodule is stripped absorbs [ ³³P] the Pi test

Low-phosphorous processing is after 50 days GmPT5Gene overexpression, contrast, three kinds of transgenic lines of interference are respectively won 3 root nodules, take by weighing fresh weight after, put into certain volume ³³The different phosphate concentration nutritive medium of P mark, ³³The P mark intensity is 10 μ Ci per μ mol PO ₄, root nodule and root point of contact wound are sealed with silicone grease and are avoided liquid directly to get into from wound, handle after 2 hours; Put into cup to root nodule with identical phosphorus concentration nutritive medium soaking and washing; Blot with thieving paper, repeat about 3 times, almost detect less than till the radioactivity to scavenging solution.After the root nodule grinding; Transfer in the 5 mL centrifuge tubes; Add 4 mL scintillation solutions; Put into white scintillation vial, place the cpm value (counts of unit time) of back of spending the night with LS6500 Multi-purpose Scintillation Counter BECKMAN COULTER scintillation counter (Agricultural University Of Nanjing) working sample.

Fig. 6 does GmPT5The influence that gene pairs soybean nodulation phosphorus obtains two approach.A wherein: the soybean root segment [ ³³P] Pi absorption test operational illustration yet, 6cm directly contacts ³³The root segment of P mark nutritive medium is as absorbing root segment; Arrow is represented the position of root nodule in the root segment of top, and top root segment and root nodule do not contact ³³The nutritive medium of P mark; B: GmPT5Different transgenic lines ³³P root segment absorption test; C: GmPT5Different transgenic line root nodules exsomatize ³³P isotropic substance absorption test.CK transforms unloaded contrast strain system; OX, GmPT5Overexpression strain system; RNAi, GmPT5Interference strain system.Cpm representes to measure the cpm number of times that obtains through liquid scintillation instrument.Data are the MV and the standard error of 4 coefficient certificates of same transgenic plant among the figure.Asterisk is represented the significance of same index between OX or RNAi strain system and contrast CK strain system relatively: * representes level of signification P<0.05 the time, significant difference; * representes level of signification 0. 001< P<0.01 the time, the significance of difference between significantly with extremely remarkable between; * * representes level of signification P<0.001 the time, difference is extremely remarkable; Ns representes that difference is not remarkable.

5, field test and water culture experiment

Fig. 1 is the design sketch behind the effective root nodule bacterium of soybean inoculation in the field test.A: field test soybean inoculation root nodule bacterium are whole upgrowth situation figure after 50 days; B: root nodule fresh weight and grain yield; C: plant nitrogen and phosphorus content; 5 repetitions are established in each processing in the test, and each repeats to comprise 3 strain soybean.Pillar is respectively handled the MV and the standard error of 5 repeating datas among the figure for test.Asterisk represent same index do not inoculate root nodule bacterium handle (R) handle with the inoculation root nodule bacterium (+pass through R) time tSignificance of difference result is relatively carried out in-test, and * representes level of signification P<0.05 the time, significant difference; * representes level of signification 0.001< P<0.01 the time, the significance of difference is between remarkable and extremely remarkable asking; * * representes level of signification P<0.001 the time, difference is extremely remarkable.

Fig. 2 supplies with the influence that root nodule is grown for phosphorus in the water culture experiment.A: be high low-phosphorous processing soybean nodulation growing state (inoculating back 50 days) under the low nitrogen situation shown in the figure; B: root nodule number and root nodule size; C: plant fresh weight and phosphorus content; D: plant leaf, root and root nodule titanium pigment concentration.In the nutrient solution that different phosphate concentration is handled, grew 50 days behind the soybean seedling inoculation root nodule bacterium, wherein low-phosphorous is 5 μ M P, and high phosphorus is 250 μ M P.4 repetitions are established in each processing in the test, and pillar is respectively handled the MV and the standard error of 4 repeating datas among the figure for test.Asterisk representes that same index carries out the result that the significance of difference compares through the t-test when handling in that height is low-phosphorous among B figure and the C figure, and * representes level of signification P<0.05 the time, significant difference; * representes level of signification 0. 001< P<0. 01 o'clock, the significance of difference between significantly with extremely remarkable between; * * representes level of signification P<0.001 the time, difference is extremely remarkable.The othernesses of letter representation phosphorus concentration between different tissues different among the D figure compare, and upper and lower case letter is represented the comparable situation under the high low-phosphorous processing respectively.

SEQUENCE LISTING

< 110>Agricultural University Of South China

< 120>a kind of phosphorus transporter protein gene GmPT5 and the application thereof relevant with the soybean nodulation phosphorus transporter

<130>

<160> 20

<170> PatentIn version 3.2

<210> 1

<211> 1566

<212> DNA

< 213>artificial sequence

<400> 1

atggggaagg agcaagttca ggtgctgaat gccctggacg tggcaaagac acaatggtat 60

catttcacag caatcatcat tgctggaatg ggcttcttca ctgatgctta tgatctgttc 120

tgtatatcac tagtcacaaa gctacttggt cgcatttact accacgttga tggggctgca 180

aagcctggtt cattgcctcc caatgtgtca gctgcagtta atggtgtagc ttttgttgga 240

acactttcag ggcaactctt ctttggctgg ctcggcgaca aaatgggccg aaaaaaggtc 300

tatggcatga cccttgcgct tatggttata gcttccattg cttcgggtct atccttcgga 360

cacgatgcaa agactgtgat gacaactcta tgcttctttc gcttctggct tggttttggc 420

attggtggag actaccctct ttcggccacc ataatgtctg agtattctaa taagaagact 480

cgaggtgcct ttatagctgc agtgtttgcc atgcagggtt ttggaatttt ggcaggaggt 540

gtgtttgcta ttatcatagc atctgtgttc aagtccaagt ttgattctcc accatacgag 600

gttgatccgt tgggttcgac tgttccacaa gcagactatg tttggaggat aattctcatg 660

tttggagcaa ttcctgctgc aatgacttac tactcgcgat ccaagatgcc agaaaccgct 720

cgttacactg ccttggttgc caagaatatg gagaaggctg cagcagatat gtctaaggtt 780

atgaacatgg agattcaagc cgagccaaag aaggaggagg aggcacaagc taaatcatat 840

ggattgttct ccaaggagtt catgagtcgc catggactgc atctgctcgg aacaacaagc 900

acatggttct tgcttgacat tgcattctac agccaaaatc ttttccagaa ggatatcttc 960

agcgcaattg gttggattcc tccggcaaaa acaatgaatg ctcttgagga ggttttcttt 1020

attgcaaggg ctcaaactct tattgctcta tgcagtacag ttcctggata ctggttcact 1080

gtggccttca ttgataggat aggaagattc gccatccaat tgatgggatt cttctttatg 1140

actatcttca tgtttgctct tgccattccc tatgatcact ggactcttag ggagaacaga 1200

attggatttg tggtcattta ctctctcaca ttcttctttg caaactttgg gcctaatgcc 1260

accacatttg ttgtgccggc ggagattttc ccagctagat ttagatccac ttgccatgga 1320

atatcttcag catctgggaa gctcggggct atggttggtg cattcgggtt tttatatttg 1380

gcacagaatc aggacccgag caaagcagat gcagggtacc ctgcaggtat tggtgtgagg 1440

aattcactgc ttgtgttggg tgtgattaac attttaggct tcatgttcac tttcttggtg 1500

cctgaggcca agggtagatc cttggaggag atttcgggag agcaagaaga ggagaccaag 1560

gtgtaa 1566

<210> 2

<211> 521

<212> PRT

< 213>artificial sequence

<400> 2

Met Gly Lys Glu Gln Val Gln Val Leu Asn Ala Leu Asp Val Ala Lys

1 5 10 15

Thr Gln Trp Tyr His Phe Thr Ala Ile Ile Ile Ala Gly Met Gly Phe

20 25 30

Phe Thr Asp Ala Tyr Asp Leu Phe Cys Ile Ser Leu Val Thr Lys Leu

35 40 45

Leu Gly Arg Ile Tyr Tyr His Val Asp Gly Ala Ala Lys Pro Gly Ser

50 55 60

Leu Pro Pro Asn Val Ser Ala Ala Val Asn Gly Val Ala Phe Val Gly

65 70 75 80

Thr Leu Ser Gly Gln Leu Phe Phe Gly Trp Leu Gly Asp Lys Met Gly

85 90 95

Arg Lys Lys Val Tyr Gly Met Thr Leu Ala Leu Met Val Ile Ala Ser

100 105 110

Ile Ala Ser Gly Leu Ser Phe Gly His Asp Ala Lys Thr Val Met Thr

115 120 125

Thr Leu Cys Phe Phe Arg Phe Trp Leu Gly Phe Gly Ile Gly Gly Asp

130 135 140

Tyr Pro Leu Ser Ala Thr Ile Met Ser Glu Tyr Ser Asn Lys Lys Thr

145 150 155 160

Arg Gly Ala Phe Ile Ala Ala Val Phe Ala Met Gln Gly Phe Gly Ile

165 170 175

Leu Ala Gly Gly Val Phe Ala Ile Ile Ile Ala Ser Val Phe Lys Ser

180 185 190

Lys Phe Asp Ser Pro Pro Tyr Glu Val Asp Pro Leu Gly Ser Thr Val

195 200 205

Pro Gln Ala Asp Tyr Val Trp Arg Ile Ile Leu Met Phe Gly Ala Ile

210 215 220

Pro Ala Ala Met Thr Tyr Tyr Ser Arg Ser Lys Met Pro Glu Thr Ala

225 230 235 240

Arg Tyr Thr Ala Leu Val Ala Lys Asn Met Glu Lys Ala Ala Ala Asp

245 250 255

Met Ser Lys Val Met Asn Met Glu Ile Gln Ala Glu Pro Lys Lys Glu

260 265 270

Glu Glu Ala Gln Ala Lys Ser Tyr Gly Leu Phe Ser Lys Glu Phe Met

275 280 285

Ser Arg His Gly Leu His Leu Leu Gly Thr Thr Ser Thr Trp Phe Leu

290 295 300

Leu Asp Ile Ala Phe Tyr Ser Gln Asn Leu Phe Gln Lys Asp Ile Phe

305 310 315 320

Ser Ala Ile Gly Trp Ile Pro Pro Ala Lys Thr Met Asn Ala Leu Glu

325 330 335

Glu Val Phe Phe Ile Ala Arg Ala Gln Thr Leu Ile Ala Leu Cys Ser

340 345 350

Thr Val Pro Gly Tyr Trp Phe Thr Val Ala Phe Ile Asp Arg Ile Gly

355 360 365

Arg Phe Ala Ile Gln Leu Met Gly Phe Phe Phe Met Thr Ile Phe Met

370 375 380

Phe Ala Leu Ala Ile Pro Tyr Asp His Trp Thr Leu Arg Glu Asn Arg

385 390 395 400

Ile Gly Phe Val Val Ile Tyr Ser Leu Thr Phe Phe Phe Ala Asn Phe

405 410 415

Gly Pro Asn Ala Thr Thr Phe Val Val Pro Ala Glu Ile Phe Pro Ala

420 425 430

Arg Phe Arg Ser Thr Cys His Gly Ile Ser Ser Ala Ser Gly Lys Leu

435 440 445

Gly Ala Met Val Gly Ala Phe Gly Phe Leu Tyr Leu Ala Gln Asn Gln

450 455 460

Asp Pro Ser Lys Ala Asp Ala Gly Tyr Pro Ala Gly Ile Gly Val Arg

465 470 475 480

Asn Ser Leu Leu Val Leu Gly Val Ile Asn Ile Leu Gly Phe Met Phe

485 490 495

Thr Phe Leu Val Pro Glu Ala Lys Gly Arg Ser Leu Glu Glu Ile Ser

500 505 510

Gly Glu Gln Glu Glu Glu Thr Lys Val

515 520

<210> 3

<211> 22

<212> DNA

< 213>artificial sequence

<400> 3

atggggaagg agcaagttca gg 22

<210> 4

<211> 24

<212> DNA

< 213>artificial sequence

<400> 4

ttacaccttg gtctcctctt cttg 24

<210> 5

<211> 34

<212> DNA

< 213>artificial sequence

<400> 5

atatgcggcc gcatggggaa ggagcaagtt cagg 34

<210> 6

<211> 34

<212> DNA

< 213>artificial sequence

<400> 6

gcgcggatcc ttacaccttg gtctcctctt cttg 34

<210> 7

<211> 30

<212> DNA

< 213>artificial sequence

<400> 7

atgctctaga gcctactgct gcctgtgaat 30

<210> 8

<211> 30

<212> DNA

< 213>artificial sequence

<400> 8

atgcccatgg cttgctcctt ccccatcgct 30

<210> 9

<211> 33

<212> DNA

< 213>artificial sequence

<400> 9

tgataaagct tatggggaag gagcaagttc agg 33

<210> 10

<211> 35

<212> DNA

< 213>artificial sequence

<400> 10

attaaacgcg tttacacctt ggtctcctct tcttg 35

<210> 11

<211> 34

<212> DNA

< 213>artificial sequence

<400> 11

tcaaggatcc ccaaggagtt catgagtcgc catg 34

<210> 12

<211> 33

<212> DNA

< 213>artificial sequence

<400> 12

tgccaagctt tggcattagg cccaaagttt gca 33

<210> 13

<211> 33

<212> DNA

< 213>artificial sequence

<400> 13

atgcctgcag ccagtgatca tagggaatgg caa 33

<210> 14

<211> 32

<212> DNA

< 213>artificial sequence

<400> 14

atgcacgcgt gaacatggag attcaagccg ag 32

<210> 15

<211> 20

<212> DNA

< 213>artificial sequence

<400> 15

gctgttatgc ggccattgtc 20

<210> 16

<211> 20

<212> DNA

< 213>artificial sequence

<400> 16

gacgtctgtc gagaagtttc 20

<210> 17

<211> 20

<212> DNA

< 213>artificial sequence

<400> 17

tgcaaaggag gctgctaact 20

<210> 18

<211> 20

<212> DNA

< 213>artificial sequence

<400> 18

cagcatcacc gttcttcaaa 20

<210> 19

<211> 20

<212> DNA

< 213>artificial sequence

<400> 19

gaacactttc agggcaactc 20

<210> 20

<211> 21

<212> DNA

< 213>artificial sequence

<400> 20

gtcatcacag tctttgcatc g 21

Claims (10)

1. phosphorus transporter protein gene relevant with the soybean nodulation phosphorus transporter GmPT5, it is characterized in that its nucleotide sequence is shown in SEQ ID NO:1.

2. said phosphorus transporter protein gene relevant of claim 1 with the soybean nodulation phosphorus transporter GmPT5Encoded protein matter is characterized in that its aminoacid sequence is shown in SEQ ID NO:2.

3. an expression vector is characterized in that containing the said phosphorus transporter protein gene relevant with the soybean nodulation phosphorus transporter of claim 1 GmPT5

4. a genetic engineering bacterium is characterized in that containing the described expression vector of claim 3.

5. the said phosphorus transporter protein gene relevant of claim 1 with the soybean nodulation phosphorus transporter GmPT5Application in the preparation transgenic plant.

6. the said phosphorus transporter protein gene relevant of claim 1 with the soybean nodulation phosphorus transporter GmPT5Application in the preparation of preparation promotion plant phosphorus transporter.

7. the application of the described expression vector of claim 3 in the preparation transgenic plant.

8. the application of the described expression vector of claim 3 in the preparation of preparation promotion plant phosphorus transporter.

9. according to each described application among the claim 5-8, it is characterized in that said plant is a dicotyledons.

10. application according to claim 9 is characterized in that said dicotyledons is a soybean.

Images