CN104946684A - Function of purple acid phosphatase GmPAP33 gene for promoting reuse of phosphorus in soybean mycorrhiza - Google Patents

Abstract

The invention belongs to the field of gene engineering, particularly discloses a function of purple acid phosphatase GmPAP33 gene for promoting reuse of phosphorus in soybean mycorrhiza, and proves a function of purple acid phosphatase GmPAP33 gene in phosphorus metabolism for the first time. In a root system, GmPAP33 genes are mainly located in root cells containing mycorrhizal arbuscular structures. The GmPAP33 genes have the effect on the reuse of phosphorus in soybean mycorrhiza; through the over-expression of GmPAP33, the soybean biomass and the phosphorus absorption quantity can be increased, so that the plant phosphorus efficiency is improved accordingly. Through the transgenic technology of the GmPAP33 genes, the efficient phosphorus utilization capability of mycorrhizal crops can be improved, and phosphorus-efficient plant materials can be cultured, so that new purposes of fertilizer saving and high yield can be realized, and important theoretical and practical significances are provided for development of the environmental-friendly sustainable agriculture.

Description

Purple acid phosphatase gene GmPAP33 is promoting the function in soybean mycorhiza in phosphorus recycling

Technical field

The present invention relates to genetically engineered field, particularly, relate to a kind of functional study and application thereof of gene, more specifically, relate to purple acid phosphatase gene gmPAP33promoting the function in soybean mycorhiza in phosphorus recycling.

Background technology

Phosphorus is the necessary nutritive element of growth and development of plants, is also one of important factor of restriction crop production.Be difficult to because phosphorus is easily fixed in soil absorb, it is very general that soil lacks phosphorus situation.In long-term evolutionary process, plant has developed the utilization that many adaptation mechanisms improve Soil Phosphorus, comprise in the change of Root morphology configuration, body and the change, rhizospheric microorganism symbiosis etc. (Wang et al., 2010) of exocrine activity of acid phosphatase.Wherein, acid phosphatase, as the multi-functional enzyme of one, all plays an important role (Tran et al., 2010) to plant-growth and growth under normal phosphorus supply and scarce phosphorus condition.Helal(1990) have studied the relation of activity of acid phosphatase under scarce phosphorus condition in plant materials and plant utilization organophosphorus, think that the height of body Acid Phosphatase Activity can as an important indicator of screening phosphorus efficiency plant.On the other hand, the acid phosphatase of secretion then take part in the hydrolysis of Organic phosphate, discharges titanium pigment for plant absorption (Richardson et al., 2001).This absolutely proves that acid phosphatase is most important to Phosphorus Efficiency in Crops.

Purple acid phosphatase (Purple acid phosphatase, PAP) " tartrate-resistant " acid phosphatase is again, belong to dinuclear metal enzyme family, the hydrolysis (kaida et al., 2003) of catalysis a series of phosphoric acid ester bond and anhydrous hydride.In higher plant, the pass that the research of purple acid phosphatase concentrates on itself and phosphorus nutrition is mostly fastened.Under low-phosphorus stress, some purple acid phosphatase genes express to strengthen all has report (Hegeman and Grabau, 2001 on the plants such as soybean, section type clover, Arabidopis thaliana and tomato; Bozzo et al., 2004; Xiao et al., 2006; Wang et al., 2011).On Arabidopis thaliana, existing 29 purple acid phosphatase genes identified (Li et al., 2002).Wherein, the purple acid phosphatase AtPAP15 from Arabidopis thaliana has stronger phytase activity, can promote that the hydrolysis of phytate produces water-soluble phosphate (Zhang et al., 2008).Wang etc. (2009) overexpression in soybean atPAP15, and utilize exocrine signal peptide to impel AtPAP15 to strengthen in the secretion of rhizosphere, thus improve Soybean P-absorbing efficiency and yield potential.

On soybean, identify 35 purple acid phosphatase gene family members at present altogether.Current those skilled in the art only know under AM fungal induction, purple acid phosphatase gene gmPAP33table is a large amount of to raise, but the concrete function of this gene in phosphorus metabolism is also unclear.

Summary of the invention

The object of the invention is to verify purple acid phosphatase gene gmPAP33function in phosphorus metabolism, thus for comprise soybean farm crop phosphorus efficiency utilize and high yield molecular breeding genetic resources is provided.

To achieve these goals, the present invention is achieved by following scheme:

Purple acid phosphatase gene gmPAP33application in poly phosphorus in degraded clump branch.

Purple acid phosphatase gene gmPAP33the application of the organophosphorus in degraded clump branch inner membrance.

Preferably, described poly phosphorus is short chain polyphosphoric acid salt, and described organophosphorus is phosphatide phosphoric acid salt.

Existing report is only known under AM fungal induction, purple acid phosphatase gene gmPAP33table is a large amount of to raise, but the concrete function of this gene in phosphorus metabolism is also unclear.Mycorrhizal plants absorbs the inorganic phosphorus in soil by the outer mycelia of root, and be quickly converted to long-chain Poly P and be transported to mycelia in root, enter in the clump branch structure in main place-root system endodermis that between mycorrhizal fungi and host plant, nutrient exchanges, be transformed into short chain Poly-P, the membrane structure being released into clump branch with the form of inorganic phosphorus again after decomposition is transitted to host plant.The main place that exchanges as nutrient of clump branch is a short-lived structure, 5-7 days of usually surviving in plant materials, aging death degrading subsequently, meanwhile, clump branch structure new in a large number is constantly formed in host plant, makes the nutrient in mycorhiza be transported to host plant continuously.And once clump branch aging death, the poly phosphorus whereabouts where of Cong Zhizhong? can organophosphorus such as the phosphatide phosphoric acid salt in old and feeble clump branch inner membrance of degenerating be recycled by plant, especially under nutrient deficiency condition, how to utilize?

Contriver is by research Late Cambrian gmPAP33the assignment of genes gene mapping in the root cells containing mycorhiza clump branch structure, and, with overexpression gmPAP33soybean is compared, under Arbuscular Mycorrhizal Fungi condition, gmPAP33suppress to express short chain polyphosphoric acid salt concn in strain root significantly to increase; Under high phosphorus Arbuscular Mycorrhizal Fungi condition, gmPAP33suppress to express phosphatide phosphate concn in strain root significantly to increase, in mycorhiza, the Utilization ability of insoluble phosphorus reduces.This result explanation gmPAP33the function of gene in phosphorus metabolism is: gmPAP33this for phosphatide phosphoric acid salt organic phosphorus degrading can become and by the inorganic phosphorus of plant utilization, thus can improve mycorrhizal plants to the utilization of phosphorus by gene, in addition, gmPAP33this for short chain polyphosphoric acid salt difficulty can be degraded into by the inorganic phosphorus of plant utilization, thus can improve mycorrhizal plants to the utilization of phosphorus by the inorganic phosphorus of plant utilization by gene.So after clump branch aging death, the organophosphorus in the poly phosphorus of Cong Zhizhong and clump branch inner membrance is all degraded into by the inorganic phosphorus of plant utilization, thus can improves mycorrhizal plants to the utilization of phosphorus by GmPAP33, improves increment.

Because purple acid phosphatase gene gmPAP33there is the effect of organophosphorus in degraded clump branch and inorganic phosphorus, can promote that mycorrhizal plants is to the recycling of phosphorus, so the present invention also protects purple acid phosphatase gene gmPAP33promoting the application in leguminous plants mycorhiza in phosphorus recycling.Preferably, described leguminous plants is soybean.

The present invention is claimed purple acid phosphatase gene also gmPAP33application in the transgenosis mycorhiza crop cultivating High-Efficiency Utilization of Phosphorus.Preferably, described transgenosis mycorhiza crop is genetically engineered soybean.

Improve a method for leguminous plants phosphorus recycling and biomass, comprise the steps:

S1. process LAN is built gmPAP33genophore, by over-express vector transform Agrobacterium tumefaciens, obtains process LAN with agrobacterium tumefaciens transfection leguminous plants gmPAP33the leguminous plants of gene;

S2. to the process LAN obtained gmPAP33arbuscular Mycorrhizal Fungi in the leguminous plants of gene also applies phosphate fertilizer, can improve leguminous plants phosphorus recycling.

Preferably, described leguminous plants is soybean.More preferably, described soybean varieties is phosphorus efficiency Guangdong spring 03-3.

Preferably, described bush mycorrhizal fungi is fungi rhizophagus irregularisor glomus mosseae.

Improve a method for soybean phosphorus recycling and biomass, comprise the steps:

S1. process LAN is built gmPAP33genophore, by over-express vector transform Agrobacterium tumefaciens, obtains process LAN with agrobacterium tumefaciens transfection phosphorus efficiency Guangdong spring 03-3 soybean gmPAP33the soybean of gene;

S2. to the process LAN obtained gmPAP33arbuscular Mycorrhizal Fungi in the soybean of gene rhizophagus irregularisand apply phosphate fertilizer, phosphorus recycling and the biomass of soybean can be improved.

Preferably, described process LAN gmPAP33the construction process of genophore is: amplification gmPAP33after ORF full length sequence 1209 bp of gene, PCR recovery sequencing fragment is errorless, after double digestion being carried out to fragment and object carrier by Sac I and Xba I, will gmPAP33gene is connected in object carrier pTF101.1 and get final product.

Compared with prior art, the present invention has following beneficial effect:

The present invention has verified purple acid phosphatase gene first gmPAP33function in phosphorus metabolism. gmPAP33gene is mainly positioned in the root cells containing mycorhiza clump branch structure in root system. gmPAP33in gene pairs soybean mycorhiza, the recycling of phosphorus works, overexpression gmPAP33biomass and the P uptake by plants of soybean can be increased, final raising plant phosphorus efficiency.Therefore, will gmPAP33gene, by transgenic technology, can be used for the ability improving the utilization of mycorhiza crop phosphorus efficiency, cultivates phosphorus efficiency vegetable material, reach the novelty teabag saving fertile high yield, have important theory and practice meaning to development environment friendly sustainable agriculture.

Accompanying drawing explanation

Fig. 1 is gmPAP33gene Expression Profile Analysis.

Fig. 2 is gmPAP33promoters driven gUSexpressive site analysis.

Fig. 3 is excessive, interference gmPAP33the expression amount of transfer-gen plant detects.

Fig. 4 is excessive, interference gmPAP33on the impact in phosphorus storehouse in Soybean transgenic plant root.

Fig. 5 is excessive, interference gmPAP33on Soybean transgenic plant growth and the impact of phosphorus content.

Embodiment

To make the present invention below in conjunction with Figure of description and specific embodiment and elaborating further, described embodiment, only for explaining the present invention, is not intended to limit scope of the present invention.The test method used in following embodiment if no special instructions, is ordinary method; The material used, reagent etc. if no special instructions, are the reagent that can obtain from commercial channels and material.

embodiment 1

gmPAP33gene Expression Profile Analysis: in the soybean gene group database announced, by homology comparison, dopes soybean purple acid phosphatase and has 35 members, by quantitative PCR technique, determine gmPAP33gene is the gene of strongly expressed in mycorhiza. gmPAP33the open reading frame length of gene is 1290 bp, and coding is containing 429 amino acid whose albumen.Research shows, this gene and soybean bush mycorrhizal fungi infect closely related, first analyze its expression pattern.

Adopt 2 soybean varieties, phosphorus poor efficiency local No. 2 (BD2) and phosphorus efficiency Guangdong spring 03-3(YC03-3).Arrange 3 AMF to inoculate process and be respectively and do not inoculate (-AM), Inoculation of Arbuscular Mycorrhizal Fungi rhizophagus irregularisor AM fungi glomus mosseae.Two phosphorus process are set, 5 μMs of KH ₂pO ₄as low-phosphorous (-P) and 250 μMs of KH ₂pO ₄as high phosphorus (+P), the K of low-phosphorous process ⁺use K ₂sO ₄polishing.Adopt 1/2 Hoagland nutritive medium sand culture plantation.Select the white plastics circle basin of 17 cm × 12.5, cm × 12 cm specifications, every basin loads quartz sand 1.8 kg, and sour earth 0.2 kg, sand, through 121 DEG C of autoclaving 40 min, circulates twice.Corresponding AMF microbial inoculum or-AMF simulation inoculum 0.35 kg(14.89% is added) during dress basin, irrigate with 160 mL secondary water after mixing completely, soybean seeds uses aqua sterilisa soaked overnight after disinfecting 20 sec with the chlorine bleach liquor of 10 %, show money or valuables one carries unintentionally to seed, every basin program request 3 seeds, thinning after emerging 1 week, every basin retains 1 strain.Water weekly the 1/2 Hoagland nutritive medium (pH 6.0-6.2) of corresponding (-P/+P) once.Each process arranges 4 biology and repeats.Routine Management, results after 7 weeks, extract root RNA, reverse transcription becomes cDNA, uses quantitative PCR detection further gmPAP33expression pattern.The house-keeping gene of soybean eF-1aas internal reference.Primer for quantitative PCR gene expression detection amount is respectively:

Soybean eF-1athe primer of gene is:

EF-1a F: 5’- TGAACCACCCTGGTCAGATT -3’ (SEQ ID NO:1)

EF-1aR: 5’- TCCAGCATCACCATTCTTCA -3’ (SEQ ID NO:2)

gmPAP33the primer of gene is:

GmPAP33 F: 5’- CGCCCCGTGGTACAACTCTAA -3’ (SEQ ID NO:3)

GmPAP33 R: 5’- GCCCTGCAAAAACAACATCAAC -3’ (SEQ ID NO:4)

Quantitative PCR response procedures and condition are: the gained cDNA that RNA sample reversed dilutes 50 times as quantitative PCR reaction template.Choose appropriate cDNA stoste and do the template that gradient dilution is typical curve.Adopt 20 μ L reaction systems in test, comprising: 2 × SYBR Green PCR master mix of 10 μ L, 10 μMs of forward and reverse primers of each 0.6 μ L, the cDNA that 2 μ L dilute, finally mend to 20 μ L with Mili-Q water.Reaction conditions is 95 DEG C of sex change 1 minute, then 95 DEG C of sex change 15 seconds, and 58 DEG C of annealing 15 seconds, 72 DEG C extend 30 seconds and carry out 40 circulations.The expression amount of each sample is calculated with the Real-Time Analysis Software 6.0 of Rotor-Gene.

Fig. 1 is gmPAP33gene Expression Profile Analysis.Plant adopts sand culture experiment, and under the (+P) condition that do not phosphorate (-P) and phosphorate, Inoculation of Arbuscular Mycorrhizal Fungi process is results after 7 weeks.BD2 and YC03-3 represents two different soybean genotypes respectively;-AM represents not Inoculation of Arbuscular Mycorrhizal Fungi, r. irregularisor g. mosseaerepresent inoculation respectively rhizophagus irregularisor glomus mosseaebush mycorrhizal fungi.In figure, data are mean value and standard errors of four secondary pollutants repetitions, and asterisk represents the comparison in difference of relative expression quantity between same kind+AM and-AM (t-inspection), *: p<0.05; *: 0.001< p<0.01; * *: p<0.001; Ns: difference is not remarkable.Result shows: compared with-AM, and inoculating different bush mycorrhizal fungi bacterial classification can significantly induce gmPAP33up-regulated expression in mycorhiza, and under high and low phosphorus condition, expression amount all strengthens.Meanwhile, the differential expression between the soybean varieties that phosphorus efficiency is different is not remarkable, shows that bush mycorrhizal fungi can be induced gmPAP33enhanced expressing in soybean mycorhiza, and their expression is less by the impact of different soybean genotype and AM fungi strain.Result implies gmPAP33may play an important role in mycorrhizal plants.

embodiment 2

1, gmPAP33the clone of gene: with soybean bloom leaf portion cDNA for template, use upstream specific primer F1:5 '- gAGCTCaTGGGGATGCGAATG-3 ' (SEQ ID NO:5) and downstream special primer R2:5 '- tCTAGAcTATTTACAGGAAGGAAT-3 ' (SEQ ID NO:6) increases gmPAP33the ORF full length sequence 1290bp of gene, and comparison of checking order, successfully obtain gmPAP33encoding sequence, it can be encoded containing 429 amino acid whose albumen.

2, gmPAP33gene promoter clone, vector construction and tissue expression positioning analysis: the structure of promoter Analysis expression vector: conventionally, extract soybean YC03-3 leaves genomic DNA in genotypic flowering period, with Soybean Leaves portion genomic dna for template, use upstream specific primer F2:5 '-CCG gAATTCgAAAGCGTTGGGCTTAAAC-3 ' (SEQ ID NO:7) and downstream special primer R2:5 '-CTAG tCTAGAtGTTTTCAAATTTCGGTGC-3 ' (SEQ ID NO:8) increases gmPAP33promotor 2019 bp fragment, after PCR fragment recovery order-checking is errorless, passes through ecor I and xbaafter I carries out double digestion to recovery fragment and object carrier, will gmPAP33gene is connected to object carrier pTF102.Transformation of E. coli DH10B, check order errorless rear transform Agrobacterium tumefaciens EHA101, transforms for the whole strain of Agrobacterium tumefaciens mediated soybean cotyledon node.

For gmPAP33tissue expression positioning analysis, adopts sand culture test, selects the whole strain transformation plant of promotor proGmPAP33-18 and proGmPAP33-20, for examination bush mycorrhizal fungi is rhizophagus irregularis,low-phosphorous (LP) 25 μMs of KH ₂pO ₄.Each process arranges 4 biology and repeats.Routine Management, collects fresh sample after 30 d, clean, and is cut into the root segment that about 1 cm is long, with PEM buffer(50 mmol/L PIPES, 5 mmol/L EGTA and 5 mmol/L MgSO ₄, pH 7.0) and fix 1 h.Taken out by the root segment fixed, paper handkerchief blots surface-moisture, and with low melting point agar embedding, root segment rip cutting is become 50 μm of thick thin heel pieces by use vibratome (Leica VT1200S).The thin heel piece cut is placed in centrifuge tube, first GUS active coloring is carried out, use PBS buffer rinsing three times again, use the WGA488 fluorescence dye room temperature of 10 μ g/mL to dye 30 min, under the exciting light of wavelength 488 nm, use fluorescence microscope and take pictures.

The results are shown in Figure 2, gmPAP33promoters driven gUSexpressive site analysis, wherein, A, gmPAP33tissue expression site analysis under promotor genetically engineered soybean Arbuscular Mycorrhizal Fungi condition.A-c: the GUS dyeing under light field, the WGA-Alexafluor 488 fluorescent dye display mycorhiza structure under d-f:488 nm, in figure, scale is 50 μm.B, gmPAP33the common location of GUS dyeing and mycorhiza dyeing in promotor soybean transgene strain root.A: the GUS active coloring under light field; B:WGA-Alexafluor 488 fluorescent dye mycorhiza structure; C:GUS active coloring and WGA-Alexafluor 488 dye and merge.In figure, scale is 30 μm.Result shows: gmPAP33mainly be positioned in root system in the cell containing clump branch structure.

embodiment 3

1, overexpression gmPAP33the structure of carrier: with genotypic leaf in the flowering period portion cDNA of soybean YC03-3 for template, use upstream specific primer F1:5 '- gAGCTCaTGGGGATGCGAATG-3 ' (SEQ ID NO:5) and downstream special primer R1:5 '- tCTAGAcTATTTACAGGAAGGAAT-3 ' (SEQ ID NO:6) increases gmPAP33after ORF full length sequence 1209 bp, PCR recovery sequencing fragment is errorless, pass through saci and xbaafter I carries out double digestion to fragment and object carrier, will gmPAP33gene is connected to object carrier pTF101.1.Transformation of E. coli DH10B, check order errorless rear transform Agrobacterium tumefaciens EHA101, transforms for the whole strain of Agrobacterium tumefaciens mediated soybean cotyledon node.

2, expression is interfered gmPAP33the structure of carrier: with genotypic leaf in the flowering period portion cDNA of soybean YC03-3 for template, use upstream specific primer F3:5 '-AA tCTAGAgGCGCGCCATGGGGATGCGAATGCGT (SEQ ID NO:9) and downstream special primer R3:5 '-G cGGATCCaTTTAAATTGATTGGAAGTTGGGAG (SEQ ID NO:10) increases 430 bp object fragments, uses asci and swaafter I carries out double digestion to forward fragment and object carrier, will gmPAP33gene forward fragment is connected to object carrier pFGC5941.And then use xbai and bamthe reverse fragment of H I double digestion and the object carrier with forward fragment, reverse fragment is connected to and includes in the object carrier pFGC5941 of forward fragment, transformation of E. coli DH10B, check order errorless rear transform Agrobacterium tumefaciens EHA105, transforms for the whole strain of Agrobacterium tumefaciens mediated soybean cotyledon node.

3, the acquisition of Soybean transgenic plant: by the expression vector plasmid (promoter vector, the overexpression that build gmPAP33carrier, interference are expressed gmPAP33carrier) be converted in agrobacterium tumefaciens, adopt the whole strain of Agrobacterium tumefaciens mediated soybean cotyledon node to transform and obtain transfer-gen plant, follow-up phenotypic evaluation all uses transgenic line.

4, the detection of Soybean transgenic plant

The detection of the whole strain transformation plant of promotor: choose a slice in the ternately compound leaf just launched completely on transfer-gen plant, half marking pen is marked, second half dips the weedicide (Liberty diluted with cotton swab, originate from France) spread upon the front of blade, observe blade change after 2-3 d.If blade generation chlorosis, flavescence, withering or having yellow spotting to produce then illustrates this plant not antiweed, is the non-transgenic material of feminine gender; If blade does not change, illustrate in its plant and have Herbicid resistant may be positive plant.Meanwhile, the qualitative detection of gus protein expression activity is carried out.Gather fresh leaf or root is placed in culture dish, add the GUS dye liquor prepared in right amount and testing sample is dipped in GUS dye liquor completely, put into 37 DEG C of thermostat containers when obvious blue appears in sample, outwell dye liquor.After alcohol immersion 5 min rinsing sample with 50%, add 70% alcohol immersion until sample observes GUS staining conditions after decolouring completely.

Overexpression gmPAP33express with interference gmPAP33the detection of whole strain converting material: carry out herbicide screening as mentioned above on the one hand; Take on the other hand single-strain blade to extract DNA as template, plasmid DNA as positive control, not genetically modified soy bean DNA as negative control, amplifying target genes fragment (excess detector primer is SEQ ID NO:5,6; Interference detects primer: SEQ ID NO:9,10) carry out PCR detection.In addition, take transfer-gen plant spire or root samples and extract RNA, reverse transcription becomes cDNA, uses the effect of quantitative PCR detection overexpression and interference further, described above with soybean house-keeping gene in quantitative PCR assays eF-1afor reference gene (primer sequence: SEQ ID NO:1,2), gene for the purpose of relative expression quantity gmPAP33the expression amount of (primer sequence: SEQ ID NO:3,4) and the ratio of house-keeping gene expression amount.Confirm to obtain effective different transgenic line through PCR detection and quantitative PCR.Fig. 3 is excessive, interference gmPAP33the expression amount of transfer-gen plant detects.Wherein, A:PCR detects positive plant; B: quantitative PCR detection overexpression gmPAP33transgenic line expression amount, C: quantitative PCR detection gmPAP33suppress express transgenic strain expression amount, gene for the purpose of relative expression quantity gmPAP33expression amount and soybean house-keeping gene eF-1athe ratio of expression amount.WT represents soybean wild type control; OX represents overexpression gmPAP33transfer-gen plant; RNAi represents gmPAP33suppress express transgenic plant.Testing data is mean value and the standard error of four biology repetitions.

,excessive, interference gmPAP33impact on phosphorus storehouse in Soybean transgenic plant root: the results Arbuscular Mycorrhizal Fungi different transgenic line of 50 days also measures the content in different phosphate storehouse, comprising: phosphatide phosphoric acid salt and short chain poly phosphorus etc.First fresh sample is extracted with 10%TCA, after centrifugal, precipitate and measures phosphatide phosphoric acid salt by 100% ethanol and ethanol/ether extraction, after supernatant liquor pH is adjusted to 4.5, measure short chain content of polyphosphate by bariumchloride precipitation.

Fig. 4 is excessive, interference gmPAP33on the impact in phosphorus storehouse in Soybean transgenic plant root.Wherein, plant adopts sand (1:1) training experiment, respectively at (-P, the 0 μM of KH of not phosphorating ₂pO ₄) or phosphorate (+P, 500 μMs of KH ₂pO ₄) under condition, do not inoculate (-AM) or Inoculation of Arbuscular Mycorrhizal Fungi rhizophagus irregularisresults after (+AM) processes 8 weeks.OE represents overexpression gmPAP33transfer-gen plant; RNAi represents gmPAP33suppress express transgenic plant.In figure, data are mean value and standard errors of four secondary pollutants repetitions.Lower case or upper case letter represents one-way analysis of variance result between same phosphorus level and bush mycorrhizal fungi inoculation process lower different soybean genotype respectively, same letter represent difference not significantly ( p<0.05).Result shows: with overexpression gmPAP33soybean is compared, under Arbuscular Mycorrhizal Fungi condition, gmPAP33suppress to express short chain polyphosphoric acid salt concn in strain root significantly to increase; Under high phosphorus Arbuscular Mycorrhizal Fungi condition, gmPAP33suppress to express phosphatide phosphate concn in strain root significantly to increase, in mycorhiza, the Utilization ability of insoluble phosphorus reduces.

6, excessive, interference gmPAP33genetic expression is on Soybean transgenic plant growth and the impact of phosphorus content:

Biomass measures: one of percentage balance weighs overground part and root samples fresh weight, and all samples completes at 105 DEG C of baking ovens and within 30 minutes, is placed on 75 DEG C of oven dry to constant weight, takes dry weight.

Plant phosphorus measures: plant phosphorus content adopts Continuous Flow Analysis instrument, and (model is SAN++, originate from Holland) measure, first take Plant samples 0.2 about g, add the 5 mL vitriol oils and clear up rear distilled water constant volume and cause 50 mL, and diluted sample 4 is doubly made liquid to be measured.Colorimetric signal is inputted computer after flowing through Flow Analyzer by liquid to be measured, and by Flow Access computed in software result.

Nutrient content in plant unit plant phosphorus content represents, calculation formula is:

Phosphorus content (mg/plant)=phosphorus concentration (mg/g) × plant weights (g/plant)

Fig. 5 is excessive, interference gmPAP33genetic expression is on Soybean transgenic plant growth and the impact of phosphorus content.Wherein, plant adopts sand (1:1) training experiment, respectively at (-P, the 0 μM of KH of not phosphorating ₂pO ₄) or phosphorate (+P, 500 μMs of KH ₂pO ₄) under condition, do not inoculate (-AM) or Inoculation of Arbuscular Mycorrhizal Fungi rhizophagus irregularisresults after (+AM) processes 8 weeks.OE represents excessive gmPAP33transfer-gen plant; RNAi represents gmPAP33suppress express transgenic plant.In figure, data are mean value and standard errors of four secondary pollutants repetitions.Lower case or upper case letter represents one-way analysis of variance result between same phosphorus level and AMF inoculation process lower different soybean genotype respectively, same letter represent difference not significantly ( p<0.05).Result shows: with gmPAP33suppress to express strain to compare, under high phosphorus Arbuscular Mycorrhizal Fungi condition, overexpression gmPAP33significantly promote the growth of genetically engineered soybean, add plant phosphorus content and biomass.

SEQUENCE LISTING

 

<110> Agricultural University Of South China

 

<120> purple acid phosphatase gene GmPAP33 is promoting the function in soybean mycorhiza in phosphorus recycling

 

<130>

 

<160> 10

 

<170> PatentIn version 3.3

 

<210> 1

<211> 20

<212> DNA

<213> EF-1a F

 

<400> 1

tgaaccaccc tggtcagatt 20

 

 

<210> 2

<211> 20

<212> DNA

<213> EF-1a R

 

<400> 2

tccagcatca ccattcttca 20

 

 

<210> 3

<211> 21

<212> DNA

<213> GmPAP33 F

 

<400> 3

cgccccgtgg tacaactcta a 21

 

 

<210> 4

<211> 22

<212> DNA

<213> GmPAP33 R

 

<400> 4

gccctgcaaa aacaacatca ac 22

 

 

<210> 5

<211> 21

<212> DNA

<213> upstream specific primer F1

 

<400> 5

gagctcatgg ggatgcgaat g 21

 

 

<210> 6

<211> 24

<212> DNA

<213> downstream special primer R1

 

<400> 6

tctagactat ttacaggaag gaat 24

 

 

<210> 7

<211> 28

<212> DNA

<213> upstream specific primer F2

 

<400> 7

ccggaattcg aaagcgttgg gcttaaac 28

 

 

<210> 8

<211> 29

<212> DNA

<213> downstream special primer R2

 

<400> 8

ctagtctaga tgttttcaaa tttcggtgc 29

 

 

<210> 9

<211> 34

<212> DNA

<213> upstream specific primer F3

 

<400> 9

aatctagagg cgcgccatgg ggatgcgaat gcgt 34

 

 

<210> 10

<211> 33

<212> DNA

<213> downstream special primer R3

 

<400> 10

gcggatccat ttaaattgat tggaagttgg gag 33

Claims (10)

1. purple acid phosphatase gene gmPAP33application in poly phosphorus in degraded clump branch.

2. purple acid phosphatase gene gmPAP33the application of the organophosphorus in degraded clump branch inner membrance.

3. application according to claim 1 and 2, described poly phosphorus is short chain polyphosphoric acid salt, and described organophosphorus is phosphatide phosphoric acid salt.

4. purple acid phosphatase gene gmPAP33promoting the application in leguminous plants mycorhiza in phosphorus recycling.

5. purple acid phosphatase gene gmPAP33application in the transgenosis mycorhiza crop cultivating High-Efficiency Utilization of Phosphorus.

6. improve a method for leguminous plants phosphorus recycling and biomass, it is characterized in that, comprise the steps:

S1. process LAN is built gmPAP33genophore, by over-express vector transform Agrobacterium tumefaciens, obtains process LAN with agrobacterium tumefaciens transfection leguminous plants gmPAP33the leguminous plants of gene;

S2. to the process LAN obtained gmPAP33arbuscular Mycorrhizal Fungi in the leguminous plants of gene also applies phosphate fertilizer, can improve leguminous plants phosphorus recycling.

7. method according to claim 6, is characterized in that, described leguminous plants is soybean.

8. method according to claim 7, is characterized in that, described soybean is phosphorus efficiency Guangdong spring 03-3.

9. method according to claim 6, is characterized in that, described bush mycorrhizal fungi is fungi rhizophagus irregularisor glomus mosseae.

10. improve a method for soybean phosphorus recycling and biomass, it is characterized in that, comprise the steps:

S1. process LAN is built gmPAP33genophore, by over-express vector transform Agrobacterium tumefaciens, obtains process LAN with agrobacterium tumefaciens transfection phosphorus efficiency Guangdong spring 03-3 soybean gmPAP33the soybean of gene;

S2. to the process LAN obtained gmPAP33arbuscular Mycorrhizal Fungi in the soybean of gene rhizophagus irregularisand apply phosphate fertilizer, phosphorus recycling and the biomass of soybean can be improved.