CN103911384B - A kind of gene and application thereof of controlling sclerotinia rot of colza - Google Patents

Abstract

The invention discloses a kind of control cabbage type rape sclerotiniose gene and application thereof, be specifically related to a kind of gene of controlling cabbage type rape sclerotiniose<i>BnWRKY33</i>Separation clone, functional verification and application.<i>BnWRKY33</i>Gene has the function of controlling sclerotium disease, in the time that sclerotiniose is processed cabbage type rape<i>BnWRKY33</i>Expression significantly improve. Improve by technique for gene engineering<i>BnWRKY33</i>The expression of gene can be controlled sclerotinia rot of colza, thereby the resistance to sclerotinia sclerotiorum and the output that improve cabbage type rape and other crops are had to important application prospect.

Description

A kind of gene and application thereof of controlling sclerotinia rot of colza

Technical field

The present invention relates to a kind of gene and application thereof of controlling sclerotinia rot of colza, be specifically related to a kind of cabbage type rape of controllingThe gene of sclerotiniose and contain this gene or its homogenic carrier, and relate to and utilize this gene or the regulation and control of its functional analogueThe application of Genes For Plant Tolerance sclerotium disease in agricultural production, belongs to plant genetic engineering field.

Background technology

Rape, as a kind of important oil crops, occupies an important position in Chinese oil seed production. China's rape7,000,000 hectares of Annual planting areas (100,000,000 mu), account for globally 1/3, occupy first place in the world, and its rapeseed oil that produces accounts for the whole food of ChinaThe 40%(Shen Jin heros of supplying with vegetable oil etc., china rape is produced and genetic improvement potentiality and brassinosteroid biosynthesis diesel oil development prospect[J], Hua Zhong Agriculture University's journal,, 26 6 phase of volume 894-899 pages in 2007). In addition, rapeseed oil is to be also suitable for producing biological bavinOil, rape is the important source material crop as the shortage of solution global energy by European and American countries. Therefore rape is not only edible oilMain source, is also the important source material crop that solves global energy shortage, has very important strategic position.

But the vegetable seed output of China only can meet domestic 2/3 consumption demand at present, a large amount of dependence on import. ChinaMore than 600 ten thousand tons of imported plants oil in 2005 are maximum in the world oil plant importers, along with growth and people's people's livelihood of the size of populationThe raising that running water is flat,, by current production scale, that breach will become is larger (Wang Hanzhong, the present situation of Chinese oil plant industry development,Problem and countermeasure [J], Chinese oil crops journal,, 27 4 phase of volume 100-105 pages in 2005). Quite long at present and in the futureTime in, China all will face the severe situation of edible oil and fossil energy shortage.

Sclerotinia rot of colza (Sclerotiniasclerotiorum(Lib.) deBary) be that restriction China rape is producedOne of Main Factors. In the middle and lower reach of Yangtze River and southeastern coast rape main producing region, the incidence of sclerotinia rot of colza is very high, and output is damagedLose up to more than 50%; There is area more than 7,000 ten thousand mu in the whole nation, production loss, up to 30%, reaches 50-80% when serious. OrderThe method of preventing and treating of front sclerotinia rot of colza is mainly the seed selection of Techniques For Chemical Control and disease-resistant variety, but chemical prevention exists preventive effect notHigh, cause of disease is difficult to the problems such as elimination, florescence spray medicine difficulty and residues of pesticides, environmental pollution; Conventional breeding is looked for because being difficult toArrive the shortcomings such as effective resistant material and speed are very slow, be also difficult to effectively solve disease-resistant problem. Thus, antagonism sclerotinioseRape variety carries out molecular improvement, and the anti-sclerotiniose kind of quickly breeding is the Critical policies that improves vegetable seed yield per unit area.

Gene engineering method is by pre-designed target and plan, by genetic manipulation, on molecular level, improvesThe technology of kind. Institute of Crop Science, Chinese Academy of Agricultural Science has found that a plant disease resistance genes is gene a or gene b,After gene a or gene b are modified to the resistance of the plant (application number: 201110048518.9,2011) that is significantly increased. And picture oilThis class of dish sclerotiniose is difficult to find the disease of antigen in host plant kind, and gene engineering method provides a kind of and dealt with problemsApproach.

WRKY transcription factor family is the Recent study important transcription factor of a class more widely, and it is present in whole greenIn look department of botany, coerce in reaction and Signal Transduction approach thereof and there is important function (AsaiTet at regulating plant biologyal.,，MAPkinasesignallingcascadeinArabidopsisinnateimmunity[J]，Nature，2002,415 6875 phase of volume 977-983 pages). WRKY33 transcription factor is the important a member in WRKY transcription factor family, containsThere are two WRKY protein structure domains, belong to the 1st class WRKY albumen (Eulgemeta1., TheWRKYsuperfamilyofPlanttranscriptionfactors[J], TrendsPlantSci,, 55 phase of volume 199-206 pages in 2000). ExistingResearch show that AtWRKY33 transcription factor is that saprophytic form fungus resistant is necessary, it can with (T) TGACC (A/T) sequence (W-Box) there is specific effect, regulate in promoter containing the regulatory gene of W-box element or the expression (Lippok of functional geneBeta1.，ExpressionofAtWRKY33encodingapathogen-orPAMP-responsiveWRKYtranscriptionfactorisregulatedbyacompositeDNAmotifcontainingWboxElements[J], MolPlantMicrobeInteract,, 20 4 phase of volume 420-429 pages in 2007). The Chinese Academy of Sciences plantsThing research institute research finds, the polypeptide Glyma02g39870 of WRKY is salicylic synthetic in can regulating plant, plants thereby strengthenDisease resistance (Jin Jingbo etc., 2012 of thing; Application number: 201010541600.0). Arabidopsis AtWRKY33 by AtMKS1 withAtMPK4 forms a complex, and in the time being subject to pathogen infringement, AtWRKY33 and AtMPK4 depart from from AtMKS1, thereby drawPlay the relevant gene of some hormones of downstream, as the expression of PR1, PDF1.2 etc. (Jin-LongQiuetal, ArabidopsisMAPKinase4regulatesgeneexpressionviatranscriptionfactorreleaseinThenucleus[J], EMBOJournal,, 27 2221 pages of 16 phases 2214 of volume – in 2008). Chinese cabbage BrWRKY33 is crossed to tableAfter reaching, Chinese cabbage presents the resistance certain to soft rot (Fan Rongwei etc., Chinese cabbage BrWRKY33 regulatory sequencesClone and functional study [J] thereof, Journal of Agricultural Biotechnology,, 18 4 phase of volume 670-675 pages in 2010). And for rapeThe effect of BnWRKY33, yet there are no the report of document and patent. In this research, we find, sclerotiniose is coerced rapeAfter compeling to process, the expression of BnWRKY33 significantly improves, and then it is remarkable that cabbage type rape BnWRKY33 transgenosis is crossed expression plantStrengthen resistance to sclerotinia sclerotiorum, this result has before important application in enhancing sclerotinia rot of colza resistance and raising rapeseed oil outputScape.

Summary of the invention

The object of the present invention is to provide a kind of gene BnWRKY33 that controls sclerotium disease.

A gene BnWRKY33 who derives from rape, its nucleotides sequence is classified as shown in SEQIDNO.1.

The invention also discloses the protein of BnWRKY33 gene code, its amino acid sequence is shown in SEQIDNO.2.

The invention also discloses the recombinant vector 1300-35S-WRKY33-NOS with BnWRKY33 gene. At carrierPCAMBIA1300(is purchased from prosperous biotech firm of Beijing ancient cooking vessel state) EcoRI/KpnI restriction enzyme site place, upstream add CaMV35S strongPromoter, BamHI/HindIII restriction enzyme site place, its downstream adds CaMVNos terminator, is transformed into carrierPCAMBIA1300-35S-Nos. And recombinant vector 1300-35S-WRKY33-NOS be with BnWRKY33-F (5 '-ggtaccATGGCTGCTTCTTCCCTTC-3′)，BnWRKY33-R(5′-ggatccTCAAGACAAAAACGAATCAAAG-3′)For primer amplification goes out genes of interest BnWRKY33, and then according to gateway kit (Gateway LRClonase IIEnzymeMix, InvitrogenCorporation) operation, genes of interest is cloned into pCAMBIA1300-35S-Nos'sRestriction enzyme site KpnI/BamHI, obtains 1300-35S-WRKY33-NOS.

The present invention further provides described BnWRKY33 gene improve rape to the application in the resistance of sclerotiniose, thisInvention is reached and is improved the resistance of cabbage type rape to dead volume auxotype germ sclerotiniose by this gene of overexpression. Concrete realTest technical step as follows:

Create cabbage type rape cDNA library, from cDNA library, pcr amplification goes out and the cDNA of AtWRKY33 homology, carries outOrder-checking, finds that this cDNA clone is 1452bp, to its Blast nucleotides comparison, finds this cDNA at GenBank databaseThe transcription factor WRKY33 of sequence and arabidopsis, tobacco etc. has very high homology on nucleotide level. For preliminary detectionThe reaction that WRKY33 infects sclerotiniose, with sclerotinite (separating from Zhenjiang, Jiangsu rape) inoculation rape leaf, is connecing respectivelyWhen kind 0,12,24,36,48h, then sampling extracts the total RNA of blade, then uses real-time fluorescence quantitative PCR to detect BnWRKY33Expression. Transform cabbage type rape with flower-dipping method with the Agrobacterium that carries 1300-35S-WRKY33-NOS carrier, adoptRound pcr identifies transgenic line, identifies BnWRKY33 expression be significantly higher than non-transgenic by RT-PCR technologyThe mistake express transgenic strain of strain. The disease-resistant evaluation experimental of sclerotiniose shows, compared with non-transgenic strain, BnWRKY33 crosses tableReach transgenic line and significantly improve resistance to sclerotinia sclerotiorum. These results show that BnWRKY33 gene is strengthening in sclerotinia rot of colza resistanceThere is important application prospect.

Advantage of the present invention:

1. what in the present invention, adopt carrys out clone gene from rape cDNA library, and reliability is high, speed is fast, efficiency is high.

2. the pollen tube passage method that adopts in the present invention transforms rape, and speed is fast, cost is low, simple to operate.

3. the BnWRKY33 gene that in the present invention, clone obtains, for other crop disease-resistant breeding provides new GENE SOURCES;The resistance to sclerotinia sclerotiorum that how to improve other crop for research has the reference function of guidance.

4. the transgenic line that the present invention obtains, for the new rape variety of further cultivating height resistance to sclerotinia sclerotiorum providesNew breeding material.

5.BnWRKY33 transgene rape plant significantly improves resistance to sclerotinia sclerotiorum, significant to the production of rape.

6.BnWRKY33 is accredited as sclerotinia rot of colza resistant gene, and the biological function of illustrating BnWRKY33 gene is hadSignificance.

The discovery of this sclerotinia rot of colza resistant gene of 7.BnWRKY33, for excavating and the antibacterial core ospc gene of qualification crop,And the molecular mechanisms of action of the antibacterial core ospc gene of further investigated, there is important theory directive significance; In the anti-sclerotiniose of cropBreeding practice, breed improvement and variety popularization all have important practical advice and are worth.

Brief description of the drawings:

Fig. 1 is that the amino acid sequence of BnWRKY33 and other species WRKY33 is compared; Wherein being abbreviated as of each species: Bn(Brassicanapus): cabbage type rape; Bo(Brassicaoleracea): cauliflower; Cr(CapsellaRubella): shepherd's purse; AtPu-protein(Thellungiellahalophilaunnamedprotein): little salt mustard;AtPu-protein(ArabidopsisthalianaputativeWRKY33): arabidopsis; Al(ArabidopsisLyrata): south, remote mountains is situated between; RcTF(Ricinuscommunistranscriptionfactor): castor-oil plant; Jc(JatrophaCurcas): tung tree. What black region showed is identical amino acid, and what gray area showed is similar amino acid,WRKYGQK is WRKY domain, marks with square frame.

Fig. 2 is the reaction that BnWRKY33 infects sclerotinite.

Fig. 3 is that BnWRKY33 expression vector 1300-35S-WRKY33-NOS builds schematic diagram;

Fig. 4 is the qualification of rape BnWRKY33 transgenic line; " just " be the PCR of 1300-35S-WRKY33-NOS carrierPositive control. #1 is respectively 20 transgenic lines to #20. " bear " as the contrast of non-transgenic wild type.

Fig. 5 is that RT-PCR detection transgenosis is crossed BnWRKY33 expression in expression strain and non-transgenic wild type strainComparison; WT is the contrast of non-transgenic wild type; #6, #8, #10 are transgenic line independently.

Fig. 6 was the resistance to sclerotinia sclerotiorum comparison of express transgenic strain and non-transgenic wild type strain; WT is the non-base that turnsBecause of wild type contrast; #8 is transgenic line.

Fig. 7 was the comparison of express transgenic strain and the expansion of non-transgenic wild type strain sclerotiniose scab; WT is non-The contrast of transgenosis wild type; #6, #8, #10 are transgenic line independently.

Detailed description of the invention

The separation clone of embodiment 1:BnWRKY33 gene

(1) separation of BnWRKY33 gene and clone

So that two No. 9 kinds are as experiment material in cabbage type rape, growth conditions is: temperature is 20 ± 2 ° of C; HumidityFor 60-90%; Photoperiod every day is the dark 16h of illumination 8h; Intensity of illumination is 44 μ molm^–2s^–1。

The synthetic employing UNIQ-10 pillar Trizol kit of the extraction of the total RNA of rape leaf and cDNA (is purchased from ShanghaiHandsome Bioisystech Co., Ltd), use DNase I (precious bioengineering (Dalian) Co., Ltd) to remove in total RNA and be mixed withA small amount of DNA, finally detect the integrality of total RNA with 1% agarose gel electrophoresis. The synthetic of cDNA reverses according to MMLVThe operating instruction of record enzyme reagent kit (Pu Luomaige (Beijing) Bioisystech Co., Ltd) is carried out, 50 μ mol/L for primerOligo (dT) 18(ThermoFisherScientific). Then use primer BnWRKY33-F (5 '-ATGGCTGCTTCTTCCCTTC-3 ') and BnWRKY33-R (5 '-TCAAGACAAAAACGAATCAAAG-3 ') order increasesBand, then PCR product cloning is entered to pMD18-T carrier (precious bioengineering (Dalian) Co., Ltd). Object fragmentReclaim, connect and transform with reference to UNIQ-10 pillar DNA glue and reclaim kit (the limited public affairs of raw work bioengineering (Shanghai) shareDepartment) operate. The linked system of object fragment and T carrier is: 4.6 μ L object fragments, 0.4 μ LpMD-18T carrier, 5μ LSolution I (precious bioengineering (Dalian) Co., Ltd) connects and spends the night at 16 DEG C. Be sent to the biological work of raw workThe order-checking of journey (Shanghai) limited company.

(2) BnWRKY33 gene order structural analysis

Through order-checking, find the long 1452bp of being of nucleotide sequence of this gene, the ORFs that contains a total length, makesCarry out the comparison of several amino acids sequence by ClustalX (Thompsonetal., 1997) program and find, this object barThe WRKY33 of band and arabidopsis, cauliflower, shepherd's purse, little salt mustard, south, remote mountains Jie, castor-oil plant and tung tree has very on amino acid levelsHigh homology (Fig. 1). Therefore, this gene is named as BnWRKY33. Be submitted to GenBank, accession number isKF712488. BnWRKY33 contains two WRKY domains, carries CX separately on it_4-5CX_22-23HX₁The zinc fingers of H,Belong to I class (Eulgemetal., the TheWRKYsuperfamilyofplant of WRKY transcription factor familyTranscriptionfactors[J], TrendsPlantSci,, 55 phase of volume 199-206 pages in 2000). Comparison discovery,These sequences all have the Key residues aspartic acid relevant to interactions between protein in the WRKY of C end conservative domain site（Chengetal.，StructuralandFunctionalAnalysisofVQMotif-ContainingProteinsinArabidopsisasInteractingProteinsofWRKYTranscriptionFactors[J], PlantPhysiology,, 159 2 phase of volume 810-825 pages in 2012). Meanwhile, at relatively conservative N-end, all containHave 4-5 serine-proline residue site, it may be potential map kinase phosphorylation site (Sharrocksetal.，Dockingdomainsandsubstrate-specificitydeterminationforMAPkinases[J], TrendsBiochemSci,, 25 9 phase of volume 448-453 pages in 2000). Find by software PSORTII prediction, thisThe nuclear localization signal that contains high conservative in a little protein sequences.

The reaction of embodiment 2:BnWRKY33 to sclerotinite

(1) processing of sclerotinite

Brassica Napus Seedling when one heart stage (four leaf) the 3rd leaf is carried out to the inoculation processing of sclerotiniose pathogen sclerotinite, before processingPlant is carried out to 23 DEG C of constant temperature culture 4～5 days, and then blade is placed in dark surrounds moisturizing 24h. Then use the mycelia of sclerotinitePiece is inoculated, and contrast connects with sterile culture matrix. 0h, 12h, 24h, 36h, 48h sampling after inoculation respectively.

(2) extraction of cabbage type rape RNA

Utilize the handsome Bioisystech Co., Ltd in plant Trizol(Shanghai) its total RNA of reagent extracting.

(3) real-time quantitative PCR

Quantitative fluorescent PCR uses SYBR GreenRealtimePCRMasterMix – Plus – kit (precious rawThing engineering (Dalian) Co., Ltd), adopt B.napusUBC21 (ubiquitin-conjugatingenzyme21) to doFor internal standard gene, primer is synthesized by Sangon Biotech (Shanghai) Co., Ltd.. The primer of UBC21 be F:5 '-CCTCTGCAGCCTCCTCAAGT-3 ' and 5 '-CATATCTCCCCTGTCTTGAAATGC-3 ', the primer order of BnWRKY33 geneRow: 5 '-AGAGGACGGTTACAACTGGAGAAA-3 ' and5 '-TGTCGGACAGCTTGGGAAAG-3 '. Fluorescent quantitationReaction system is 20 μ L: contain SYBRMix10 μ L, the each 0.8 μ L of forward and reverse primer (10 μ mol/L), template 2 μ L andThe sterilized water that DEPC processed. Amplification condition is: 95 DEG C, and 30sec; Then 95 DEG C of 5s, 60 DEG C of 30s, 72 DEG C of 27s, 40Circulation; Eachly be circulated in 72 DEG C of renaturation ends and carry out fluoroscopic examination. Reaction finishes to be first heated to 95 DEG C afterwards, is then down to 72 DEG C,Slowly be warming up to 95 DEG C, the variation of recording fluorescence signal, draws the melting curve of amplified production again. Every group of experiment all completes threeBiology repeats, and each biology repeats at least to do three technology and repeats. Detecting BnWRKY33 induces rape sclerotinite respectivelyBlade 0-48h Expression change.

First taking solubility curve as standard, utilize ABI (Applied biosystems) model for QPCR7300 instrument instituteThe software 7300System-SDSShell carrying, optimizes internal standard gene and genes of interest PCR reaction condition, makes it amplification and producesThing is special. This experiment, taking rape BnUBC21 as internal standard gene, is measured respectively the Ct value of BnUBC21 and genes of interest, gets that it is averageValue, obtains the DCt of genes of interest to internal standard gene by Ct method relatively, then (turns by its value taking the blade of water treatment as referenceChange 1 into) obtain respectively the DDCt of other processing, finally estimate relative expression's value of genes of interest by 2-DDCt, and obtainSystematic error.

Result demonstration, in the time that sclerotinite is infected 24h, the transcriptional level of BnWRKY33 raises 9.1 times, when sclerotinite is infectedWhen 48h, the expression of BnWRKY33 improves 11 times (Fig. 2) compared to not inoculating sclerotinite bacterial strain. Rape BnWRKY33 couple is describedInfecting of sclerotinite has significant response.

Embodiment 3: cross the acquisition of expressing BnWRKY33 transgene rape plant

(1) plant expression vector construction

Design primer 5 '-gaattcTTAATTAAGAGCTCGCATGCC-3 ' and 5 '-GgtaccGTCCCCGTGTTCTCTCCAA-3 ', from pEGAD carrier, (be purchased from precious bioengineering (Dalian) has the means of employing PCRLimit company) in amplification obtain CaMV35S fragment, be then connected to pCAMBIA1300 carrier and (be purchased from Beijing ancient cooking vessel state prosperityBiotechnology Co., Ltd) EcoRI/KpnI restriction enzyme site; Design simultaneously primer 5 '-GgatccGAATTTCCCCGATCGTTCAA '-3 ' and 5 '-aagcttGATCTAGTAACATAGATGACACCGC-3 ', with PCR fromIn pEGAD carrier, amplification obtains CaMVNos fragment, and the BamHI/HindIII enzyme that is connected to pCAMBIA1300 carrier is cutSite, obtains pCAMBIA1300-35S-Nos carrier. Restriction endonuclease EcoRI used, KpnI, BamHI and HindIII are all purchased fromTreasured bioengineering (Dalian) Co., Ltd, enzyme tangent condition is 37 DEG C of standing 12h. Then design primer 5 '-GgtaccATGGCTGCTTCTTCCCTTC-3 ' and 5 '-ggatccTCAAGACAAAAACGAATCAAAG-3 ', with cabbage type rapeCDNA is that template is carried out pcr amplification, and obtaining required length is the object segment of 1473kb, is connected to pCAMBIA1300-On the KpnI/BamHI restriction enzyme site of 35S-Nos, reaction system is: I.KpnI1ul, 10*Hbuffer1ul, DNA1ul(2ug), ddH207ul; II.BamHI1ul, 10*Kbuffer1ul, DNA1ul (2ug), ddH207ul, is placed on37 DEG C of standing 12h. Thereby be created to cabbage type rape BnWRKY33 transgenic over expression carrier 1300-35S-WRKY33-NOS, contains the selection markers of moisture resistance mycin in its T-DNA district, the promoter of BnWRKY33 overexpression is 35s promoter(Fig. 3).

(2) genetic transformation of rape

1300-35S-WRKY33-NOS is proceeded to Agrobacterium GV3101, contaminate rape flower three times, each five minutes. ContaminateStep is:

(1) in the test tube that contains corresponding antibiotic LB fluid nutrient medium, cultivate the Agrobacterium that contains recombinant plasmidGV3101, then accesses in 10% ratio the triangular flask that contains corresponding antibiotic LB fluid nutrient medium and makes Agrobacterium nutrient solutionFinal concentration is that OD600 is about 2.0 left and right.

(2) in culture medium, add conversion buffer solution:

0.1%Silwet-77

2ng/L6-BA

8mg/L acetosyringone

(3) the whole bud part of not opening of rape is immersed in to 3-5min in Agrobacterium solution, shake makes gently simultaneouslyBud fully contacts agrobacterium liquid. The bud soaking is inserted in to sheepskin paper bag 24h, to keep bud to there is higher humidity,Avoid bud to be exposed to the sun in excessive sunlight, prevent that Agrobacterium from losing activity.

(4) every one day repeating step (3), and whole bud is enclosed within to 48h in sheepskin paper bag.

(5) soak after bow structure bundle, remove the sheepskin paper bag on inflorescence, shear the side shoot inflorescence and the process that newly bear and soak coloredThe new bud of sprouting in its top of inflorescence, and utilize colored silk thread to carry out anchor line (string) mark to the inflorescence of contaminating Agrobacterium, different heavyThe structure of group plasmid carries out label.

(6) plant is cultivated in normal pouring, and regularly wipes out newborn side shoot inflorescence and newborn bud, until seed becomesWhen ripe, stop irrigating. Results dry seeds. Carry out the screening of transformant by the selected marker of carrying on recombinant plasmid. By this sideMethod filters out a large amount of transfer-gen plants.

(3) transfer-gen plant qualification

The seed sprouting of results is first used the hygromycin selection of 25mg/L later, chooses the plant of moisture resistance mycin, extracts geneGroup, identifies with PCR, primer used be 5 '-CTTCGCAAGACCCTTCCTC-3 ' and 5 '-GgatccTCAAGACAAAAACGAATCAAAG-3 '. Contrast is wild type non-transgenic plant (WT).

Testing result shows (Fig. 4), positive control and #1-#2, #4-#9, #11-#15, these 17 transformed plants of #17-#20All can amplify the big or small electrophoretic band (1021bp) of expection, negative control does not have electrophoretic band, shows transgenic rapeIn dish genome, contain foreign gene DNA fragmentation.

(4) cross the RT-PCR qualification of expressing BnWRKY33 transgene rape

In order to determine BnWRKY33 overexpression whether in rape, sampling RT-PCR method is analyzed, BnWRKY33Amplimer be 5'AGAGGACGGTTACAACTGGAGAAA3' and 5'TGTCGGACAGCTTGGGAAAG3', internal referenceGene is UBC21, its amplimer 5 '-CCTCTGCAGCCTCCTCAAGT-3 ' and 5 '-CATATCTCCCCTGTCTTGAAATGC-3 ', the raw work in Shanghai is synthetic. PCR program: 95 DEG C of denaturation 30S, then follow through 40Ring (95 DEG C of 10s, 57 DEG C of 10s, 72 DEG C of 26s).

As shown in the figure, the BnWRKY33 expression of #6, #8, #10 strain is significantly higher than not genetically modified wild type contrast,Show #6, #8, #10 strain be three independently BnWRKY33 cross express transgenic strain.

Embodiment 4:BnWRKY33 crosses the evaluation of the anti-sclerotiniose of express transgenic rape

The 4th true leaf that turns BnWRKY33 positive plant of getting four one heart stages of leaf of above-mentioned PCR test positive carry out fromBody inoculation. Blade is cut and is placed in ceramic whiteware dish, and each rotaring gene plant blade contrasts with non-transgenic and is placed side by side in a dish,Blade lower berth one deck wet gauze, gets the φ 5mm mycelia piece of fresh preparation, has facing down of mycelia, is inoculated in blade middle part slightlyDepart from the position of master pulse, two mycelia pieces of every leaf inoculation. Cover with Pan Kou with ventilated membrane and be beneficial to moisturizing, then put 22 DEG C of dark trainingsSupport.

After cultural hypha, 12h starts observed and recorded mycelia a situation arises, and it is raw that after cultivating, 24h starts observational record bacterial plaqueLong amount, every 24h once, until mycelia grows in vitro limb edge.

Isolated leaf inoculation qualification result shows that transfer-gen plant obviously strengthens resistance to sclerotinia sclerotiorum. As shown in Figure 6 and Figure 7,It is medium and small more a lot of than non-transgenic strain that sclerotinite scab is crossed growth area in express transgenic strain at BnWRKY33, damageThe area of tissue is also little. Can find according to the growth area of sclerotinite, soft addling extremely occurs in after sclerotinite inoculation 24h,And rapidly, in the time of 48h, its growth area reaches maximum in growth during 36-48h. #6, these three independent strains one of #8 and #10The identical trend of straight maintenance, and identical to the resistant phenotype of sclerotinite. In the time inoculating 48 hours, BnWRKY33 transfer-gen plantThe half that 6, #8 and #10 leaf spot lesion only contrast for wild type. Aspect the diffusion velocity of germ, can find that expression turned baseBecause the diffusion velocity of strain will obviously be delayed the diffusion velocity of scab in non-transgenic strain, in rape, BnWRKY33 has and carriesThe effect of high resistance to sclerotinia sclerotiorum.

Sequence table SEQ UENCELISTING

<110>Jiangsu University

<120>a kind of gene and application thereof of controlling sclerotinia rot of colza

<130>a kind of gene and application thereof of controlling sclerotinia rot of colza

<160>2

<170>PatentInversion3.3

<210>1

<211>1452

<212>DNA

<213>cabbage type rape (Brassicanapus)

<400>1

atggctgcttcttcccttcttcatatagacaataacacaaccagacaaaacatgagtggt60

tctgctaactggtcacgaagatcatcagcatctttggaagatcttgagatcccaaacttt120

agatcttttgctccttcttcagtctcaatctctccttcaacttgtttcagtccctctgtt180

ttcctcgattcccctgcgtttgttgcctcctctgctaacgttcttgcttctccaaccaca240

ggagctcttattacaaacgaaaacaatcagaaaaatgtagctaaggaagagaagaacaac300

aacattaactacttcgatttctcatttcagacacaatcatcaacactttctgcaccaaca360

acaacaacaacagcgacaaacagttctatctttcaatcacaggaacaagaaaggaagaac420

cagtcagatcaaaaatggaaccaaactctaaacaacagcaacactcatcaagctgtatct480

tacaatgtaagggagcaaaggaaaggagaggacggttacaactggagaaagtacggtcag540

aaacaggtgaaagggagcgagaatcctcggagttattacaagtgtactttcccaagctgt600

ccgacaaagaagaaagtcgagagatctttggaaggacagatcacggagattgtctataag660

ggaagccataaccatcctaaacctcaatccaccagaagatcatcttcttcttcttcaaca720

tttcactcggctgttttcaatgccagccttgataatagtttcagtcactctgattccctt780

gcaatccaacaagatgataacactacttctggttctgtcggagacgatgagtttgaacga840

ggctcatcggttgtcagcagagaagaagaatgtgggagtgaacctgaagcaaagagatgg900

aaaggagaaagtgaaacaaacggtgggaatggtaatggaagcaagacagtgagagagcca960

agaattgttgtgcagacaacaagtgatatcgacattcttgacgacggttacagatggaga1020

aaatacggccaaaaagtcgttaaaggaaacccaaacccaagaagctactacaagtgcaca1080

accttcggttgtccagtgagaaaacatgttgagagagcatcacatgatatgagagcagta1140

atcacaacctatgaagggaaacacaaccacgatgtacctgcagctcgtggtagcggatac1200

accacaaaccgactggcacaagatccttcttcagcaccaattagaccaaatgctattgct1260

ggtcaccctagttacactacttcttctcaagcaccgtatacgcttcaaatgctgcaccaa1320

aacaacaacactagcgccgggtcttttggttacgctacgaacaataataacttcctcggt1380

ggtggtttctctagagcaaaagaagaaccgaacgatgattcttcctctttctttgattcg1440

tttttgtcttga1452

<210>2

<211>483

<212>PRT

<213>cabbage type rape (Brassicanapus)

<400>2

MetAlaAlaSerSerLeuLeuHisIleAspAsnAsnThrThrArgGln

151015

AsnMetSerGlySerAlaAsnTrpSerArgArgSerSerAlaSerLeu

202530

GluAspLeuGluIleProAsnPheArgSerPheAlaProSerSerVal

354045

SerIleSerProSerThrCysPheSerProSerValPheLeuAspSer

505560

ProAlaPheValAlaSerSerAlaAsnValLeuAlaSerProThrThr

65707580

GlyAlaLeuIleThrAsnGluAsnAsnGlnLysAsnValAlaLysGlu

859095

GluLysAsnAsnAsnIleAsnTyrPheAspPheSerPheGlnThrGln

100105110

SerSerThrLeuSerAlaProThrThrThrThrThrAlaThrAsnSer

115120125

SerIlePheGlnSerGlnGluGlnGluArgLysAsnGlnSerAspGln

130135140

LysTrpAsnGlnThrLeuAsnAsnSerAsnThrHisGlnAlaValSer

145150155160

TyrAsnValArgGluGlnArgLysGlyGluAspGlyTyrAsnTrpArg

165170175

LysTyrGlyGlnLysGlnValLysGlySerGluAsnProArgSerTyr

180185190

TyrLysCysThrPheProSerCysProThrLysLysLysValGluArg

195200205

SerLeuGluGlyGlnIleThrGluIleValTyrLysGlySerHisAsn

210215220

HisProLysProGlnSerThrArgArgSerSerSerSerSerSerThr

225230235240

PheHisSerAlaValPheAsnAlaSerLeuAspAsnSerPheSerHis

245250255

SerAspSerLeuAlaIleGlnGlnAspAspAsnThrThrSerGlySer

260265270

ValGlyAspAspGluPheGluArgGlySerSerValValSerArgGlu

275280285

GluGluCysGlySerGluProGluAlaLysArgTrpLysGlyGluSer

290295300

GluThrAsnGlyGlyAsnGlyAsnGlySerLysThrValArgGluPro

305310315320

ArgIleValValGlnThrThrSerAspIleAspIleLeuAspAspGly

325330335

TyrArgTrpArgLysTyrGlyGlnLysValValLysGlyAsnProAsn

340345350

ProArgSerTyrTyrLysCysThrThrPheGlyCysProValArgLys

355360365

HisValGluArgAlaSerHisAspMetArgAlaValIleThrThrTyr

370375380

GluGlyLysHisAsnHisAspValProAlaAlaArgGlySerGlyTyr

385390395400

ThrThrAsnArgLeuAlaGlnAspProSerSerAlaProIleArgPro

405410415

AsnAlaIleAlaGlyHisProSerTyrThrThrSerSerGlnAlaPro

420425430

TyrThrLeuGlnMetLeuHisGlnAsnAsnAsnThrSerAlaGlySer

435440445

PheGlyTyrAlaThrAsnAsnAsnAsnPheLeuGlyGlyGlyPheSer

450455460

ArgAlaLysGluGluProAsnAspAspSerSerSerPhePheAspSer

465470475480

PheLeuSer

Claims (4)

1. control a gene BnWRKY33 for sclerotinia rot of colza, its sequence is nucleotide sequence shown in SEQIDNo.1.

2. the protein of a kind of gene BnWRKY33 coding of controlling sclerotinia rot of colza as claimed in claim 1, its sequence isAmino acid sequence shown in SEQIDNo.2.

3. a recombinant vector, it contains nucleotide sequence claimed in claim 1.

4. a kind of gene BnWRKY33 answering in control sclerotinia rot of colza of controlling sclerotinia rot of colza claimed in claim 1With.