CN102140446A - Application of rape iMyAP gene over-expression in sclerotinia sclerotiorum resistance of rape - Google Patents
Application of rape iMyAP gene over-expression in sclerotinia sclerotiorum resistance of rape Download PDFInfo
- Publication number
- CN102140446A CN102140446A CN 201110022642 CN201110022642A CN102140446A CN 102140446 A CN102140446 A CN 102140446A CN 201110022642 CN201110022642 CN 201110022642 CN 201110022642 A CN201110022642 A CN 201110022642A CN 102140446 A CN102140446 A CN 102140446A
- Authority
- CN
- China
- Prior art keywords
- rape
- imyap
- gene
- expression vector
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
An application of rape iMyAP gene over-expression in the sclerotinia sclerotiorum resistance of rape is that the complete coding sequence with intron of the iMyAP gene, which is directly cloned from the DNA of the rape genome through high-fidelity polymerase chain reaction (PCR), or the full-length CDS of the iMyAP gene, which is amplified from rape through the reverse transcription-polymerase chain reaction (RT-PCR) technology, is inserted behind the over-expression promoter to obtain an over-expression vector, and then the vector is introduced in the rape genome to obtain genetically modified rape. Therefore, the over-expression of the iMyAP gene in the genetically modified plant can be realized, the rape can be in a defense system priming state and the rape can have high sclerotinia sclerotiorum resistance, which has great significance for protecting high and stable rape yield.
Description
Technical field:
The invention belongs to biological technical field, be specifically related to a kind ofly utilize engineered means to make myrosin assist protein gene in rape, to cross to express, and then significantly improve the method for the anti-sclerotium disease of rape.
Background technology:
The pathogenic bacteria of sclerotium disease is bacterium cup fungi (Sclerotinia sclerotiorum (Lib) de bary), it is a kind of wide spectrum parasitic fungi, host range is wide, according to the statistics of Boland and Hall, and 408 kinds during sclerotinite can colonize in and 278 years of 75 sections belong to and 42 subspecies or mutation.The bacterium cup fungi also is a kind of important crop plants pathogenic bacteria, and in the whole world, produce to farm crop and bring about great losses its every year, as have a strong impact on tens kinds of particularly productions of high-quality farm crop of farm crop such as rape, soybean, Sunflower Receptacle, peanut, Kidney bean, safflower.At present, all there is discovery or popular in nearly 100 countries in five continents.Up to the present, also do not have to find the resistance resource of anti-fully sclerotium disease, this is encroached on the huge challenge that faces in the crop production.
In China, sclerotium disease is to influence the particularly important disease of quality rape output raising of rape.For alleviating the hazard rating of sclerotium disease to rape, people attempt to isolate the favourable resource of anti-sclerotium disease from different plant resourceses.Result of study to the anti-sclerotium disease of rape shows: on the dissimilar rape of sclerotinite parasitism, have the type that the pathogenic bacteria height is resisted, but also do not have to find the immunization type resource of anti-fully sclerotium disease.Owing to lack the resource of anti-sclerotium disease immunization type, cannot obtain material to sclerotium disease tool immunization type by cross-breeding.Just because of this, utilize engineered method to cultivate anti-sclerotium disease rape, in the present circumstance, this is an only way.We once carried out and are used for changeing rape from the Oxalate oxidase of wheat and strengthen the anti-sclerotium disease Research on ability of rape in 2002; Reports such as Liu Shengyi utilize to change the research that Oxalate oxidase strengthens the anti-sclerotium disease of rape (Liu et al, Plant Cell Report, 2005,24:133-144).But effect is not clearly.This just need seek the approach of new anti-sclerotium disease.
In Cruciferae rape and Chinese cabbage platymiscium, a kind of distinctive myrosin-sulphur glycosides system of defense (Glucosinolate-Myrosinase system) is arranged, now known this is a kind ofly to resist plant-feed insect and get effective system of defense of food (Giamoustaris and Mithen, 1995).(thioglucoside glucosidases, TGG), its effect is the hydrolysis of catalysis sulphur glycosides to have another name called sulfo-glucoside Polyglucosidase.Within plant tissue, myrosin (Myrosinase, EC 3.2.3.1) need with the conjugated protein (Myrosinase-bindingprotein of myrosin, MBP) and myrosin assist albumen (Myrosinase-associated proteins, MyAP) form a myrosin mixture jointly after, the sulphur glycosides could be hydrolyzed into multiple deleterious compounds such as lsothiocyanates, nitrile, oxazolidine thione or thiocyanic ester.These toxic compounds can play the effect that stops insect's food-taking.MyAP is the monomer glycoprotein of a 40kDa, it exists seed specific and vegetative organ to express two types: and seed myrosin assistance albumen (Seed-MyAP, sMyAP), sMyAP is a kind of protein of composing type, it is present in the seed specifically, as kind of a chrotoplast; Another kind is to be present in the vegetative organ, and it is under the situation that is subjected to wound (wounding), or induces at dormin and methyl jasmonic and to express down, be called induction type MyAP (inducible MyAP, iMyAP) (Taipalensuu, et al, 1997,247:963-971; Andreasson, et al, 1999,41 (2): 171-80).
We discover that iMyAP not only is subjected to wound, dormin and methyl jasmonic abduction delivering, but also is subjected to the sclerotinite abduction delivering.After forwarding to the expression cassette (iMyAP::GUS) of the promotor of iMyAP and GUS (β-Pu Taotanggansuanmei) gene fusion in the Arabidopis thaliana, after the Arabidopis thaliana that has an iMyAP::GUS sprays the toxin oxalic acid of sclerotinite, whole plant is blue after GUS dyeing, illustrate that iMyAP is expressed by the sclerotinite toxin-induced, sees Fig. 1.In addition, also find, in rape between representational anti-sclerotium disease material Hunan oil 15 and the susceptible material 98C40, be subjected to sclerotinite to induce the startup expression time difference of back iMyAP gene, iMyAP expression of gene in the resistant material Hunan oil 15 is seen Fig. 2 early than the iMyAP expression of gene of susceptible material 98,C40 12 hours.The favourable rape of in time expressing fast that the iMyAP gene is described improves sclerotium disease pathogenic bacteria generation resistance.
In order effectively to obtain the rape of high anti-sclerotium disease, the application adopts genetic engineering means, allows the iMyAP gene become the gene of expressing.Like this when not having sclerotinite to infect, iMyAP just begins to express in the rape body, make rape be in system of defense and trigger state (Priming), sclerotinite infected the generation rapid reaction, in time transfer the system of defense opposing infection process of self, realize reducing significantly sclerotinite produces harm to rape production purpose.
Summary of the invention:
Technical problem to be solved by this invention is: at above-mentioned the deficiencies in the prior art, provide a kind of rape myrosin to assist protein gene (iMyAP gene) to cross the application that is expressed in the anti-sclerotium disease of rape, be to set up a kind ofly to allow the iMyAP gene of abduction delivering became expressing gene in the original rape, and then rape obtained have the ability of high anti-sclerotium disease.
In order to solve the problems of the technologies described above, the technical solution used in the present invention is: the application of a kind of rape iMyAP gene in the anti-sclerotium disease of rape, its iMyAP gene order is seen SEQ ID NO.1.
Contain the application of expression vector in the anti-sclerotium disease of rape excessively of rape iMyAP gene, be characterized in: described cross expression vector be with by high-fidelity PCR directly from the encoding sequence of the complete band intron of the genomic DNA clone's of rape iMyAP gene, maybe the total length CDS of the iMyAP gene that will from rape, amplify by the RT-PCR technology be inserted into express promotor obtain later expression vector.
A kind of method that improves the anti-sclerotium disease of rape, be that the expression vector of crossing that will contain rape iMyAP gene imports the rape genome by agriculture bacillus mediated transgenic technology, make the iMyAP gene in the rape body, realize expressing, this cross expression vector be with by high-fidelity PCR directly from the encoding sequence of the complete band intron of the genomic DNA of rape clone's iMyAP gene, maybe the total length CDS of the iMyAP gene that will amplify from rape by the RT-PCR technology was inserted into the mistake expression vector that obtains later of expressing promotor.Thereby the system of defense that makes rape is in one triggers state (Priming) timely, in case the pathogenic bacteria sclerotinite spore of sclerotium disease is fallen the surface of rape plant, can make defensive raction immediately, realizes the purpose of anti-sclerotium disease.
Sclerotium disease is a broad spectrum fungus venereal disease evil, a large amount of breeding practices prove: can't cultivate the rape variety that this broad spectrum fungal disease of sclerotium disease is had complete resistance by traditional breeding way, because sclerotinite infect effective unlatching prior to the relevant system of defense of rape, in sclerotinite and these two adversarys of rape, the system of defense of rape is destroyed earlier often, and morbidity is dead.By engineered method, someone is transferred to oxalate oxidase gene in the rape, attempt to utilize the Oxalate oxidase sclerotinite of degrading to infect the toxin oxalic acid that produces behind the rape and reach and stop germ to be taken place, but the result is the rape that changes oxalate oxidase gene resistance to sclerotinia sclerotiorum there is not promoter action, because this method is in fact still after sclerotinite is infected, and be after producing toxin oxalic acid, missed the duration of response of defence.
Present method has the different of essence with other method, it is that the form of the gene induced expression of the intravital iMyAP of rape was changed into the form of expressing, make the system of defense of rape be in a real-time triggering (priming) state, in case sclerotinite contact rape surface is arranged, just can make rape in time produce defensive raction, stop infecting of sclerotinite.
Description of drawings:
Fig. 1 is the expression (blueness) that sclerotium disease sclerotinite toxin oxalic acid is induced gus gene among the iMyAP::GUS.
Fig. 2 is that sclerotinite is induced the different startup expression time of back iMyAP gene in anti-and susceptible material.
Fig. 3 is that the expression cassette of crossing that has the iMyAP gene complete encoding sequence makes up.
Fig. 4 is the incidence synoptic diagram of transgenosis and non-transgenic rape inoculation sclerotinite.
Embodiment:
Below in conjunction with accompanying drawing and example the present invention is further described, but is not intended to limit the scope of the invention.
Merge the expression cassette of formation with tobacco mosaic virus (TMV) 35S promoter (CaMV35S) with the total length CDS of iMyAP gene, improve the anti-sclerotium disease ability of swede type rape by transgenic technology and be embodiment:
1. material therefor reagent
Swede type rape (Brassica napus): kind is No. 15, Hunan oil; Susceptible variety 98C40 and its explant are cotyledon petiole.
Bacterial strain and plasmid: bacillus coli DH 5 alpha, pMD19-T carrier, pHB cross expression vector available from the precious biotechnology (Dalian) in Dalian company limited).Agrobacterium LBA4404 is that bacterial classification is preserved in plant metabolism laboratory, Agricultural University Of Hunan life science building.
Enzyme and chemical reagent: Taq
TMArchaeal dna polymerase is contained bio tech ltd available from new east station of Guangzhou.High-fidelity polysaccharase Pfu is available from TaKaRa company.Restriction enzyme, DNA T4 connect test kit available from Shenzhen U.S. biotechnology of crystalline substance company limited.Plasmid DNA purification kit, dna gel in a small amount reclaims test kit available from Changsha An Biao Bioisystech Co., Ltd.The RT-PCR test kit is the RevertAidTMFirst Strand cDNA Synthesis Kit of Fermentas company.PMD19-T connects test kit available from the precious biotechnology in Dalian company limited.Agarose: Spain produces.Yeast extract, peptone are available from OXOID.LTD.DNA Marker is available from TIANGEN Biotech (Beijing) Co., Ltd..CTAB, Tris-base, EDTANa
2, kantlex, careless fourth phosphine and other biochemical reagents all step biology and Chemical Reagent Co., Ltd., Sinopharm Group available from Europe.
2. step
1) iMyAP full length gene CDS clones and crosses expression vector establishment
IMyAP full length gene CDS clone:
Design of primers: the sequence (number of entering is Y10156) that goes up the swede type rape myrosin assistance protein gene 12 (iMyAP12) of GenBank announcement according to website NCBI (http://www.ncbi.nlm.nih.gov/), adopt primer primer5 design primer Primer1 and Primer2, iMyAP full length gene CDS is used to increase, and, add BamHI and XbaI enzyme cutting site respectively at 5 of upstream and downstream primer ' end according to the restriction enzyme digestion sites of expression vector pHB.Primer is synthetic by Nanjing Jin Site biotech firm.Primer sequence is as follows:
Primer1:5 ' GGATCCATGGCAACCACCTTCAGTTTAGCGA ' 3 sees SEQ ID NO.2;
(italic is the recognition sequence of BamHI)
Primer2:5 ' TCTAGACTACATAGATTCACTGGCACTGACGACA ' 3 sees SEQ ID NO.3;
(italic is the recognition sequence of XbaI)
RT-PCR amplification iMyAP full length gene CDS: with No. 15 swede type rape Hunan of Hunan oil No. 15 blades of oil is material, extracts the total RNA of rape leaf with reference to the TRIZOL method.According to the RevertAidTM First Strand cDNA Synthesis Kit operation steps of Fermentas company, reverse transcription obtains cDNA.Be masterplate with cDNA again, adopt following reaction system and thermal cycle conditions amplification iMyAP full length gene CDS, its sequence is seen SEQ ID NO.1.
PCR reaction system (30 μ L system):
Damping fluid 3 μ L
Ultrapure water 22.4 μ L
Template 2 μ L
DNTP 0.8 μ L (10mM stores liquid)
Each 0.5 μ L (200 μ M) of iMyAP F/R
Pfu enzyme 0.8 μ L
The thermal cycling program:
94 ℃ of pre-sex change 4 minutes, 94 ℃ of sex change 40 seconds, 60 ℃ of annealing 40 seconds, 72 ℃ were extended 90 seconds, circulates after 30 times, and extension is 10 minutes after 72 ℃, 16 ℃ of preservations.Gene-amplificative instrament is a Biometra T type.
The amplified production of PCR carries out agarose gel electrophoresis, and agarose concentration is 1.5%, and voltage 60V is about electrophoresis time 1hr.The observation of taking pictures of gel analysis system.The recovery of PCR product is reclaimed the Kit explanation with reference to An Biao Gel and is carried out.
The PCR product connects and sequencing analysis: by the PCR product that above-mentioned high-fidelity Pfu polymeric enzymatic amplification obtains, add the A tail earlier after, be connected to and make up the pMD19-iMyAP intermediate carrier on the pMD19-T carrier.After changing the pMD19-iMyAP carrier over to bacillus coli DH 5 alpha again, send Nanjing Jin Site biotech firm to carry out sequencing, its sequence is seen SEQ ID NO.1.Then sequencing result is carried out the homology compare of analysis on American National Information Network NCBI, going up the Blast comparison through GenBank shows, the iMyAP12 dna homolog that this sequence and NCBI go up login has reached 100%, this sequencing result is described and reported sequence is consistent.
The structure of iMyAP gene overexpression carrier:
Cut pHB with enzyme simultaneously with BamHI and two restriction enzymes of XbaI and cross expression vector and pMD19-iMyAP carrier.Two kinds of enzymes are cut product separate, with two object tapes of glue recovery test kit recovery of An Biao through agarose gel electrophoresis.With two object tapes (being respectively the total length CDS and the linearizing pHB expression vector of the iMyAP gene) mixing that reclaims in the gel, by the connection of spending the night of 16 ℃ of T4 ligase enzymes.The total length CDS of iMyAP gene is connected to CaMV35S promotor back on the pHB carrier, is built into pHB-iMyAP and crosses the expression vector (see figure 3).The pHB-iMyAP carrier that builds is transferred in the agrobacterium tumefaciens lba4404 by freezing molten method, is used for the conversion of next step rape.
2) genetic transformation of swede type rape
Select full grains, particle shape is normal, do not have split do not have the susceptible variety 98C40 seed sterilization of going mouldy after, seed evenly is seeded on the 1/5MS substratum, place 25 ℃ of darkrooms to cultivate 4-5 days, launch to cotyledon.From the top of cotyledonary node, downcut the cotyledon of band handle as the conversion explant with aseptic scalpel.After explant is contaminated in carrying the Agrobacterium LBA4404 solution of pHB-iMyAP carrier, cotyledon petiole is kept flat in the flat board of MB (not added with antibiotic) substratum, cultivate screening and culturing in the flat board that is transferred to the MB substratum that is added with 10mg/L grass fourth phosphine after 2-3 days in the darkroom altogether.Per two weeks are changed a fresh culture, and the seedling that differentiates is transferred on the 1/2MS substratum, by the time grow flourishing root system, open and seal film one day, seedling are transferred in the vermiculite again and practice 1～2 week of seedling.Change over to afterwards in the basin dress soil and place the outdoor solid maturation that is cultured to.
3) detection of transgene rape
Because the iMyAP gene is from rape genome itself, the detection of transfer-gen plant need utilize the CaMV35S sequence on the pHB-iMyAP carrier to design a forward PCR and detect primer Primer3, and another designs an inverse PCR primer Primer4 on iMyAP full length gene CDS.It is as follows that PCR detects primer sequence:
Primer3:5 ' GGATTGATGTGATAACATGGTGGAG 3 ' sees SEQ ID NO.4;
Primer4:5 ' AACTGATGCATTGAACTTGACGAAC 3 ' sees SEQ ID NO.5.
4) resistance to sclerotinia sclerotiorum is identified:
Get cabbage type rape variety 98C40 and iMyAP and cross various 5 strains of express transgenic plant, about 20 ℃ growths in the growth room when treating plant length to 5 true leaves, are used for inoculation experiments.Sclerotium disease pathogenic bacteria sclerotinite earlier on the potato substratum in 28 ℃ of growths about 2-3 days, treat that mycelial growth is covered with the substratum plate after, be used for inoculation experiments.Earlier mycelia is cut into bacterium piece big or small about 1 square centimeter together with substratum, with the upper surface of bacterium piece left-hand thread at blade, four leaves are got in every strain then, bacterium piece of inoculation on the every leaf.Plant with inoculation moves into the growth room then, and keeps relative humidity greater than 90%.A situation arises to check the blade face scab after two weeks.
3. result
Utilize agrobacterium mediation method that the total length CDS of iMyAP gene is imported in the genome of cabbage type rape variety 98C40,, obtain the anti-careless fourth phosphine plant of 256 strains altogether by screening.Utilize Primer3/Primer4 to detect primer the PCR that carries out is detected, wherein 6 strains have pcr amplification product, and the PCR molecular weight of product that amplifies size is identical with the molecular weight of expection, illustrates to obtain transfer-gen plant.
The transfer-gen plant present age (T0) selfing obtains the transgenosis homozygote of T2 after two generations, get 5 strains and be used for inoculation test from T2 transgenosis homozygote, 4 bacterium pieces of every strain inoculation; Contrast 98C40 does same processing.Two week of inoculation, the back was observed scab, and the result shows on whole 20 leaves of contrast 98C40 all has scab to form, and forms the also withered (see figure 4) of bacterium piece on 20 leaves of transfer-gen plant without any scab.Expressing the iMyAP gene can effectively improve the resistivity of rape to the sclerotium disease sclerotinite excessively in rape in explanation.
Claims (3)
1. the application of rape iMyAP gene in the anti-sclerotium disease of rape, its iMyAP gene order is seen SEQ ID NO.1.
2. contain the application of expression vector in the anti-sclerotium disease of rape excessively of rape iMyAP gene, it is characterized in that: described cross expression vector be with by high-fidelity PCR directly from the encoding sequence of the complete band intron of the genomic DNA clone's of rape iMyAP gene, maybe the total length CDS of the iMyAP gene that will from rape, amplify by the RT-PCR technology be inserted into express that promotor obtains later expression vector.
3. method that improves the anti-sclerotium disease of rape, be that the expression vector of crossing that will contain rape iMyAP gene imports the rape genome by agriculture bacillus mediated transgenic technology, make the iMyAP gene in the rape body, realize expressing, this cross expression vector be with by high-fidelity PCR directly from the encoding sequence of the complete band intron of the genomic DNA of rape clone's iMyAP gene, maybe will be inserted into and express the mistake expression vector that promotor obtains later by the total length CDS of the iMyAP gene that from rape, amplifies by the RT-PCR technology.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110022642 CN102140446A (en) | 2011-01-20 | 2011-01-20 | Application of rape iMyAP gene over-expression in sclerotinia sclerotiorum resistance of rape |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110022642 CN102140446A (en) | 2011-01-20 | 2011-01-20 | Application of rape iMyAP gene over-expression in sclerotinia sclerotiorum resistance of rape |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102140446A true CN102140446A (en) | 2011-08-03 |
Family
ID=44408243
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110022642 Pending CN102140446A (en) | 2011-01-20 | 2011-01-20 | Application of rape iMyAP gene over-expression in sclerotinia sclerotiorum resistance of rape |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102140446A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103911384A (en) * | 2014-01-21 | 2014-07-09 | 江苏大学 | Gene for controlling Sclerotinia sclerotiorum (Lib.) de Bary of Brassica napus L. and use thereof |
| CN106397555A (en) * | 2016-12-13 | 2017-02-15 | 湖南农业大学 | Sclerotinia sclerotiorum lectin SSL-6 protein and encoding gene and application thereof |
| CN112626259A (en) * | 2021-01-13 | 2021-04-09 | 华中农业大学 | Method for identifying sclerotinia rot resistant rape strain and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2007299219A1 (en) * | 2006-04-05 | 2008-03-27 | Metanomics Gmbh | Process for the production of a fine chemical |
-
2011
- 2011-01-20 CN CN 201110022642 patent/CN102140446A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2007299219A1 (en) * | 2006-04-05 | 2008-03-27 | Metanomics Gmbh | Process for the production of a fine chemical |
Non-Patent Citations (4)
| Title |
|---|
| 《Eur J plant pathol》 20100916 Rahmanpour等 Reaction of glucosinolate-myrosinase defence system in brassica plants to pathogenicity factor of sclerotinia sclerotiorum 429-433 第128卷, 第4期 2 * |
| 《Plant science》 20070503 Bo yang等 Transcriptional profiling of canola(Brassica napus L.)responses to the fungal pathogen sclerotinia sclerotiorum 156-171 第173卷, 第2期 2 * |
| 《分子植物育种》 20100728 尹峰 等 iMyAP基因过表达载体转化甘蓝型油菜 708-712 第8卷, 第4期 2 * |
| 《湖南农业大学学报（自然科学版）》 20070228 阮颖 等 植物硫代葡萄糖苷-黑芥子酶底物酶系统 18-22 第33卷, 第1期 2 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103911384A (en) * | 2014-01-21 | 2014-07-09 | 江苏大学 | Gene for controlling Sclerotinia sclerotiorum (Lib.) de Bary of Brassica napus L. and use thereof |
| CN103911384B (en) * | 2014-01-21 | 2016-05-25 | 江苏大学 | A kind of gene and application thereof of controlling sclerotinia rot of colza |
| CN106397555A (en) * | 2016-12-13 | 2017-02-15 | 湖南农业大学 | Sclerotinia sclerotiorum lectin SSL-6 protein and encoding gene and application thereof |
| CN112626259A (en) * | 2021-01-13 | 2021-04-09 | 华中农业大学 | Method for identifying sclerotinia rot resistant rape strain and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106086058B (en) | Method for reducing fruiting time of cordyceps militaris and improving fruiting yield | |
| Chen et al. | Large-scale insertional mutagenesis in Magnaporthe oryzae by Agrobacterium tumefaciens-mediated transformation | |
| CN110734482B (en) | Lilium regale WRKY transcription factor gene LrWRKY4 and application thereof | |
| CN113604490B (en) | Kiwi fruit canker susceptibility gene AcBXL1 and application thereof | |
| CN105861517A (en) | Panax notoginseng antimicrobial peptide gene PnSN1 and application thereof | |
| CN111424022A (en) | Verticillium dahliae VdEG target gene fragment for pathogen-resistant bacteria, interference vector and application thereof | |
| CN101358190A (en) | Artificial synthetic high gene order expression high virulence protein for lepidoptera pest and use thereof | |
| CN102329818B (en) | Method for introducing stress-resistant gene to transgenic 741 poplar | |
| CN116444636B (en) | Rice OsGLP3-6 for inhibiting sclerotinia and application thereof | |
| CN102140446A (en) | Application of rape iMyAP gene over-expression in sclerotinia sclerotiorum resistance of rape | |
| CN116425847B (en) | Rice OsGLP8-10 for inhibiting sclerotinia and application thereof | |
| CN110982715B (en) | High-spore-yield purple-spore-bacterium-gene engineering bacterium delta PlflbD and construction method and application thereof | |
| CN114480416B (en) | Application of tsaoko AtDRM2 gene in improving cold resistance of plants | |
| CN110747208B (en) | Cassava nitrate reductase gene and construction and disease-resistant application of overexpression vector thereof | |
| CN104878027B (en) | Yangbi bulla walnut ribonuclease gene JsRNase and application | |
| CN110423702B (en) | High-spore-yield purple-spore-bacterium-gene engineering bacterium delta PlflbC and construction method and application thereof | |
| CN109825456B (en) | Marina marine bacillus E40208a1 and application thereof | |
| CN102628052A (en) | Rice disease resistance related gene, encoding protein thereof and preparation method for strain for improving rice broad spectrum disease resistance | |
| CN101892242A (en) | Ammopiptanthus mongolicus cold-resistant gene AmEBP1 | |
| CN103088035B (en) | Application of soybean agglutinin gene lec-s | |
| CN102586269A (en) | Ammopiptanthus mongolicus cold resistant gene AmGS | |
| CN115807010B (en) | Honeysuckle leaf glandular hair-growing gene and application thereof | |
| CN112195178B (en) | Tomato late blight-resistant long-chain non-coding RNA-lncRNA40787, cloning method and application method thereof | |
| CN113025621B (en) | Application of CIPK14 gene in improving drought resistance of pigeon pea | |
| CN114591984B (en) | Application of OsAP79 gene in inducing rice to resist brown planthoppers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20110803 |