CN102628052A - Rice disease resistance related gene, encoding protein thereof and preparation method for strain for improving rice broad spectrum disease resistance - Google Patents

Abstract

The invention discloses a method for improving the rice disease resistance by using a broad spectrum disease resistance related gene modifier of scnl n rice (OsMOS) and belongs to the technical field of rice genetic engineering. The method comprises the following steps of: cloning a full-length complementary deoxyribonucleic acid (cDNA) of the OsMOS gene from rice nipponbare, connecting the full-length cDNA to a plant carrier, and building overexpression of the OsMOS gene by initiating the expression of the gene by using a constitutive promoter CaMV35S; obtaining a transgenic plant by agrobacterium tumefaciens-mediated transformation; and selecting a marked gene hygromycin and a target gene OsMOS through multiplex polymerase chain reaction (PCR) detection, detecting free salicylic acid (FreeSA) in the transgenic rice, and performing inoculation identification on rice bacterial leaf blight resistance. Results show that the content of the FreeSA in the OsMOS overexpression transgenic plant is obviously higher than that in a contrast plant, and the OsMOS overexpression transgenic plant is higher in disease resistance to rice bacterial leaf blight. Therefore, the method for obtaining the strain for improving the rice broad spectrum disease resistance is provided.

Description

A kind of preparation method who improves paddy rice broad spectrum resistance strain of paddy disease-resistant related gene and proteins encoded thereof and acquisition

Technical field

The present invention relates to technical field of rice gene engineering, specifically is from paddy rice Japan is fine, to clone OsMOSFull length gene cDNA Transform through rice genetic, obtain OsMOSThe gene overexpression transfer-gen plant carries out the mensuration of analysis of bacterial leaf-blight disease resistance and salicylic acid content respectively to transfer-gen plant and non-transgenic plant.The result shows OsMOSGene and paddy rice broad-spectrum disease resistance performance significant correlation.

Background technology

Paddy rice is not only important crops, or the important model animals in the molecular biology of plants research field.In the Rice Production process,, be the important difficult problem that grain-production faces owing to receive the influence of diseases such as rice blast, hypochnus, bacterial leaf-blight always.Prevent and treat under the condition existing, the whole nation reaches 20,000,000,000 kilograms because of various rice diseases cause the paddy underproduction every year on average.On producing at present is main with pesticide control mainly still, but is to use the pesticide control disease that certain pesticide residue are arranged, and has influence on grain security, and the virus disease of some paddy rice, does not have the specific pesticide control at present, and disease is in case take place to make paddy rice underproduction 10%-20%.The disease of paddy rice is brought tremendous loss on giving and producing, and directly has influence on the grain security of country.

Therefore, study and prevent and treat rice disease and have crucial meaning.Facts have proved that cultivating and utilizing disease-resistant variety is to address the above problem most economical and effective means.Traditional breeding for disease resistance since need disease-resistant germ plasm resource prolonged preservation, periodically breed and identify, must cost many, workload is big, plants losing of resource but also be accompanied by part inevitably; Even obtain new anti-source, the problem that the hybridization of plant level reorganization also exists new disease-resistant proterties and bad proterties to introduce simultaneously, breeding cycle is long, resistance parent lacks and inefficient awkward situation thereby be difficult to break away from, and is difficult to be able to promote.And often be to use the disease-resistant gene (R gene) of some specialization to improve and improve the disease-resistant performance of plant mostly through the present of genetically engineered improvement.But this special resistant gene loses resistance through regular meeting along with the variation of pathogenic bacteria microspecies.

Plant is in the long-term evolution process; In order to resist the infringement of pathogenic micro-organism; Exist derivable disease resistance response in the plant materials, comprise SAR (System Acquired Resistance system obtains resistance) and ISR (Induced Systemic Resistance induced systemic resistance).The SRA approach is maximum approach of studying at present.After pathogenic infected, the non-position of infecting was all keeping the enhancing resistance to this cause of disease and some other cause of diseases in one period long term, i.e. systemic acquired resistance (systemic acquired Resistance, SAR) or resistance of wide spectrum.A key gene controlling this SAR is NPR1(non-expresser of PR genes). NPR1Anchorin repeat sequence protein of genes encoding (ankyrin repeat) was in clone and report in the model animals Arabidopis thaliana in 1997. NPR1Just regulating and control the SAR reaction in the Arabidopis thaliana, overexpression in Arabidopis thaliana NPR1After, can obviously strengthen the resistance of Arabidopis thaliana to pathogenic micro-organism, and NPR1Disappearance can cause the PR gene not expressed, and the forfeiture of plant SAR resistance.Cloned again in the Arabidopis thaliana at present MOS, SNC1, NPR4Key gene etc. a series of controlling plant SAR reactions. SNC1(suppressor of npr-1, constitutive, 1) is one type of TIR-NBS-LRR type broad spectrum antidisease gene, in Arabidopis thaliana, clones and reports. MOS(modifier of scn1) is another the important resistance of wide spectrum gene in the SAR signal path, the nucleoporin that contains Nup96 of encoding. MOS3Cross in the Arabidopis thaliana of expressing, the expression that salicylic content obviously improves and induction phase is answered pathogenesis-related proteins PR1 and PR2 in the plant body, thus strengthen the disease-resistant performance of plant to various pathogenic micro-organisms.Yet, but in paddy rice, also do not appear in the newspapers at present OsMOS,The present invention finds in the paddy rice OsMOS (Modifier of scn1 in rice), with in the Arabidopis thaliana MOS3Compare, have similar sequence, all contain the nucleoporin of a Nup96, controlling going out nuclear and going into the nuclear transportation of material and information, show resistance of wide spectrum simultaneously various pathogenic bacterias.

Summary of the invention

Goal of the invention:

The present invention utilizes overlapping pcr (overlap PCR) in paddy rice Japan is fine, to clone and isolate a broad-spectrum disease resistance genes involved first OsMOSSaid gene order of gene cDNA total length and protein sequence are shown in sequence table SEQ ID NO:1 and SEQ ID NO:2.

The present invention utilizes gene engineering method, crosses expression through making goal gene, has made up OsMOSCross expression vector.A kind of preferable embodiment is provided, said gene is efficiently expressed in the correlated expression carrier.

The invention provides the preferable genetic transformation embodiment of a cover that transforms above-mentioned expression vector host cell.

The present invention relates to the clone and analyze a kind of OsMOSThe cDNA total length of gene.This gene improves the salicylic content of paddy rice free state and gives the disease generation resistance that paddy rice causes bacterial leaf-blight.Thereby identify the role of this gene in disease resistance response, lay the foundation for utilizing this gene to cultivate paddy rice broad-spectrum disease resistance performance.

The present invention sets forth OsMOSThe clone of gene and functional verification process.After changing plant over to, a kind of method is provided for improving plant broad spectrum antidisease property.

Beneficial effect:

Advantage of the present invention:

MOSBe the key gene in the SAR signal pathway, in the broad spectrum resistance of plant, play crucial effect.The present invention is report and Arabidopis thaliana in paddy rice first MOSGenes involved OsMOS, and clone paddy rice through overlapping PCR OsMOSThe cDNA total length.Will OsMOSImport in the paddy rice, make it cross expression, obtain the transgenic progeny paddy rice.Functional verification first OsMOSCross to express and obviously improved the salicylic content of free state in the paddy rice body, bacterial leaf-blight is had tangible resistance in spire phase and boot stage.For reducing rice pest, improve the paddy rice broad spectrum resistance, a kind of new solution route is provided.

Description of drawings

Fig. 1 is the salicylic content histogram of the free state of transfer-gen plant and adjoining tree;

Fig. 2 be Fig. 2 transfer-gen plant with adjoining tree in spire phase and boot stage the different resistances to bacterial leaf-blight, wherein A is the spire phase, B is boot stage;

Fig. 3 is the electrophorogram of the fine RNA of paddy rice Japan.

Embodiment:

Embodiment 1

1. the Trizol method is extracted the fine total RNA of Japan

(1) take by weighing that 0.1g is fresh, the tender Japanese fine blade of children ( Oryza.Sativa L.spp.japonica, var nipponbare, AA genome,Identifier Cheng Beijiu professor), adds liquid nitrogen and grind rapidly, transfer in the centrifuge tube (liquid nitrogen precooling) of 1.5mL.And in centrifuge tube, add 1mL Trizol, place 10min on ice;

(2) 4 ℃, 13000rpm, centrifugal 20min;

(3) shift supernatant and newly manage, add the 5M NaCl of 250uL in one, 250uL chloroform/primary isoamyl alcohol, concuss 15S places 3 min on ice;

（4）4℃，13000rpm，15min；

(5) transfer in another new centrifuge tube, adds 500uL Virahol mixing clearly, and room temperature is placed 10min;

（6）4℃，13000rpm，15min；

(7) supernatant discarded adds 500uL 75% ethanol, washing;

(8) 4 ℃, 7500rpm, 5min outwells ethanol, is placed upside down on the paper, and room temperature is put dried;

(9) add 20 ~ 30uL DEPC water, behind 65 ℃ of water bath heat preservation 15-30min, centrifugal;

(10) detect.Electrophoresis detection: get the water-soluble RNA of 2 μ L DEPC, (0.25% YLENE is blue or green, 0.25% tetrabromophenol sulfonphthalein to add 1 μ L sample-loading buffer; 30% aqueous glycerin solution), 1.2% agarose gel electrophoresis detects, and under gel imaging system, observes after 20 minutes; It is thus clear that tangible 3 bands; Be respectively 5S, 18S, 28S.18 S are that the twice of 28S is bright.And through the NanoDrop detection, A260/A280 is 1.933, and RNA concentration is 1779.40 ng/ μ L.Show that the fine RNA of paddy rice Japan extracts successfully.As shown in Figure 3.

Two-step approach reverse transcription (promega reverse transcription test kit)

(1) reverse transcription system:

Total RNA 2 μ L

25mM Mgcl ₂ 4μL

Reverse Transcription 10X Buffer 2μL

10mM dNTP Mixture 2μL

Ribonuclease inhibitor(1μg /μL) 0.5μL

Oligo(dT) ₁₅ Primer (0.5μg/μL) 1μL

MMLV Reverse Transcriptase(15u/μL) 1μL

Nuclease-Free Water 7.5μL

Total 20 μL

(2) careful mixing, 42 ℃ of temperature are bathed 40min, and 95 ℃ of heating 5min place the 5min termination reaction on ice then, promptly obtain corresponding reverse transcription product cDNA.

Overlapping pcr amplification OsMOSGene

According to OsMOSThe distribution situation of intron in the gene, utilize 4 pairs of primers of primer-design software design (AF, AR, BF, BR), wherein AF contains restriction enzyme site BamH I, BR contains restriction enzyme site SacI.AR and BF oppositely repeat.Primer sequence is following: referring to SEQ NO:5-8, be specially:

AF：5'-cgc GGATCCATGTCTTCCGACCCGGTGTT-3'

AR：5'-AGTATTCATTGTAAAGAGCCAGAGCGTCAT-3'

BF：5'-ATGACGCTCTGGCTCTTTACAATGAATACT-3'

BR：5'-gcc GAGCTCTCAGTCCCTGCAAAGTATGT-3

Primer AF, AR amplifies OsMOSThe A section, primer BF, BR amplifies OsMOSThe B section is utilized primer AF, BR then, and is right through overlapping pcr amplification OsMOSThe gene cDNA total length.

OsMOSThe amplification of section

(1) PCR reaction system:

10×PCRbuffer 5μL

10mM dNTP 5μL

10 μ M primer AF, 1 μ L

10 μ M primer AR, 1 μ L

Pfu polymerase 0.5μL

cDNA 2μL

ddH ₂O 35.5μL

Total 50μL

(2) optimum reaction condition is: 94 ℃ of preparatory sex change 10min

94 ℃ of sex change 30 s

35 circulations of 52 ℃ of annealing 30 s

72 ℃ are extended 3 min

72 ℃ are extended 10min

3.2 OsMOSThe amplification of B section

(1) PCR reaction system

10×PCRbuffer 5μL

10mM dNTP 5μL

10 μ M primer BF, 1 μ L

10 μ M primer BR, 1 μ L

Pfu polymerase 0.5μL

cDNA 2μL

ddH ₂O 35.5μL

Total 50μL

(2) optimum reaction condition is: 94 ℃ of preparatory sex change 10min

94 ℃ of sex change 30 s

35 circulations of 58 ℃ of annealing 30 s

72 ℃ are extended 3 min

72 ℃ are extended 10min

3.3 OsMOS CDNA Total length (A section+B section)

(1) PCR reaction system

10×PCRbuffer 5μL

10mM dNTP 5μL

10 μ M primer AF, 1 μ L

10 μ M primer BR, 1 μ L

Pfu polymerase 0.5μL l

A section PCR reclaims product 1 μ L

B section PCR reclaims product 1 μ L

ddH ₂O 35.5μL

Total 50μL

(2) optimum reaction condition is: 94 ℃ of preparatory sex change 10min

94 ℃ of sex change 30 s

35 circulations of 57 ℃ of annealing 30 s

72 ℃ are extended 5 min

72 ℃ are extended 10min

Product after the amplification is electrophoresis on the 0.8 % sepharose that contains 0.5 μ g/mL ethidium bromide (Ethidium Bromide). OsMOSA section size is 1475 bp, and its nucleotides sequence is classified sequence table SEQ ID No:3 as; OsMOSB section size is 1543 bp, and its nucleotides sequence is classified sequence table SEQ ID No:4 as; OsMOSTotal length is 3018 bp, and its nucleotides sequence is classified sequence table SEQ ID No:1 as.

5. PCRThe purifying of amplified fragments

(1) carries out agarose gel electrophoresis, separate the fragment of wanting purifying;

(2) downcut the target DNA band with clean aseptic operation cutter and put into preweighted 1.5 mL eppendorf pipe;

(3) per 0.1 g sepharose need add 200 uL S1 solution;

(4) in 50 ℃ of incubations, melt fully until agarose;

(5) per 5 ug (less than 5 ug are in 5 ug) DNA need add 5 uL DNA and combine liquid (glass powder suspension), puts upside down mixing gently, places 10 min on ice;

(6) centrifugal 20 s of room temperature 6000 rpm;

(7) abandon supernatant, add 700 uL ethanol washing lotions, suction gently suspends glass powder, places 5 min on ice;

(8) repeat (6), (7) step, 6000 rpm, centrifugal 20 s; Abandon supernatant, carefully remove whole raffinates;

(9) add 30～50 uL TE, blow and beat suspension glass powder gently, 50 ℃ of incubation 10 min;

(10) centrifugal 20 s of room temperature 6000 rpm suct clearly extremely new eppendorf pipe, and are subsequent use in 20 ℃ of preservations of 4 ℃ Huo –.

6. cross the structure of expression vector

OsMOS full length gene sequence with above-mentioned purifying; Be connected to cloning vector pMD18-T Vector (precious biotech firm), be transformed into again in the DH5 α competent cell (precious biotech firm), select positive bacterium colony and be inoculated into 5mL and contain in the LB liquid nutrient medium of 100mg/L penbritin (Amp); Cultivated 12-16 hour in 37 ℃, the shaking table of 200rpm; Extract plasmid, obtain containing the segmental recombinant plasmid of purpose, sequence verification is correct.Pass through then BamH I, SacI enzyme respectively cuts and contains OsMOSPMD18 positive colony and P1301 plant expression vector (preserve in this laboratory, and the preparation method of P1301 plant expression vector is with reference to the patent No.: 201110208640.8).The endonuclease reaction system is 30 μ L, and is as follows:

Reclaim respectively OsMOSThe big fragment of gene fragment and plant expression vector.Add each composition shown in the according to the form below, the crawl mixing is in 16 ℃ of connections of spending the night.

Transform DH5 α competent cell then, on the LB solid medium that contains kantlex (Kan), carry out the screening of recon, cut and sequence verification through enzyme respectively.

Plant expression vector transforms agrobacterium tumefaciens EHA105

(1) preparation of Agrobacterium competent cell

Go bail for the Agrobacterium EH105 that deposits ( Agrobacterium tumefaciensEH105 for preserving in Agricultural University Of Anhui biophysics laboratory, is known bacterial strain commonly used) rule 28 ℃ of dark cultivations in containing on the 50 μ g/mL Rifampin YEB solid plates; Picking list colony inoculation in 5mL YEB liquid nutrient medium, 28 ℃ of shaking culture 12-16h of 220 rpm; Get 2 mL bacterium liquid and transfer in 100mL YEB liquid nutrient medium, 28 ℃ of shaking culture of 220 rpm are to OD ₆₀₀=0.5; Change aseptic centrifuge tube over to, centrifugal 5 min of 5000rpm remove supernatant, add the CaCl of the 0.15M of 10mL precooling ₂Solution, suspension cell is placed 20 min on ice gently; 4 ℃, centrifugal 5 min of 5000 rpm remove supernatant, add the CaCl of 0.15 M that contains 10% glycerine of 4 mL precoolings ₂Solution suspends gently; Agrobacterium suspension is sub-packed in the aseptic Eppendorf pipe, and every pipe 200 μ L quick-frozen 1min in liquid nitrogen is frozen in-70 ℃.

(2) expression vector transforms Agrobacterium EH105

The expression vector DNA of getting 1 μ g joins in the 200 μ L EH105 competent cells mixing; Quick-frozen 1min in the liquid nitrogen, 37 ℃ of water-bath 5min add 1mL YEB liquid nutrient medium, and 28 ℃ of 150rpm shake training 4h; The centrifugal 30sec of 10000rpm abandons supernatant, adds 0.1mL YEB liquid nutrient medium, again suspension cell; Coat on the YEB solid plate that contains 100 μ g/mL Kan and 50 μ g/mL Rifampins, cultivate about 48h for 28 ℃.

(3) evaluation of positive colony

The single bacterium colony that grows on the picking flat board is inoculated in the YEB liquid nutrient medium that contains 100 μ g/mL Kan and 50 μ g/mL Rifampins, and 28 ℃ of shaking culture are to OD ₆₀₀About=0.5; Get 3 μ L bacterium liquid and do the positive colony that template is carried out bacterium colony PCR evaluation Agrobacterium.Amplification condition is: 94 ℃ of preparatory sex change 5min; 94 ℃ of sex change 30s, 57 ℃ of annealing 30 s, 72 ℃ of extension 5 min, 35 circulations; Last 72 ℃ are extended 10 min.Through the PCR checking, expression vector has imported among the Agrobacterium EHA105.

Agriculture bacillus mediated rice genetic transforms

After rice paddy seed is sterilized through peeling; Be seeded on the inducing culture 30 ℃ and carry out continuous light and cultivate, the back picking has differentiated callus about 10d seed and Agrobacterium are contaminated 30min, utilize aseptic filter paper to blot bacterium liquid then; Change on the common substratum 22 ℃ of dark culturing 3 days over to.Take out seed asepsis water and clean 5 times, in containing the sterilized water of Pyocianil, rock 30min after, take out callus aseptic filter paper suck dry moisture.Change over to and select on the substratum, 30 ℃ are carried out continuous light and cultivate.The callus that picking soya bean size comes off behind the 30d changes division culture medium over to and carries out differentiation culture, when seedling to be broken up grows to the 5cm left and right sides, moves on to seedling in the pipe of taking root and to carry out root culture, after root system forms fully, can refine seedling and be transplanted to the land for growing field crops.

The evaluation of transgenic paddy rice

9.1 the Molecular Detection of transgenic paddy rice

Extract genome through the CTAB method, transfer-gen plant is carried out multiplex PCR detect.Through the selection markers gene hygromix phosphotransferase (Hyg) among the amplification plant expression vector P1301, identify the transgenic positive plant.The upstream and downstream primer sequence is following: see SEQ NO:9-10, be specially:

HygF： 5’-ACTCACCGCGACGTCTGT-3’

HygR： 5’-TTTCTTTGCCCTCGGACG-3’

The PCR reaction system:

10×PCRbuffer 5μL

10mM dNTP 5μL

10 μ M primer HygF, 1 μ L

10 μ M primer HygR, 1 μ L

Taq polymerase 0.5μL

The fine genome 2 μ L of Japan

ddH ₂O 35.5μL

Total 50μL

Reaction conditions is: 94 ℃ of preparatory sex change 10min

94 ℃ of sex change 30 s

35 circulations of 57 ℃ of annealing 30 s

72 ℃ are extended 2 min

72 ℃ are extended 10min

Obtain the positive transfer-gen plant of 1009 bp Hyg dna fragmentations through amplification.

The CTAB method is extracted genomic step:

(1) gets 1 g rice leaf, clean, add silica sand, PVP (Vinylpyrrolidone polymer), liquid nitrogen, grind dress

In the 5 mL dorf pipe;

(2) add 195 μ L β – mercaptoethanols;

(3) adding 1950 μ L1.5 % CTAB (cetyl trimethylammonium bromide) shakes up;

(4) 65 ℃ of water-bath 20 min whenever shake up 1 time at a distance from 5 min gently;

(5) add 1500 μ L chloroform/primary isoamyl alcohol (24: 1) mixed solutions, shake up centrifugal 10 min of 10000 rpm gently;

(6) get supernatant, add 60 ℃ of water-baths, 10 % CTAB, 195 μ L, chloroform/primary isoamyl alcohol (24: 1) 1950 μ L, centrifugal 10 min of 10000 rpm.Repeating the 5th goes on foot twice;

(8) get supernatant, add NaAc 195 μ L, absolute ethyl alcohol 2600 μ L, shake up centrifugal 5 min of 10000 rpm gently;

(9) abandon supernatant, wash 3 times with 3 mL, 75 % ethanol, inversion is dried;

(10) add the dissolving of 50 μ L autoclaving distilled waters;

(11) get 1 μ L DNA on the NanoDrop detector, according to A ₂₆₀/ A ₂₈₀Value is judged DNA purity, and purity is 1.873, and concentration is 1325.67ng/ μ L.Show that oryza sativa genomic dna extracts successfully;

9.2 free state Whitfield's ointment (Free SA) Determination on content in the transgenic paddy rice body

With reference to (Nawrath.et al., Salicylic Acid Induction-Deficient Mutants of ArabidopsisExpress PR2 and PR5 and Accumulate High Levels of Camalexin after Pathogen Inoculation. The Plant Cell, 1999,11:1393-1404) report of document also improves.Utilize performance liquid chromatography (HPLC), free state salicylic acid content in the rotaring gene plant blade is measured.Concrete determination step is following:

(1) takes by weighing rice leaf 0.2 g, after liquid nitrogen fully grinds, transfer in the 5 mL dorf pipe;

(2) methyl alcohol of adding 2 mL 80%, the 500ng o-anisic acid, vortex 30 s, down dark, ultrasonic 20 min;

(3) 4 ℃, centrifugal 15 min of 15000 rpm shift supernatant in another new pipe;

(4) residue adds 1.5 mL100% methyl alcohol, vortex vortex 30 s, dark ultrasonic 20 min down;

(5) repeating step 3, and merge supernatant in step 3;

(6) 40 ℃ of Rotary Evaporators are evaporated to about 100 μ L, and it is subsequent use that taking-up is placed on refrigerator;

(7) add the trichoroacetic acid(TCA) of 1 mL5% in 6, vortex 30 s, ultrasonic 5 min;

(8) 4 ℃, 10000 rpm, centrifugal 15 min;

(9) shift supernatant in clean 5 a mL dorf pipe, add 1 mL ETHYLE ACETATE: pentamethylene (1:1),

4 ℃, 10000 rpm, centrifugal 15 min extract organic phase to new pipe;

(10) residue, repeating step 9 merges organic phase.Vacuum-drying is to about 100 μ L.

(11) add 100 μ L methyl alcohol, vortex 30 s, ultrasonic 5 min.

(12) behind the 0.45nm membrane filtration, be used for HPLC.

The ratio row shared according to peak area calculate contrast and the content of crossing free state SA in the expression plant 1,2,3 respectively, do 3 repetitions respectively.As can beappreciated from fig. 1, OsMOSCross express Free SA in the plant content apparently higher than the non-transgenic plant.Show OsMOSGene is participated in the broad-spectrum disease resistance signal pathway of SA signal mediation.

The disease resistance of transgenic paddy rice detects

(1) utilize bacterial leaf-blight Anhui microspecies ( Xanthomonas oryzae pv.oryzae, identifier Wang Wenxiang, be so kind as to give the academy of agricultural sciences in Anhui Province), on potato culture, the inclined-plane was cultivated 2-3 days down for 28 ℃, was diluted to about 9 * 10 with sterilized water ⁹The concentration of individual/mL is subsequent use.(reference literature Sun et al., Xa26, a gene conferring resistance to Xanthomonas oryzae pv. oryzaeIn rice, encodes an LRR receptor kinase-like protein. Plant J, 2004, the report of 37:517-527), adopt leaf-cutting method that the fine spire of Japan phase and boot stage are inoculated.

(2) illness analysis of bacterial leaf-blight

Respectively to the inoculating of seedling phase and boot stage, after 18 days, the sick area of investigation inoculation blade, the ratio of scab length and blade length.Assess the power of plant resistance as standard.Can find out like Fig. 2, OsMOSCrossing the expression plant shows the tangible resistance of bacterial leaf-blight.

SEQUENCE LISTING

<110>Agricultural University Of Anhui

<120>;

A kind of preparation that improves paddy rice broad spectrum resistance strain of paddy disease-resistant related gene and proteins encoded thereof and acquisition

Method

<130>;

<160>; 10

<170>; PatentIn version 3.3

<210>; 1

<211>; 3018

<212>; DNA

<213>Artificial sequence

<400>; 1

atgtcttccgacccggtgtt ccccgtgctc cgccatggcg attacttcac caagccgtcg 60

atcgatgagctggtggagag ggaggcggct gaccctggct actgcagcag ggtcccggat 120

ttcgtcgtcgggagggtcgg gtatgggcga attcacttcc ccggtgacac tgatgtgagg 180

gggatggacctgaatgggat cgttaagttc ggtaggcact ctgtggaggt ttacaaggat 240

gaggctagcaagccgccttt agggcaaggt cttaataagc cagcagaagt gacgttgatg 300

ctgaatttgagcgtgcttcc agagcctagc gctcttgggg agttgcttaa gtgtcaaacg 360

agaaagcaaggcgctaggtt cgtttcgttc aaccactcga gcggcaggtg gaagttcgag 420

gttgatcattttagtcgatt cggtcttgtg gacgaggagg aagaggatgt tgtgatggat 480

gaggtggttgttcggcagcc tattgcggaa gtaagagacc cacctgcaaa tggtcatgag 540

ctggagctttcacgttcgtt gcctgctcat cttgggcttg accctgcaaa gatgcatgaa 600

atgcggatgacgatgttctc caatgaggaa ggtgatgaag atatggagga tggattccca 660

tctgatcagagatacttcag cagtgagaag atgaatgtgg attcaccgaa ctcaagtgct 720

aaaggtttgaggctaaggtc tctctctcct ttgcatggtt cttctctgaa agtcagcagg 780

agacctggtgtaattggtag gagagaacca caggctctgc tggaatacag tgtaaattct 840

tcagaacatggcccatcttc tcatggtatt cttatgtctg ggcaaaacaa gggatttcca 900

gtgagaatgaccaaggtgga tggctttaag ttgccatctg atcaggaaac tcctgtggct 960

gggaacgtatattccaattg tgttgtggat gctgctttat ttatgggcag gtcatttcgt 1020

gttggttggggaccaaatgg catccttgta cattctggca gtcttgtcaa tagacccgga 1080

actggtctatcttctgttat tcacatagag aaagttgcag gcgacaaagt tgtacgtgat 1140

gagaagaacaaaattaagga ggagctgact gatctgtgct tctcagaccc gctggatctc 1200

cataggaggcttcatcatga atatctggag actgagtctg acttgtttaa attgaagctt 1260

cagaaggttgtggcaagtcg ctttgtgttg ccagatattt gcagatctta tattgacatc 1320

attgaaaggcagcttgaagt cagtgattta tctatgtctt ctcgtgtgct gttaatgcac 1380

caggttacagtttgggagct tattcgggtc ttgttctcag aaagagcaac tggtaaccag 1440

ttagagcctactggtgatga ggaccaggag gggatgattt tagataagaa agaaggtact 1500

gttgccatagaccttgaagc actccctttg gttagaagag cagactttag caattggtta 1560

caggacagtgtttgtcatcg ggttcaagga gaggcgggct ccttaaatga tgccaggtat 1620

ctggaacatattattctgct tttgactggt cggcaattag acacagccac agaagttgct 1680

gcctttaggggtgatgttcg actggcaatt ttgctaagcc aggcaggtgg gtcaatgcta 1740

aatcgttctgacctttctca gcaactggat ctatggaaaa caaatggtct ggattttgat 1800

tatattcaggaagacaggtt aaagatatat gagttgcttt ctggtaatgt acaaggcgcg 1860

ttggtagattcatcaattga ctggaaacgg taccttggtt taataatgtg gtatcaacta 1920

tcacctgatgcatcacttga tattatcatt cactcttatc accagctcct tggtgagggc 1980

aaagtcccatatcctgtacc tgtatatata gatgaaggac cccttgatga gtcacttcaa 2040

tggtccccaggtgaccgctt tgacatatcc ttttatctaa tgctgcttca tgcaaatcaa 2100

gacgagaagtttgggatgct aaaaactatg ttcagtgcat tctcatcttc atatgatccc 2160

ttggactaccatatgatctg gcatcagtgt tccattctgg aagctatcgg tgctttcagt 2220

tcaaatgatcttcatgtgct agatttgagt tttgtttacc aattattgtg tctggggaag 2280

tgccattgggctatctatgt cattctacat atgcctcatc ttgatgacgc cccatacatc 2340

catgagaagttgatcaggga aattttgtca caatattgcg aatcatggag caaggatgaa 2400

actcagagagtttatattgc agaacttggt attccagtag aatggatgca tgacgctctg 2460

gctctttacaatgaatacta tggagatcag caaagcgcac tggagaatta tattctgtgt 2520

ggcaactggaagaaagccca tacaattttc atgacatcca ttgctcattc tttgtttctg 2580

tcatctaagcatcaagagat ctgggacatt acaagctctt tggaggttca caagtctgaa 2640

attgctgactgggaacttag tgctggaata tacatagact tcttcattct aagaaattct 2700

atgcaagaaaaaagtaccat ggatgatcca gatcaacttg agaagaaaaa tgaatcatgc 2760

agcactttctttggccggtt aaatgattca ttgatagtct ggggaagtaa attacctgtt 2820

gaggcaagggcatgcttctc gaagatggca gaggagctgt gcgagctact aatgaactcc 2880

cccggcgagggcttgacgcc agatctctac atgggctgct ttcagacgat gcttaacgct 2940

cctgtgcccgacgaccacag gtcatcctac ctgcaagagg cggtctctgt tttcaccgac 3000

atactttgcagggactga 3018

<210>; 2

<211>; 1005

<212>; PRT

<213>Artificial sequence

<400>; 2

Met Ser Ser Asp Pro Val Phe Pro Val Leu Arg His Gly Asp Tyr Phe

1 5 10 15

Thr Lys Pro Ser Ile Asp Glu Leu Val Glu Arg Glu Ala Ala Asp Pro

20 25 30

Gly Tyr Cys Ser Arg Val Pro Asp Phe Val Val Gly Arg Val Gly Tyr

35 40 45

Gly Arg Ile His Phe Pro Gly Asp Thr Asp Val Arg Gly Met Asp Leu

50 55 60

Asn Gly Ile Val Lys Phe Gly Arg His Ser Val Glu Val Tyr Lys Asp

65 70 75 80

Glu Ala Ser Lys Pro Pro Leu Gly Gln Gly Leu Asn Lys Pro Ala Glu

85 90 95

Val Thr Leu Met Leu Asn Leu Ser Val Leu Pro Glu Pro Ser Ala Leu

100 105 110

Gly Glu Leu Leu Lys Cys Gln Thr Arg Lys Gln Gly Ala Arg Phe Val

115 120 125

Ser Phe Asn His Ser Ser Gly Arg Trp Lys Phe Glu Val Asp His Phe

130 135 140

Ser Arg Phe Gly Leu Val Asp Glu Glu Glu Glu Asp Val Val Met Asp

145 150 155 160

Glu Val Val Val Arg Gln Pro Ile Ala Glu Val Arg Asp Pro Pro Ala

165 170 175

Asn Gly His Glu Leu Glu Leu Ser Arg Ser Leu Pro Ala His Leu Gly

180 185 190

Leu Asp Pro Ala Lys Met His Glu Met Arg Met Thr Met Phe Ser Asn

195 200 205

Glu Glu Gly Asp Glu Asp Met Glu Asp Gly Phe Pro Ser Asp Gln Arg

210 215 220

Tyr Phe Ser Ser Glu Lys Met Asn Val Asp Ser Pro Asn Ser Ser Ala

225 230 235 240

Lys Gly Leu Arg Leu Arg Ser Leu Ser Pro Leu His Gly Ser Ser Leu

245 250 255

Lys Val Ser Arg Arg Pro Gly Val Ile Gly Arg Arg Glu Pro Gln Ala

260 265 270

Leu Leu Glu Tyr Ser Val Asn Ser Ser Glu His Gly Pro Ser Ser His

275 280 285

Gly Ile Leu Met Ser Gly Gln Asn Lys Gly Phe Pro Val Arg Met Thr

290 295 300

Lys Val Asp Gly Phe Lys Leu Pro Ser Asp Gln Glu Thr Pro Val Ala

305 310 315 320

Gly Asn Val Tyr Ser Asn Cys Val Val Asp Ala Ala Leu Phe Met Gly

325 330 335

Arg Ser Phe Arg Val Gly Trp Gly Pro Asn Gly Ile Leu Val His Ser

340 345 350

Gly Ser Leu Val Asn Arg Pro Gly Thr Gly Leu Ser Ser Val Ile His

355 360 365

Ile Glu Lys Val Ala Gly Asp Lys Val Val Arg Asp Glu Lys Asn Lys

370 375 380

Ile Lys Glu Glu Leu Thr Asp Leu Cys Phe Ser Asp Pro Leu Asp Leu

385 390 395 400

His Arg Arg Leu His His Glu Tyr Leu Glu Thr Glu Ser Asp Leu Phe

405 410 415

Lys Leu Lys Leu Gln Lys Val Val Ala Ser Arg Phe Val Leu Pro Asp

420 425 430

Ile Cys Arg Ser Tyr Ile Asp Ile Ile Glu Arg Gln Leu Glu Val Ser

435 440 445

Asp Leu Ser Met Ser Ser Arg Val Leu Leu Met His Gln Val Thr Val

450 455 460

Trp Glu Leu Ile Arg Val Leu Phe Ser Glu Arg Ala Thr Gly Asn Gln

465 470 475 480

Leu Glu Pro Thr Gly Asp Glu Asp Gln Glu Gly Met Ile Leu Asp Lys

485 490 495

Lys Glu Gly Thr Val Ala Ile Asp Leu Glu Ala Leu Pro Leu Val Arg

500 505 510

Arg Ala Asp Phe Ser Asn Trp Leu Gln Asp Ser Val Cys His Arg Val

515 520 525

Gln Gly Glu Ala Gly Ser Leu Asn Asp Ala Arg Tyr Leu Glu His Ile

530 535 540

Ile Leu Leu Leu Thr Gly Arg Gln Leu Asp Thr Ala Thr Glu Val Ala

545 550 555 560

Ala Phe Arg Gly Asp Val Arg Leu Ala Ile Leu Leu Ser Gln Ala Gly

565 570 575

Gly Ser Met Leu Asn Arg Ser Asp Leu Ser Gln Gln Leu Asp Leu Trp

580 585 590

Lys Thr Asn Gly Leu Asp Phe Asp Tyr Ile Gln Glu Asp Arg Leu Lys

595 600 605

Ile Tyr Glu Leu Leu Ser Gly Asn Val Gln Gly Ala Leu Val Asp Ser

610 615 620

Ser Ile Asp Trp Lys Arg Tyr Leu Gly Leu Ile Met Trp Tyr Gln Leu

625 630 635 640

Ser Pro Asp Ala Ser Leu Asp Ile Ile Ile His Ser Tyr His Gln Leu

645 650 655

Leu Gly Glu Gly Lys Val Pro Tyr Pro Val Pro Val Tyr Ile Asp Glu

660 665 670

Gly Pro Leu Asp Glu Ser Leu Gln Trp Ser Pro Gly Asp Arg Phe Asp

675 680 685

Ile Ser Phe Tyr Leu Met Leu Leu His Ala Asn Gln Asp Glu Lys Phe

690 695 700

Gly Met Leu Lys Thr Met Phe Ser Ala Phe Ser Ser Ser Tyr Asp Pro

705 710 715 720

Leu Asp Tyr His Met Ile Trp His Gln Cys Ser Ile Leu Glu Ala Ile

725 730 735

Gly Ala Phe Ser Ser Asn Asp Leu His Val Leu Asp Leu Ser Phe Val

740 745 750

Tyr Gln Leu Leu Cys Leu Gly Lys Cys His Trp Ala Ile Tyr Val Ile

755 760 765

Leu His Met Pro His Leu Asp Asp Ala Pro Tyr Ile His Glu Lys Leu

770 775 780

Ile Arg Glu Ile Leu Ser Gln Tyr Cys Glu Ser Trp Ser Lys Asp Glu

785 790 795 800

Thr Gln Arg Val Tyr Ile Ala Glu Leu Gly Ile Pro Val Glu Trp Met

805 810 815

His Asp Ala Leu Ala Leu Tyr Asn Glu Tyr Tyr Gly Asp Gln Gln Ser

820 825 830

Ala Leu Glu Asn Tyr Ile Leu Cys Gly Asn Trp Lys Lys Ala His Thr

835 840 845

Ile Phe Met Thr Ser Ile Ala His Ser Leu Phe Leu Ser Ser Lys His

850 855 860

Gln Glu Ile Trp Asp Ile Thr Ser Ser Leu Glu Val His Lys Ser Glu

865 870 875 880

Ile Ala Asp Trp Glu Leu Ser Ala Gly Ile Tyr Ile Asp Phe Phe Ile

885 890 895

Leu Arg Asn Ser Met Gln Glu Lys Ser Thr Met Asp Asp Pro Asp Gln

900 905 910

Leu Glu Lys Lys Asn Glu Ser Cys Ser Thr Phe Phe Gly Arg Leu Asn

915 920 925

Asp Ser Leu Ile Val Trp Gly Ser Lys Leu Pro Val Glu Ala Arg Ala

930 935 940

Cys Phe Ser Lys Met Ala Glu Glu Leu Cys Glu Leu Leu Met Asn Ser

945 950 955 960

Pro Gly Glu Gly Leu Thr Pro Asp Leu Tyr Met Gly Cys Phe Gln Thr

965 970 975

Met Leu Asn Ala Pro Val Pro Asp Asp His Arg Ser Ser Tyr Leu Gln

980 985 990

Glu Ala Val Ser Val Phe Thr Asp Ile Leu Cys Arg Asp

995 1000 1005

<210>; 3

<211>; 1475

<212>; DNA

<213>OsMOS gene cDNA A section sequence

<400>; 3

atgtcttccgacccggtgtt ccccgtgctc cgccatggcg attacttcac caagccgtcg 60

atcgatgagctggtggagag ggaggcggct gaccctggct actgcagcag ggtcccggat 120

ttcgtcgtcgggagggtcgg gtatgggcga attcacttcc ccggtgacac tgatgtgagg 180

gggatggacctgaatgggat cgttaagttc ggtaggcact ctgtggaggt ttacaaggat 240

gaggctagcaagccgccttt agggcaaggt cttaataagc cagcagaagt gacgttgatg 300

ctgaatttgagcgtgcttcc agagcctagc gctcttgggg agttgcttaa gtgtcaaacg 360

agaaagcaaggcgctaggtt cgtttcgttc aaccactcga gcggcaggtg gaagttcgag 420

gttgatcattttagtcgatt cggtcttgtg gacgaggagg aagaggatgt tgtgatggat 480

gaggtggttgttcggcagcc tattgcggaa gtaagagacc cacctgcaaa tggtcatgag 540

ctggagctttcacgttcgtt gcctgctcat cttgggcttg accctgcaaa gatgcatgaa 600

atgcggatgacgatgttctc caatgaggaa ggtgatgaag atatggagga tggattccca 660

tctgatcagagatacttcag cagtgagaag atgaatgtgg attcaccgaa ctcaagtgct 720

aaaggtttgaggctaaggtc tctctctcct ttgcatggtt cttctctgaa agtcagcagg 780

agacctggtgtaattggtag gagagaacca caggctctgc tggaatacag tgtaaattct 840

tcagaacatggcccatcttc tcatggtatt cttatgtctg ggcaaaacaa gggatttcca 900

gtgagaatgaccaaggtgga tggctttaag ttgccatctg atcaggaaac tcctgtggct 960

gggaacgtatattccaattg tgttgtggat gctgctttat ttatgggcag gtcatttcgt 1020

gttggttggggaccaaatgg catccttgta cattctggca gtcttgtcaa tagacccgga 1080

actggtctatcttctgttat tcacatagag aaagttgcag gcgacaaagt tgtacgtgat 1140

gagaagaacaaaattaagga ggagctgact gatctgtgct tctcagaccc gctggatctc 1200

cataggaggcttcatcatga atatctggag actgagtctg acttgtttaa attgaagctt 1260

cagaaggttgtggcaagtcg ctttgtgttg ccagatattt gcagatctta tattgacatc 1320

attgaaaggcagcttgaagt cagtgattta tctatgtctt ctcgtgtgct gttaatgcac 1380

caggttacagtttgggagct tattcgggtc ttgttctcag aaagagcaac tggtaaccag 1440

ttagagcctactggtgatga ggaccaggag gggat 1475

<210>; 4

<211>; 1543

<212>; DNA

<213>OsMOS gene cDNA B section sequence

<400>; 4

gattttagataagaaagaag gtactgttgc catagacctt gaagcactcc ctttggttag 60

aagagcagactttagcaatt ggttacagga cagtgtttgt catcgggttc aaggagaggc 120

gggctccttaaatgatgcca ggtatctgga acatattatt ctgcttttga ctggtcggca 180

attagacacagccacagaag ttgctgcctt taggggtgat gttcgactgg caattttgct 240

aagccaggcaggtgggtcaa tgctaaatcg ttctgacctt tctcagcaac tggatctatg 300

gaaaacaaatggtctggatt ttgattatat tcaggaagac aggttaaaga tatatgagtt 360

gctttctggtaatgtacaag gcgcgttggt agattcatca attgactgga aacggtacct 420

tggtttaataatgtggtatc aactatcacc tgatgcatca cttgatatta tcattcactc 480

ttatcaccagctccttggtg agggcaaagt cccatatcct gtacctgtat atatagatga 540

aggaccccttgatgagtcac ttcaatggtc cccaggtgac cgctttgaca tatcctttta 600

tctaatgctgcttcatgcaa atcaagacga gaagtttggg atgctaaaaa ctatgttcag 660

tgcattctcatcttcatatg atcccttgga ctaccatatg atctggcatc agtgttccat 720

tctggaagctatcggtgctt tcagttcaaa tgatcttcat gtgctagatt tgagttttgt 780

ttaccaattattgtgtctgg ggaagtgcca ttgggctatc tatgtcattc tacatatgcc 840

tcatcttgatgacgccccat acatccatga gaagttgatc agggaaattt tgtcacaata 900

ttgcgaatcatggagcaagg atgaaactca gagagtttat attgcagaac ttggtattcc 960

agtagaatggatgcatgacg ctctggctct ttacaatgaa tactatggag atcagcaaag 1020

cgcactggagaattatattc tgtgtggcaa ctggaagaaa gcccatacaa ttttcatgac 1080

atccattgctcattctttgt ttctgtcatc taagcatcaa gagatctggg acattacaag 1140

ctctttggaggttcacaagt ctgaaattgc tgactgggaa cttagtgctg gaatatacat 1200

agacttcttcattctaagaa attctatgca agaaaaaagt accatggatg atccagatca 1260

acttgagaagaaaaatgaat catgcagcac tttctttggc cggttaaatg attcattgat 1320

agtctggggaagtaaattac ctgttgaggc aagggcatgc ttctcgaaga tggcagagga 1380

gctgtgcgagctactaatga actcccccgg cgagggcttg acgccagatc tctacatggg 1440

ctgctttcagacgatgctta acgctcctgt gcccgacgac cacaggtcat cctacctgca 1500

agaggcggtctctgttttca ccgacatact ttgcagggac tga 1543

<210>; 5

<211>; 29

<212>; DNA

<213>; AF

<400>; 5

cgcggatccatgtcttccga cccggtgtt 29

<210>; 6

<211>; 30

<212>; DNA

<213>; AR

<400>; 6

agtattcattgtaaagagcc agagcgtcat 30

<210>; 7

<211>; 30

<212>; DNA

<213>; BF

<400>; 7

atgacgctctggctctttac aatgaatact 30

<210>; 8

<211>; 29

<212>; DNA

<213>; BR

<400>; 8

gccgagctctcagtccctgc aaagtatgt 29

<210>; 9

<211>; 18

<212>; DNA

<213>; HygF

<400>; 9

actcaccgcgacgtctgt 18

<210>; 10

<211>; 18

<212>; DNA

<213>; HygR

<400>; 10

tttctttgccctcggacg 18

Claims (5)

1. a paddy disease-resistant related gene is characterized in that, it has the nucleotide sequence shown in the SEQ ID NO:1 or its complementary sequence in the sequence table.

2. the proteins encoded of a paddy disease-resistant related gene; SEQ ID NO:2, or one or more aminoacid deletion are arranged, substitute or insert and have the bioactive proteic aminoacid sequence of OsMOS broad-spectrum disease resistance with respect to the aminoacid sequence shown in the SEQ ID NO:2.

3. expression vector is characterized in that: said carrier comprise the described total length nucleotide sequence of claim 1 and with the upper reaches expression regulation element of this nucleotide sequence, express with constitutive promoter CaMV35S promotor gene, be selection markers with the Totomycin, make up OsMOSThe gene overexpression carrier.

4. a host cell is characterized in that, from paddy rice, is transformed by the described expression vector of claim 3, and goal gene is incorporated on its genome.

5. obtain a kind of preparation method who improves paddy rice broad spectrum resistance strain, it is characterized in that:

(1) the described expression vector of claim 3 is imported in the cell of 4 said plants;

(2) cell of cultivating said plant is to produce the regenerated plant;

(3) make the described paddy disease-resistant related gene of claim 1 at host cell inner expression, thereby obtain the plant lines that broad spectrum resistance increases.

Images