CA2082042C - Production of plants resistant to attacks of sclerotinia sclerotiorum by introducing a gene coding for an oxalate oxidase - Google Patents
Production of plants resistant to attacks of sclerotinia sclerotiorum by introducing a gene coding for an oxalate oxidase Download PDFInfo
- Publication number
- CA2082042C CA2082042C CA002082042A CA2082042A CA2082042C CA 2082042 C CA2082042 C CA 2082042C CA 002082042 A CA002082042 A CA 002082042A CA 2082042 A CA2082042 A CA 2082042A CA 2082042 C CA2082042 C CA 2082042C
- Authority
- CA
- Canada
- Prior art keywords
- oxalate oxidase
- protein
- dna sequence
- plant cell
- oxalate
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/50—Isolated enzymes; Isolated proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
- C12Y102/03—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with oxygen as acceptor (1.2.3)
- C12Y102/03004—Oxalate oxidase (1.2.3.4)
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Environmental Sciences (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Agronomy & Crop Science (AREA)
- Pest Control & Pesticides (AREA)
- Virology (AREA)
- Dentistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines Containing Plant Substances (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Networks Using Active Elements (AREA)
Abstract
1) DNA sequence encoding an oxalate oxidase.
2) The protein may be used for the resistance of plants to diseases caused by Sclerotinia sp. It may be provided by a chimeric gene and a vector containing the coding sequence.
3) It may be used to confer on plants an increased resistance to diseases caused by Sclerotinia sp.
2) The protein may be used for the resistance of plants to diseases caused by Sclerotinia sp. It may be provided by a chimeric gene and a vector containing the coding sequence.
3) It may be used to confer on plants an increased resistance to diseases caused by Sclerotinia sp.
Description
PRODUCTION OF PLANTS RESISTANT TO ATTACKS BY
SCLEROTINIA SCLEROTIORUM BY THE INTRODUCTION OF A
GENE ENCODING AN OXALATE OXIDASE
The subject of the present invention is a qene encoding an oxalate oxidase, the protein encoded by this gene, the chimeric genes comprising this gene and their use for transformatiori in order to confer on them a resistance to fungal diseases.
Scleroti.niose is a ma j or fur gal disease whi_ch ld affects a large numoer of dicotyledones. The causati_ve agent, Sclerotinia _a~:leroti_orum is a polyphagous funqus which exhibits little host specificity.
The fungus can attack the plant either directly at the level of the stem, or at t:h.e level cf the leaves and then spread to the stern, ora-- the level of the floral capitulum. In trle first tt.ao cases, the plant withers from disruption to food. supply. In the last case, the flower withers, damaging the harvest.
The fungus produces lytic enzymes which degrade the cell wall of the infected plar_t and promote its development in the plant. These enzymes play an important role in pathoqenicity, but do not appear to be sufficient. This fungus also produces oxalic acid (Godoy et al. (1990) Physicl. h9olec. Pla-Itt Pathol. 37:179-181) .
This oxalic acid causes a decrease in pH in the infected tissues, promoting hydrolysis c,f the cel,~~~~~ wall by the lytic enzymes. A reduction in the producti.on of oxalic acid or degradation of this oxalic acid should permit a slowing-down or even an inhibition of the development of the fungus.
In order to develop a Sclerotinia sclerotiorum resistant plant, the strategy of detoxification of oxalic acid may be used. The degradation of this acid will limit the decrease in intracellular pH of the plant tissue attacked, the lytic enzymes will thereby be functioning at a value too far-removed from their optimum pH to be really active and efficient. This will lead to a decrease in the pathogenicity of the fungus.
Oxalate oxidase which catalyses the following reaction:
Oz C204H2 -----------------> 2COZ + H202 oxalate oxidase may be used to achieve this objective.
Oxalate oxidase is isolated from various plants, generally from monocotyledons (Pieta et al., (1982) Preparative Biochemistry 12(4):341-353): the protein may for example be purified from barley using conventional chromatographic techniques (SephadexTM G-75 filtration gels and MonoQTM ion exchange gels, Pharmacia), by monitoring the enzymatic activity according to the following colorimetric procedure (Obzansky and Richardson, (1983) Clin. Chem. 29(10):1815-1819):
Oxalic acid + 02 ---------------> 2CO2 + H202 +
oxalate oxidase H202 + MBTH + DMA ------------> indamine + H20 +
peroxidase MBTH = 3-methyl-2-benzothiazolinone hydrazone DMA = N,N-dimethylalinine This has made it possible to purify a protein which, on acrylamide gel under denaturing conditions, has a molecular mass of 26,000 daltons. Part of the purified oxalate oxidase was used to obtain rabbit ani-oxalate oxidase antibodies; the remainder of the protein was used to carry out the sequencing of the native protein (N-terminal) or, after cyanogen bromide cleavage, the sequencing of certain internal peptides. The results obtained are as follows:
N-terminal : TDPDPLQDFXVADLDGKAVSVNGH or SDPDPLQDFXVADLDGKAVSVNGH where X is any naturally occurring amino acid Internal peptide No. 2 : HFQFNVGKTEAY
cDNA
Comparison of the peptide sequence described above with the data contained in the protein library Swiss-Prot enabled us to identify a wheat protein called Germine and published in 1989 by Dratewka-kos et al.
Experiments were carried out and they enabled us to determine that the cDNA published by the authors encodes a protein of 201 amino acids which exhibits an oxalate oxidase activity. For the rest of the description of the experiments presented in this patent, we will use the nucleotide numbering in Figure 2 in the article by the authors published in J. Biol. Chem., 264, 4896-4900.
The sequence of this cDNA is 1075 nucleotides in length with an untranslated 5' of 85 residues, an open reading frame of 672 nucleotides (from position 86 to 757) and an untranslated 3' of 318 residues. A
representation of this sequence is shown in Fig. 2.
:'omparison of the proteln sequence deduced from the cDNA sequence w.it.:1 that obtained by sequencing the native protein shows that the cJNA er:codes not only mature oxalate oxidase but also a signal peptide of 23 amino acids in the N--terminal part. Oxalate oxidase is therefore synthesised ir. the form of a preprotein (signal peptide plus mature pepti.de) which undergoes maturation by removal of the signal peptide in order tc> release the mature active enzyme.
In the f:ol'Lowing, we will use either the part encoding the preprotein nucleetides 86 to 757), or only that part encodinq the mature protein (from position 155 to 757). In the latter case, an AUG codon (encoding a methionine) shoul(J be placed before the ACC codon (encoding threorlirie, first amino acid of the mature protein).
The attacks or: plants by Scl.erotinia sclerotiorum beirig essentially through the stem or the plant, it is advantageous to he able to express oxalate oxidase either in ch:'-orophyllous tissues, and for that the promoter of the small subun:it, of ribulose 1,5-di--phosphate carboxylase of Heliar.thl,s annuus (SSUHa, Waksman et al (1987) Nucl. Ac.id Res. 15:7181) may be used, or iri the various tissues of the plant, and for that we will use the iabi.quitous promoter of the 35S RNA
of the cauliflower mosai_c virus (C.aMV 35S) part of which was duplicated and which is cal led. "double CaMV".
The chimeric genes according to the invent_-on may be for example constructed from the following elements:
A. Double CaMV promoter followed by that part of the oxalate oxidase cDNA encoding the pre-5 protein (signal peptide plus mature peptide) and the terminator "nos" obtained from the pTi 37 nopaline synthase gene (Bevan et al. Nature (1983) 304(5922):184-187).
B. Double CaMV promoter followed by that part of the oxalate oxidase cDNA encoding only the mature protein followed by the terminator "nos" .
C. Gene identical to "A" but with the promoter of the small subunit of sunflower ribulose 1,5-diphosphate carboxylase (SSUHa) in place of the double CaMV.
D. Gene identical to "B" but with the promoter of the SSUHa in place of the double CaMV.
Each chimeric gene is introduced into the plant cell by a system using Agrobacterium or any other system otherwise known for transforming plant cells. Plants are regenerated from these transformed cells. They exhibit an increased tolerance to Sclerotinia sclerotiorum.
Fig. 1. Obtention procedure of the four chimeric genes from both coding genes, pRPA-oxo-01 and pRPA-oxo-02H, HindIII; B, BstN; N, NheI; E, EcoRI; Sc, SacI; S, SaII and X, XbaI.
Fig. 2. Sequence of cDNA which includes a sequence which codes for an oxylate oxidase preprotein comprising oxylate oxidase and a signal peptide.
EXAMPLE 1: Preparation of two coding sequences:
Preprotein: it i_s obtained from the cDNA
described above, digested with HindIII (in position 66). The cohesive end obtained is made blurit by tr_eatirig with Klenow polvmerase. This DNA is then digested with NheI: (in position 811) .
The plasmid pUC 19 is digested in parallel with SacI.
The cohesive end obtained is made blunt by treating with Klenow polymerase. The plasmid is then digested with XbaI (compatible with NheI).
The cDNA fragment and plasmid prepared above are ligated. The new plasmid thus obtained is called pRPA-oxo-01 and its map is presented in Figure 1.
B. Mature protein: it is obtained from the cDNA described above after diges,tion with BstNI (in position 173). The fragment obtained and the linker of the sequence:
5' 3' ATGACCGACCCAGACCCTCTCC
TACTGGCTGGGTCTGGGAGAGGT
31 5.
are ligated. This leads to a modification of the N-terminal sequence of the mature protein which passes from TDPDPLQ to MTDPDPLQ.
This cDNA fragment is then digested wit:-l NheI (in position 811) so that it can then be ligated with t:rIe plasrnid pUC19 prepared as described in the paragraph above. The new plasmid thas formed is ca'lled pRPA-oxo-02 a.nd its map is presented in Figure 1.
EXAMPLE 2: Preparationof the chimeric aenes:
a. Preparation o~~~' the vectors containing the promoter and the terminator nos;
- example double CaMV: this vector is obtai_ned from the plasmid pRPA-BL-410 obtained in the followirig manner:
"Transit peptiAe of the SSU cf maize RuBisCO/AroA
aerle" fusion:
The transii_- peptide of the SSU of the maize RuBisCO gerie is derived from an EcoRI-Sphl fragment of 192-bp; it is obtained f:rom the c'JNA corresponding tc> the SSU gene of the maize RuBisCO gene described by Lebrun et al. (1987) Nucl. Acid Res. 1'_~~:436D with an Ncol site spanning the initiation codor: for translat.ion and an Sphl site cor.respondinq to the cleavage site of the transit peptide.
The translational fusion between the maize transit pepticle anci the bacterial EPSPS gene is obta:ir_ed by treating the Spr.I enci w i th t he bacteriophage T4 polymerase and by ligating it with tile Klenow polymerase-treated NcoI end of the AroA gene of pF:PA-BL 104 recut.
with EcoRI.
Transit peptide_of the SSE of maize RuBisCO/seauence of 22 amino acids of themature part of the SSU of maize RuBisCO/AroA aene fusion:
In a sirr.ilar fashion, ari Ec:oRI-HindIl fragment of 228bp of the cDNA of the SSU of maize RuBisCO gene is ligated with the Klenow polymerase-treated NcoI end of the AroA gene of pRPA--BL 104 and recut 4ith EcoRI. P, translational fusion -,_s obtained between the transit peptide of the SSU of maize RuB--sCO, the 22 amino acids of the mature part of: the SSU of maize RuBisCO and the bacterial EPSPS gene.
Transit peptide of the SSU of sunflower RuBisCO:
The fragmenr is obtained from the cDNA isolated by Waksman and Freyssinet (1987) Nuc-1. Acid Res. 15:1.328.
A SphI site was created acc.ording to the method of Zoller and Smith (1984) Method Enzymol. 154:329 at the cleavage sit:e of the transit peptide. The transit peptide of the SSU of sunflower RuBi3CO thus. obtained is an EcoRI-SphI
fragment of 171bp.
Transitpeptide_of the SSU of sunflower RuBisCOi sequence of 22 amLno aci_ds of the mature part of the SSU
of maize RuBisCO/AroA aene fusion:
The construct contairinq the tr_ansit peptide of the SSU of maize RuBisCC/sequer:ce of 22 arnino acids of the SSU of maize Rt1BisC0 of the mature part of the maize gene fusion was cut with EcoRI-SphI of 17:1bp corresponding to the transit peptide of the SSU of the said sunflower RuBisCO gene. The resulting construct exhibits a substitution of the EcoRI-SphI fragments and is a translational fusion, "transit peptide of the SSU
or sunflower RuBisCO/sequence of 22 amino acids of the mature part of the SSU of maize RuBisCO/AroA gene.
The EcoRI-SalI fragment was ligated with the SalI-SstI fragment containing the 3' nos sequence and the right end of the T-DNA. The resulting EcoRI-SstI
fragment comprising "transit peptide of the SSU of sunflower RuBisCO/sequence of 22 amino acids of the mature part of the SSU of maize RuBisCO/AroA gene/3' nos/T-DNA right end" is substituted for the EcoRI-SstI
fragment containing the right end of the T-DNA of the plasmid 150 A alpha 2 containing the double CaMV
promoter. The transcriptional fusion "double CaMV/transit peptide of the SSU of sunflower RuBisCO/sequence of 22 amino acids of the mature part of the SSU of maize RuBisCO/AroA gene/3'nos" in the vector 150 A alpha 2 was called pRPA-BL 294.
"Transit peptide of the SSU of sunflower RuBisCO/sequence of 22 amino acids of the SSU of maize RuBisCO/transit neotide of the SSU of maize RuBisCO/AroA gene" fusion:
The construct above is cut with NcoI-HindIII
releasing the AroA gene. It is then ligated with a 1.5-kbp NcoI-HindIII fragment containing the "transit peptide of the SSU of maize RuBisCO/AroA gene" fusion.
The resulting construct exhibits a substitution of the NcoI-HindIII fragments and is a translational fusion "transit peptide of the SSU of sunflower RuBisCO/sequence of 22 amino acids of the SSU of RuBisCO of the mature part of the maize gene/transit 5 peptide of the SSU of maize RuBisCO/AroA gene".
The EcoRI-SalI fragment was ligated with the SalI-SstI fragment containing the 3' nos sequence and the right end of the T-DNA. The resulting EcoRI-SstI fragment comprising 10 "transit peptide of the SSU of sunflower RuBisCO/sequence of 22 amino acids of the SSU
of RuBisCO of the mature part of the maize gene/transit peptide of the SSU of maize RuBisCO/AroA gene/3'rios/T-DNA right end" is substituted for the EcoRI-Sstl fragment containing the right end of T-DNA of the plasmid 150 A alpha 2 containing the double CaMV promoter. The transcriptional fusion "double CaMV/transit peptide of the SSU of sunflower RuBisCO/sequence of 22 amino acids of the SSU of RuBisCO of the mature part of the maize gene/transit peptide of the SSU of maize RuBisCO/AroA gene/3'nos" in the vector 150 A alpha 2 was called pRPA-BL 410. This plasmid is digested with EcoRI and Sall in order to remove the structural gene "optimised transit peptide-mature EPSPS
encoding region", pRPA-BL-410 deleted (see Figure 1).
- Example SSUHa: this vector is obtained from the plasmid pRPA-BL-207 (described in European Patent Application 0,337,899) which is digested with EcoRI and HindIII in order to remove the nitrilase-encoding region, pRPA-BL-207 deleted (see Figure 1).
b. Construction of chimeric genes:
pRPA-oxo-03: it is obtained by digesting pRPA-oxo-01 with EcoRI and SaII. The fragmerit obtained, which'encodes the preprotein, is then inserted between the EcoRI and Sall sites downstream of the double CaMV and upstream of the terminator nos respectively.
pRPA-oxo-04: it is obtained by digesting pRPA-oxo-02 with EcoRI and SalI. The fragment obtained, which encodes the mature protein, is then inserted betweeri the EcoRI and SalI
sites downstream of the double Ca.X1 and upstream of the terminator nos respectively.
pRPA-oxo-05: it is obtained by digesting pRPA-oxo-O1 with EcoRI and HindIII. The fragment obtained, which encodes the preprotein, is then inserted between the EcoRI and HindIII sites downstream of the double SSUHa and upstream of the terminator nos respectively.
pRPA-oxo-06: it is obtained by digesting 1.2 pRPA-oxo--02 w~:th EcoR_I and HindIII. The f raament octa ined, which encodes the mature protein, is ~.hen inserted between the EcoRI and HindIII sites downstream of the SSUHa promoter and the terminator nos respec.t;Lvely.
Table 1: Schematic represeritatior of the four chimeric genes:
Identifi_cation Promoter Oxalate oxidase Terminator encoding region pRPA-oxo-03 dCaMV preprctein nos pRPA-oxo-04 dCaNV matL:r_e nos pRPA-oxo-05 SSUHa prepro--e.in nos 1 pRPA-oxo-06 SSCJHa mature nos EXAMPLE 3! Production of transaenic colzas:
a. Traris.-or:mati.on Each vector, Gs described above, is introduced into the nononcogenic Acrobac.te-rium tumefac,-ens strain EHA 101 (Hood et al. (1c86) J. Bacteriol. 168:1291-1301) carrying the cosmid pTVK 291 (1Komari et al. (1986) J.
Bacteriol. 166:88-94;.
The method o~= tr_ansform=i_nq colza, Westar variety, is essent.i.a.- _y based on that described by Boulter et al. (1990) Plant Sci. "70:91-99, using a bacterial concentrattt:_on of 2.5 x 10" per ml (0D 600 nm =
1).
b. Reg eneration The method of reqener:ation is essentially based on that descri_bed by Boulter et. al. (supra) The plants are rooted on the njediura of De Block et. al . (1989 ) Plant Sci. 1:694-701. They are then brought to the flower:ing stage in a greenhouse.
EXAMPLE 4: Measurement ~>f the resistance of colza to SclerotiniL_sc-erotiorum:
In vitro:
- Foliar discs: the resistance is measured by weighing the mass ofthr_ee foliar discs after growing for 11 days on a MurasY,Lige and Skoog (MS) medium with hormones, supplemented with I m.M of oxalic acid.
Under these conditions, it is observed that for the foliar discs obtained from colzas modified using one of the chimeric genes, pRPA-oxo-03, pRPA-oxo-04, pRPA-oxo-05 and pRPA-oxc-06, the mass of the foliar discs increases substantially whereas, in the case of the foliar discs obtained from unmodified colzas, the mass stagnates or even decreases.
- Root elongati_on: the _--esistance is also measured in vitro by rneasuririg root elongat;.~on after growing for two days on water supplemented with 5 mM of oxalic acid. It is observed, in this case, that the roots of colza plarits modified with one of the chimeric geries, pRPA-oxo-03, pRPP~-ox.o-04, are capable of growing anci increasing in length, whereas the roots of unmodified colzas show no growth ur,der these conditions.
In vivo:
The resistance in vivo is measured in a greenhouse after contaminating colza plants obtained from the regeneration, as soon as the first flowers appeared, either by depositing S. sclerotiorum spores on the petals, the infection of the leaves thereby occurring naturally during defloration, or by directly depositing mycelium or a mycelium-impregnated petal on the leaves. The plants modified by one of the chimeric genes, pRPA-oxo-03, pRPA-oxo-04, pRPA-oxo-05 and pRPA-oxo-06 do not allow the fungus to develop and do not exhibit any symptom of rot characteristic of sclerotiniose, whereas the unmodified plants are rapidly overcome by rot characteristic of the development of Sclerotinia sclerotiorum.
Drawing Caption Obtention procedure of the four chimeric genes from both coding genes, pRPA-oxo-01 and pRPA-oxo-02H, Hind III
B, BstN ; N, Nhe I E, Eco RI Sc, Sac I S, Sal I and X, Xba I.
SCLEROTINIA SCLEROTIORUM BY THE INTRODUCTION OF A
GENE ENCODING AN OXALATE OXIDASE
The subject of the present invention is a qene encoding an oxalate oxidase, the protein encoded by this gene, the chimeric genes comprising this gene and their use for transformatiori in order to confer on them a resistance to fungal diseases.
Scleroti.niose is a ma j or fur gal disease whi_ch ld affects a large numoer of dicotyledones. The causati_ve agent, Sclerotinia _a~:leroti_orum is a polyphagous funqus which exhibits little host specificity.
The fungus can attack the plant either directly at the level of the stem, or at t:h.e level cf the leaves and then spread to the stern, ora-- the level of the floral capitulum. In trle first tt.ao cases, the plant withers from disruption to food. supply. In the last case, the flower withers, damaging the harvest.
The fungus produces lytic enzymes which degrade the cell wall of the infected plar_t and promote its development in the plant. These enzymes play an important role in pathoqenicity, but do not appear to be sufficient. This fungus also produces oxalic acid (Godoy et al. (1990) Physicl. h9olec. Pla-Itt Pathol. 37:179-181) .
This oxalic acid causes a decrease in pH in the infected tissues, promoting hydrolysis c,f the cel,~~~~~ wall by the lytic enzymes. A reduction in the producti.on of oxalic acid or degradation of this oxalic acid should permit a slowing-down or even an inhibition of the development of the fungus.
In order to develop a Sclerotinia sclerotiorum resistant plant, the strategy of detoxification of oxalic acid may be used. The degradation of this acid will limit the decrease in intracellular pH of the plant tissue attacked, the lytic enzymes will thereby be functioning at a value too far-removed from their optimum pH to be really active and efficient. This will lead to a decrease in the pathogenicity of the fungus.
Oxalate oxidase which catalyses the following reaction:
Oz C204H2 -----------------> 2COZ + H202 oxalate oxidase may be used to achieve this objective.
Oxalate oxidase is isolated from various plants, generally from monocotyledons (Pieta et al., (1982) Preparative Biochemistry 12(4):341-353): the protein may for example be purified from barley using conventional chromatographic techniques (SephadexTM G-75 filtration gels and MonoQTM ion exchange gels, Pharmacia), by monitoring the enzymatic activity according to the following colorimetric procedure (Obzansky and Richardson, (1983) Clin. Chem. 29(10):1815-1819):
Oxalic acid + 02 ---------------> 2CO2 + H202 +
oxalate oxidase H202 + MBTH + DMA ------------> indamine + H20 +
peroxidase MBTH = 3-methyl-2-benzothiazolinone hydrazone DMA = N,N-dimethylalinine This has made it possible to purify a protein which, on acrylamide gel under denaturing conditions, has a molecular mass of 26,000 daltons. Part of the purified oxalate oxidase was used to obtain rabbit ani-oxalate oxidase antibodies; the remainder of the protein was used to carry out the sequencing of the native protein (N-terminal) or, after cyanogen bromide cleavage, the sequencing of certain internal peptides. The results obtained are as follows:
N-terminal : TDPDPLQDFXVADLDGKAVSVNGH or SDPDPLQDFXVADLDGKAVSVNGH where X is any naturally occurring amino acid Internal peptide No. 2 : HFQFNVGKTEAY
cDNA
Comparison of the peptide sequence described above with the data contained in the protein library Swiss-Prot enabled us to identify a wheat protein called Germine and published in 1989 by Dratewka-kos et al.
Experiments were carried out and they enabled us to determine that the cDNA published by the authors encodes a protein of 201 amino acids which exhibits an oxalate oxidase activity. For the rest of the description of the experiments presented in this patent, we will use the nucleotide numbering in Figure 2 in the article by the authors published in J. Biol. Chem., 264, 4896-4900.
The sequence of this cDNA is 1075 nucleotides in length with an untranslated 5' of 85 residues, an open reading frame of 672 nucleotides (from position 86 to 757) and an untranslated 3' of 318 residues. A
representation of this sequence is shown in Fig. 2.
:'omparison of the proteln sequence deduced from the cDNA sequence w.it.:1 that obtained by sequencing the native protein shows that the cJNA er:codes not only mature oxalate oxidase but also a signal peptide of 23 amino acids in the N--terminal part. Oxalate oxidase is therefore synthesised ir. the form of a preprotein (signal peptide plus mature pepti.de) which undergoes maturation by removal of the signal peptide in order tc> release the mature active enzyme.
In the f:ol'Lowing, we will use either the part encoding the preprotein nucleetides 86 to 757), or only that part encodinq the mature protein (from position 155 to 757). In the latter case, an AUG codon (encoding a methionine) shoul(J be placed before the ACC codon (encoding threorlirie, first amino acid of the mature protein).
The attacks or: plants by Scl.erotinia sclerotiorum beirig essentially through the stem or the plant, it is advantageous to he able to express oxalate oxidase either in ch:'-orophyllous tissues, and for that the promoter of the small subun:it, of ribulose 1,5-di--phosphate carboxylase of Heliar.thl,s annuus (SSUHa, Waksman et al (1987) Nucl. Ac.id Res. 15:7181) may be used, or iri the various tissues of the plant, and for that we will use the iabi.quitous promoter of the 35S RNA
of the cauliflower mosai_c virus (C.aMV 35S) part of which was duplicated and which is cal led. "double CaMV".
The chimeric genes according to the invent_-on may be for example constructed from the following elements:
A. Double CaMV promoter followed by that part of the oxalate oxidase cDNA encoding the pre-5 protein (signal peptide plus mature peptide) and the terminator "nos" obtained from the pTi 37 nopaline synthase gene (Bevan et al. Nature (1983) 304(5922):184-187).
B. Double CaMV promoter followed by that part of the oxalate oxidase cDNA encoding only the mature protein followed by the terminator "nos" .
C. Gene identical to "A" but with the promoter of the small subunit of sunflower ribulose 1,5-diphosphate carboxylase (SSUHa) in place of the double CaMV.
D. Gene identical to "B" but with the promoter of the SSUHa in place of the double CaMV.
Each chimeric gene is introduced into the plant cell by a system using Agrobacterium or any other system otherwise known for transforming plant cells. Plants are regenerated from these transformed cells. They exhibit an increased tolerance to Sclerotinia sclerotiorum.
Fig. 1. Obtention procedure of the four chimeric genes from both coding genes, pRPA-oxo-01 and pRPA-oxo-02H, HindIII; B, BstN; N, NheI; E, EcoRI; Sc, SacI; S, SaII and X, XbaI.
Fig. 2. Sequence of cDNA which includes a sequence which codes for an oxylate oxidase preprotein comprising oxylate oxidase and a signal peptide.
EXAMPLE 1: Preparation of two coding sequences:
Preprotein: it i_s obtained from the cDNA
described above, digested with HindIII (in position 66). The cohesive end obtained is made blurit by tr_eatirig with Klenow polvmerase. This DNA is then digested with NheI: (in position 811) .
The plasmid pUC 19 is digested in parallel with SacI.
The cohesive end obtained is made blunt by treating with Klenow polymerase. The plasmid is then digested with XbaI (compatible with NheI).
The cDNA fragment and plasmid prepared above are ligated. The new plasmid thus obtained is called pRPA-oxo-01 and its map is presented in Figure 1.
B. Mature protein: it is obtained from the cDNA described above after diges,tion with BstNI (in position 173). The fragment obtained and the linker of the sequence:
5' 3' ATGACCGACCCAGACCCTCTCC
TACTGGCTGGGTCTGGGAGAGGT
31 5.
are ligated. This leads to a modification of the N-terminal sequence of the mature protein which passes from TDPDPLQ to MTDPDPLQ.
This cDNA fragment is then digested wit:-l NheI (in position 811) so that it can then be ligated with t:rIe plasrnid pUC19 prepared as described in the paragraph above. The new plasmid thas formed is ca'lled pRPA-oxo-02 a.nd its map is presented in Figure 1.
EXAMPLE 2: Preparationof the chimeric aenes:
a. Preparation o~~~' the vectors containing the promoter and the terminator nos;
- example double CaMV: this vector is obtai_ned from the plasmid pRPA-BL-410 obtained in the followirig manner:
"Transit peptiAe of the SSU cf maize RuBisCO/AroA
aerle" fusion:
The transii_- peptide of the SSU of the maize RuBisCO gerie is derived from an EcoRI-Sphl fragment of 192-bp; it is obtained f:rom the c'JNA corresponding tc> the SSU gene of the maize RuBisCO gene described by Lebrun et al. (1987) Nucl. Acid Res. 1'_~~:436D with an Ncol site spanning the initiation codor: for translat.ion and an Sphl site cor.respondinq to the cleavage site of the transit peptide.
The translational fusion between the maize transit pepticle anci the bacterial EPSPS gene is obta:ir_ed by treating the Spr.I enci w i th t he bacteriophage T4 polymerase and by ligating it with tile Klenow polymerase-treated NcoI end of the AroA gene of pF:PA-BL 104 recut.
with EcoRI.
Transit peptide_of the SSE of maize RuBisCO/seauence of 22 amino acids of themature part of the SSU of maize RuBisCO/AroA aene fusion:
In a sirr.ilar fashion, ari Ec:oRI-HindIl fragment of 228bp of the cDNA of the SSU of maize RuBisCO gene is ligated with the Klenow polymerase-treated NcoI end of the AroA gene of pRPA--BL 104 and recut 4ith EcoRI. P, translational fusion -,_s obtained between the transit peptide of the SSU of maize RuB--sCO, the 22 amino acids of the mature part of: the SSU of maize RuBisCO and the bacterial EPSPS gene.
Transit peptide of the SSU of sunflower RuBisCO:
The fragmenr is obtained from the cDNA isolated by Waksman and Freyssinet (1987) Nuc-1. Acid Res. 15:1.328.
A SphI site was created acc.ording to the method of Zoller and Smith (1984) Method Enzymol. 154:329 at the cleavage sit:e of the transit peptide. The transit peptide of the SSU of sunflower RuBi3CO thus. obtained is an EcoRI-SphI
fragment of 171bp.
Transitpeptide_of the SSU of sunflower RuBisCOi sequence of 22 amLno aci_ds of the mature part of the SSU
of maize RuBisCO/AroA aene fusion:
The construct contairinq the tr_ansit peptide of the SSU of maize RuBisCC/sequer:ce of 22 arnino acids of the SSU of maize Rt1BisC0 of the mature part of the maize gene fusion was cut with EcoRI-SphI of 17:1bp corresponding to the transit peptide of the SSU of the said sunflower RuBisCO gene. The resulting construct exhibits a substitution of the EcoRI-SphI fragments and is a translational fusion, "transit peptide of the SSU
or sunflower RuBisCO/sequence of 22 amino acids of the mature part of the SSU of maize RuBisCO/AroA gene.
The EcoRI-SalI fragment was ligated with the SalI-SstI fragment containing the 3' nos sequence and the right end of the T-DNA. The resulting EcoRI-SstI
fragment comprising "transit peptide of the SSU of sunflower RuBisCO/sequence of 22 amino acids of the mature part of the SSU of maize RuBisCO/AroA gene/3' nos/T-DNA right end" is substituted for the EcoRI-SstI
fragment containing the right end of the T-DNA of the plasmid 150 A alpha 2 containing the double CaMV
promoter. The transcriptional fusion "double CaMV/transit peptide of the SSU of sunflower RuBisCO/sequence of 22 amino acids of the mature part of the SSU of maize RuBisCO/AroA gene/3'nos" in the vector 150 A alpha 2 was called pRPA-BL 294.
"Transit peptide of the SSU of sunflower RuBisCO/sequence of 22 amino acids of the SSU of maize RuBisCO/transit neotide of the SSU of maize RuBisCO/AroA gene" fusion:
The construct above is cut with NcoI-HindIII
releasing the AroA gene. It is then ligated with a 1.5-kbp NcoI-HindIII fragment containing the "transit peptide of the SSU of maize RuBisCO/AroA gene" fusion.
The resulting construct exhibits a substitution of the NcoI-HindIII fragments and is a translational fusion "transit peptide of the SSU of sunflower RuBisCO/sequence of 22 amino acids of the SSU of RuBisCO of the mature part of the maize gene/transit 5 peptide of the SSU of maize RuBisCO/AroA gene".
The EcoRI-SalI fragment was ligated with the SalI-SstI fragment containing the 3' nos sequence and the right end of the T-DNA. The resulting EcoRI-SstI fragment comprising 10 "transit peptide of the SSU of sunflower RuBisCO/sequence of 22 amino acids of the SSU
of RuBisCO of the mature part of the maize gene/transit peptide of the SSU of maize RuBisCO/AroA gene/3'rios/T-DNA right end" is substituted for the EcoRI-Sstl fragment containing the right end of T-DNA of the plasmid 150 A alpha 2 containing the double CaMV promoter. The transcriptional fusion "double CaMV/transit peptide of the SSU of sunflower RuBisCO/sequence of 22 amino acids of the SSU of RuBisCO of the mature part of the maize gene/transit peptide of the SSU of maize RuBisCO/AroA gene/3'nos" in the vector 150 A alpha 2 was called pRPA-BL 410. This plasmid is digested with EcoRI and Sall in order to remove the structural gene "optimised transit peptide-mature EPSPS
encoding region", pRPA-BL-410 deleted (see Figure 1).
- Example SSUHa: this vector is obtained from the plasmid pRPA-BL-207 (described in European Patent Application 0,337,899) which is digested with EcoRI and HindIII in order to remove the nitrilase-encoding region, pRPA-BL-207 deleted (see Figure 1).
b. Construction of chimeric genes:
pRPA-oxo-03: it is obtained by digesting pRPA-oxo-01 with EcoRI and SaII. The fragmerit obtained, which'encodes the preprotein, is then inserted between the EcoRI and Sall sites downstream of the double CaMV and upstream of the terminator nos respectively.
pRPA-oxo-04: it is obtained by digesting pRPA-oxo-02 with EcoRI and SalI. The fragment obtained, which encodes the mature protein, is then inserted betweeri the EcoRI and SalI
sites downstream of the double Ca.X1 and upstream of the terminator nos respectively.
pRPA-oxo-05: it is obtained by digesting pRPA-oxo-O1 with EcoRI and HindIII. The fragment obtained, which encodes the preprotein, is then inserted between the EcoRI and HindIII sites downstream of the double SSUHa and upstream of the terminator nos respectively.
pRPA-oxo-06: it is obtained by digesting 1.2 pRPA-oxo--02 w~:th EcoR_I and HindIII. The f raament octa ined, which encodes the mature protein, is ~.hen inserted between the EcoRI and HindIII sites downstream of the SSUHa promoter and the terminator nos respec.t;Lvely.
Table 1: Schematic represeritatior of the four chimeric genes:
Identifi_cation Promoter Oxalate oxidase Terminator encoding region pRPA-oxo-03 dCaMV preprctein nos pRPA-oxo-04 dCaNV matL:r_e nos pRPA-oxo-05 SSUHa prepro--e.in nos 1 pRPA-oxo-06 SSCJHa mature nos EXAMPLE 3! Production of transaenic colzas:
a. Traris.-or:mati.on Each vector, Gs described above, is introduced into the nononcogenic Acrobac.te-rium tumefac,-ens strain EHA 101 (Hood et al. (1c86) J. Bacteriol. 168:1291-1301) carrying the cosmid pTVK 291 (1Komari et al. (1986) J.
Bacteriol. 166:88-94;.
The method o~= tr_ansform=i_nq colza, Westar variety, is essent.i.a.- _y based on that described by Boulter et al. (1990) Plant Sci. "70:91-99, using a bacterial concentrattt:_on of 2.5 x 10" per ml (0D 600 nm =
1).
b. Reg eneration The method of reqener:ation is essentially based on that descri_bed by Boulter et. al. (supra) The plants are rooted on the njediura of De Block et. al . (1989 ) Plant Sci. 1:694-701. They are then brought to the flower:ing stage in a greenhouse.
EXAMPLE 4: Measurement ~>f the resistance of colza to SclerotiniL_sc-erotiorum:
In vitro:
- Foliar discs: the resistance is measured by weighing the mass ofthr_ee foliar discs after growing for 11 days on a MurasY,Lige and Skoog (MS) medium with hormones, supplemented with I m.M of oxalic acid.
Under these conditions, it is observed that for the foliar discs obtained from colzas modified using one of the chimeric genes, pRPA-oxo-03, pRPA-oxo-04, pRPA-oxo-05 and pRPA-oxc-06, the mass of the foliar discs increases substantially whereas, in the case of the foliar discs obtained from unmodified colzas, the mass stagnates or even decreases.
- Root elongati_on: the _--esistance is also measured in vitro by rneasuririg root elongat;.~on after growing for two days on water supplemented with 5 mM of oxalic acid. It is observed, in this case, that the roots of colza plarits modified with one of the chimeric geries, pRPA-oxo-03, pRPP~-ox.o-04, are capable of growing anci increasing in length, whereas the roots of unmodified colzas show no growth ur,der these conditions.
In vivo:
The resistance in vivo is measured in a greenhouse after contaminating colza plants obtained from the regeneration, as soon as the first flowers appeared, either by depositing S. sclerotiorum spores on the petals, the infection of the leaves thereby occurring naturally during defloration, or by directly depositing mycelium or a mycelium-impregnated petal on the leaves. The plants modified by one of the chimeric genes, pRPA-oxo-03, pRPA-oxo-04, pRPA-oxo-05 and pRPA-oxo-06 do not allow the fungus to develop and do not exhibit any symptom of rot characteristic of sclerotiniose, whereas the unmodified plants are rapidly overcome by rot characteristic of the development of Sclerotinia sclerotiorum.
Drawing Caption Obtention procedure of the four chimeric genes from both coding genes, pRPA-oxo-01 and pRPA-oxo-02H, Hind III
B, BstN ; N, Nhe I E, Eco RI Sc, Sac I S, Sal I and X, Xba I.
Claims (15)
1. An isolated plant cell transformed with a vector comprising a DNA sequence encoding an oxalate oxidase preprotein comprising an oxalate oxidase signal peptide and an oxalate oxidase mature peptide comprising the sequence of TDPDPLQDFXVADLDGKAVSVNGH or SDPDPLQDFXVADLDGKAVSVNGH where X is any naturally occurring amino acid.
2. The isolated plant cell of claim 1, wherein the plant cell is from a dicotyledon.
3. The isolated plant cell of claim 2, wherein the plant cell is from a Colza.
4. An isolated plant cell according to claim 1, wherein said vector further comprises a small subunit of ribulose 1,5-diphosphate carboxylase of Helianthus annuus (SSUHa) promoter.
5. An isolated plant cell according to claim 1, wherein said vector further comprises a double Cauliflower Mosaic Virus (CaMV) promoter.
6. An isolated plant cell according to claim 1, wherein said vector comprises a double CaMV promoter followed by that part of the oxalate oxidase DNA sequence encoding the oxalate oxidase preprotein and a terminator "nos"
obtained from a pTi 37 nopaline synthase gene.
obtained from a pTi 37 nopaline synthase gene.
7. An isolated plant cell according to claim 1, wherein said vector comprises a SSUHa promoter followed by that part of the oxalate oxidase DNA sequence encoding the oxalate oxidase preprotein and a terminator "nos"
obtained from a pTi 37 nopaline synthase gene.
obtained from a pTi 37 nopaline synthase gene.
8. The isolated plant cell of claim 1, wherein said DNA
sequence encoding an oxalate oxidase preprotein has a sequence selected from the group consisting of: (a) the DNA sequence encoding the oxalate oxidase preprotein pRPA-oxo-01; and (b) the DNA sequence from nucleotides 86 to 757 of Fig. 2.
sequence encoding an oxalate oxidase preprotein has a sequence selected from the group consisting of: (a) the DNA sequence encoding the oxalate oxidase preprotein pRPA-oxo-01; and (b) the DNA sequence from nucleotides 86 to 757 of Fig. 2.
9. The isolated plant cell of claim 1 wherein said oxalate oxidase preprotein is a wheat germin preprotein.
10. A method of conferring on plants resistance to sclerotiniosis comprising transforming said plants with a DNA sequence encoding an oxalate oxidase pre-protein comprising an oxalate oxidase signal peptide and an oxalate oxidase mature peptide and recovering sclerotiniosis-resistant plants, wherein said oxalate oxidase pre-protein is a wheat germin pre-protein.
11. The method of claim 10, wherein the DNA sequence encoding an oxalate oxidase pre-protein encodes an oxalate oxidase signal peptide and an oxalate oxidase mature protein comprising the amino acid sequence of TDPDPLQDFXVADLDGKAVSVNGH or SDPDPLQDFXVADLDGKAVSVNGH
where X is any naturally occurring amino acid.
where X is any naturally occurring amino acid.
12. A method of reducing oxalic acid in plants comprising transforming said plants with a DNA encoding an oxalate oxidase pre-protein comprising of an oxalate signal peptide and an oxalate oxidase mature peptide and recovering transformed plants which have reduced oxalic acid content, wherein said oxalate oxidase pre-protein is a wheat germin pre-protein.
13. The method of claim 12, wherein said DNA sequence encoding an oxalate oxidase pre-protein encodes an oxalate oxidase signal peptide and an oxalate oxidase mature protein comprising the sequence of TDPDPLQDFXVADLDGKAVSVNGH or SDPDPLQDFXVADLDGKAVSVNGH
where X is any naturally occurring amino acid.
where X is any naturally occurring amino acid.
14. The method of claim12, wherein the DNA has a sequence consisting of the DNA sequence of Fig. 2.
15. The method of claim 10, wherein said DNA sequence encoding an oxalate oxidase pre-protein has a sequence consisting of the DNA sequence of Fig. 2.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| FR9102874A FR2673644A1 (en) | 1991-03-05 | 1991-03-05 | DNA SEQUENCE ENCODING OXALATE OXIDASE AND TRANSFORMED PLANTS COMPRISING THE SAME AND RESISTANT TO SCLEROTINIA. |
| FR91/02874 | 1991-03-05 | ||
| PCT/FR1992/000195 WO1992015685A1 (en) | 1991-03-05 | 1992-03-04 | Production of plants resistant to attacks of sclerotinia sclerotiorum by introducing a gene coding for an oxalate oxidase |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CA2082042A1 CA2082042A1 (en) | 1992-09-06 |
| CA2082042C true CA2082042C (en) | 2007-05-29 |
Family
ID=9410559
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002082042A Expired - Lifetime CA2082042C (en) | 1991-03-05 | 1992-03-04 | Production of plants resistant to attacks of sclerotinia sclerotiorum by introducing a gene coding for an oxalate oxidase |
Country Status (24)
| Country | Link |
|---|---|
| EP (1) | EP0531498B1 (en) |
| JP (1) | JPH05506582A (en) |
| KR (1) | KR930700665A (en) |
| CN (1) | CN1051576C (en) |
| AT (1) | ATE338129T1 (en) |
| AU (1) | AU660976B2 (en) |
| BG (1) | BG61275B1 (en) |
| BR (1) | BR9204788A (en) |
| CA (1) | CA2082042C (en) |
| CZ (1) | CZ289623B6 (en) |
| DE (1) | DE69233653T2 (en) |
| DK (1) | DK0531498T3 (en) |
| EG (1) | EG21465A (en) |
| ES (1) | ES2273329T3 (en) |
| FR (1) | FR2673644A1 (en) |
| HU (1) | HUT65677A (en) |
| IE (1) | IE920691A1 (en) |
| IL (1) | IL101117A (en) |
| MX (1) | MX9200917A (en) |
| NZ (1) | NZ241829A (en) |
| PT (1) | PT100203B (en) |
| UA (1) | UA43308C2 (en) |
| WO (1) | WO1992015685A1 (en) |
| ZA (1) | ZA921647B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103911384A (en) * | 2014-01-21 | 2014-07-09 | 江苏大学 | Gene for controlling Sclerotinia sclerotiorum (Lib.) de Bary of Brassica napus L. and use thereof |
Families Citing this family (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RO114979B1 (en) * | 1991-02-25 | 1999-09-30 | Ici Plc | Oxalic acid capable of degrading oxydase oxalate and process for producing oxydase oxalate in plants |
| WO1994012622A1 (en) * | 1992-11-30 | 1994-06-09 | Zeneca Limited | Oxalate decarboxylase |
| ATE221121T1 (en) * | 1992-12-07 | 2002-08-15 | Biogemma Fr | USE OF A DNA SEQUENCE CODING FOR A PROTEIN CAPABILITY TO BREAK DOWN OXALIC ACID FOR GENE SELECTION |
| AUPM379294A0 (en) * | 1994-02-10 | 1994-03-03 | Commonwealth Scientific And Industrial Research Organisation | Expression of the glucose oxidase gene in transgenic organisms |
| ZA986308B (en) * | 1997-07-18 | 1999-11-24 | Pioneer Hi Bred Int | The induction of stress-related factors in plants. |
| US6166291A (en) | 1997-07-18 | 2000-12-26 | Pioneer Hi-Bred International, Inc. | Production of pathogen resistant plants |
| AU8919098A (en) * | 1997-08-26 | 1999-03-16 | North Carolina State University | Fumonosin resistance |
| FR2844142B1 (en) | 2002-09-11 | 2007-08-17 | Bayer Cropscience Sa | TRANSFORMED PLANTS WITH ENHANCED PRENYLQUINON BIOSYNTHESIS |
| FR2848570B1 (en) | 2002-12-12 | 2005-04-01 | Bayer Cropscience Sa | EXPRESSION CASSETTE ENCODING A 5-ENOL PYRUVYLSHIKIMATE-3-PHOSPHATE SYNTHASE (EPSPS) AND HERBICIDE TOLERANT PLANTS CONTAINING THE SAME |
| CN100383239C (en) * | 2004-07-21 | 2008-04-23 | 华南农业大学 | Process for extracting oxalate oxidase from bran of wheat |
| AR074941A1 (en) | 2009-01-07 | 2011-02-23 | Bayer Cropscience Sa | TRANSPLASTOMIC PLANTS EXEMPTED FROM SELECTOR MARKER |
| CA2786001A1 (en) | 2009-12-31 | 2011-07-07 | Pioneer Hi-Bred International, Inc. | Engineering plant resistance to diseases caused by pathogens |
| CN103060350A (en) * | 2011-10-21 | 2013-04-24 | 华中农业大学 | Sclerotia oxalic acid decarboxylase gene SsOXDC2 and application thereof in improvement in soybeans for disease resistance |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1988008450A1 (en) * | 1987-05-01 | 1988-11-03 | Birdwell Finlayson | Gene therapy for metabolite disorders |
| RO114979B1 (en) * | 1991-02-25 | 1999-09-30 | Ici Plc | Oxalic acid capable of degrading oxydase oxalate and process for producing oxydase oxalate in plants |
-
1991
- 1991-03-05 FR FR9102874A patent/FR2673644A1/en active Granted
-
1992
- 1992-02-28 CN CN92101989A patent/CN1051576C/en not_active Expired - Lifetime
- 1992-03-02 IL IL10111792A patent/IL101117A/en not_active IP Right Cessation
- 1992-03-03 EG EG12792A patent/EG21465A/en active
- 1992-03-03 MX MX9200917A patent/MX9200917A/en unknown
- 1992-03-04 DK DK92908073T patent/DK0531498T3/en active
- 1992-03-04 IE IE069192A patent/IE920691A1/en unknown
- 1992-03-04 CA CA002082042A patent/CA2082042C/en not_active Expired - Lifetime
- 1992-03-04 DE DE69233653T patent/DE69233653T2/en not_active Expired - Lifetime
- 1992-03-04 JP JP92507499A patent/JPH05506582A/en active Pending
- 1992-03-04 KR KR1019920702749A patent/KR930700665A/en not_active Application Discontinuation
- 1992-03-04 AU AU16820/92A patent/AU660976B2/en not_active Expired
- 1992-03-04 ES ES92908073T patent/ES2273329T3/en not_active Expired - Lifetime
- 1992-03-04 HU HU9203473A patent/HUT65677A/en unknown
- 1992-03-04 CZ CS19923369A patent/CZ289623B6/en not_active IP Right Cessation
- 1992-03-04 BR BR9204788A patent/BR9204788A/en not_active Application Discontinuation
- 1992-03-04 NZ NZ241829A patent/NZ241829A/en not_active IP Right Cessation
- 1992-03-04 AT AT92908073T patent/ATE338129T1/en not_active IP Right Cessation
- 1992-03-04 WO PCT/FR1992/000195 patent/WO1992015685A1/en active IP Right Grant
- 1992-03-04 UA UA93004232A patent/UA43308C2/en unknown
- 1992-03-04 EP EP92908073A patent/EP0531498B1/en not_active Expired - Lifetime
- 1992-03-05 PT PT100203A patent/PT100203B/en not_active IP Right Cessation
- 1992-03-05 ZA ZA921647A patent/ZA921647B/en unknown
- 1992-11-03 BG BG97042A patent/BG61275B1/en unknown
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103911384A (en) * | 2014-01-21 | 2014-07-09 | 江苏大学 | Gene for controlling Sclerotinia sclerotiorum (Lib.) de Bary of Brassica napus L. and use thereof |
| CN103911384B (en) * | 2014-01-21 | 2016-05-25 | 江苏大学 | A kind of gene and application thereof of controlling sclerotinia rot of colza |
Also Published As
| Publication number | Publication date |
|---|---|
| FR2673644B1 (en) | 1994-12-02 |
| AU1682092A (en) | 1992-10-06 |
| PT100203A (en) | 1993-07-30 |
| DK0531498T3 (en) | 2007-01-02 |
| BG97042A (en) | 1993-12-24 |
| CZ289623B6 (en) | 2002-03-13 |
| CA2082042A1 (en) | 1992-09-06 |
| WO1992015685A1 (en) | 1992-09-17 |
| IL101117A (en) | 2004-09-27 |
| IL101117A0 (en) | 1992-11-15 |
| HUT65677A (en) | 1994-07-28 |
| EP0531498B1 (en) | 2006-08-30 |
| JPH05506582A (en) | 1993-09-30 |
| KR930700665A (en) | 1993-03-15 |
| DE69233653D1 (en) | 2006-10-12 |
| BG61275B1 (en) | 1997-04-30 |
| FR2673644A1 (en) | 1992-09-11 |
| UA43308C2 (en) | 2001-12-17 |
| CZ336992A3 (en) | 1994-01-19 |
| ATE338129T1 (en) | 2006-09-15 |
| ZA921647B (en) | 1992-11-25 |
| PT100203B (en) | 1999-06-30 |
| DE69233653T2 (en) | 2007-10-04 |
| MX9200917A (en) | 1992-11-01 |
| HU9203473D0 (en) | 1993-01-28 |
| CN1051576C (en) | 2000-04-19 |
| IE920691A1 (en) | 1992-09-09 |
| NZ241829A (en) | 1994-04-27 |
| BR9204788A (en) | 1993-07-27 |
| ES2273329T3 (en) | 2007-05-01 |
| EG21465A (en) | 2001-11-28 |
| CN1065683A (en) | 1992-10-28 |
| AU660976B2 (en) | 1995-07-13 |
| EP0531498A1 (en) | 1993-03-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2082042C (en) | Production of plants resistant to attacks of sclerotinia sclerotiorum by introducing a gene coding for an oxalate oxidase | |
| AU652417B2 (en) | Chimeric gene for the transformation of plants | |
| AU652610B2 (en) | Chimeric gene for the transformation of plants | |
| USRE36449E (en) | Chimeric gene for the transformation of plants | |
| US5034322A (en) | Chimeric genes suitable for expression in plant cells | |
| UA80895C2 (en) | Transformed plant | |
| CA2637588A1 (en) | Chimeric regulatory sequences comprising introns from dicotyledons for plant gene expression | |
| EP0353908B1 (en) | DNA constructs and plant incorporating them | |
| Chen et al. | Obtaining transgenic Anthurium through Agrobacterium-mediated transformation of etiolated internodes | |
| US6229065B1 (en) | Production of plants resistant to attacks by Sclerotinia sclerotiorum by the introduction of a gene encoding an oxalate oxidase | |
| US5919998A (en) | Genetic control of plant hormone levels and plant growth | |
| US20020157135A1 (en) | Polynucleotide and method for selectively expressing a protein in a target cell or tissue of a plant | |
| EP0494215A1 (en) | Light-activatable plant promoter | |
| US6362396B1 (en) | Chimeric gene for the transformation of plants | |
| AU769546B2 (en) | Method for obtaining transgenic plants expressing a protein with activity producing hydrogen peroxide by transformation by Agrobacterium rhizogenes | |
| AU2004227405A1 (en) | MtHP promoter element | |
| MX2008010632A (en) | Chimeric regulatory sequences comprising introns from dicotyledons for plant gene expression | |
| MXPA00009108A (en) | Genes controlling diseases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| EEER | Examination request | ||
| MKEX | Expiry |