BG61275B1 - Production of plants resistant to attacks of sclerotiniasp.by introducing a gene coding for an oxalate oxidase - Google Patents

Abstract

A DNA sequence coding for an oxalate oxidase. The protein isuseful in making plants resistant to diseases caused bySclerotinia sp. It may be provided by a chimeric gene and a vectorcontaining the coding sequence. It is useful in increasing theresistance of plants to diseases due to Sclerotinia sp.

Description

The present invention relates to a gene encoding an oxalate oxidase, a protein encoded by that gene, chimeric genes comprising this gene and their transformation application in order to transmit resistance to plants to diseases caused by mold.

Sclerotiniosis is the most common fungal disease that affects a large range of bipedal plants. Agent agent Sclerotinia Sclerotiorum is a polyphage mold that exhibits poor host specificity.

The mold can attack the plant both directly at the level of the stem and at the level of the leaf and then spread to the stem or at the inflorescence level. In the first two cases, the plant withers due to interruption of nutrient supply. In the latter case, the flowers fade, thus damaging the harvest.

The mold produces lytic enzymes that break down the cell wall of infected plants, facilitating its development in the plant. These enzymes play an important role in pathogenicity, but they do not seem to be sufficient. These molds also produce oxalic acid (Godov et al., 1990), which causes the pH of the infected tissues to drop, thereby promoting the hydrolysis of the cell wall by lytic enzymes. Reduction of oxalic acid production or degradation would allow a delay or even inhibition of mold development.

In order to develop a "nos" resistant plant, the detoxification strategy of oxalic acid can be used. The degradation of this acid would limit the decline in the intracellular pH of the plant's attacked tissues, whereby lytic enzymes must function at pH values far beyond the pH optimum in order to be truly active and efficient. This would reduce the pathogenicity of the mold.

Oxalate oxidase that catalyzes the following reaction:

o ₂

C ₂ 0 ₄ H ₂ ---------> 2CO ₂ + H ₂ O ₂ oxalate oxidase can be used to achieve the goal.

Oxalatoxidase is isolated from various plants, usually from monocotyledons (Pieta et al., 1982): it can, for example, be purified with barley protein using conventional chromatographic techniques (Superdex G-75 filtration gels and MonoQ ion exchange gels, Pharmacia) and the enzymatic activity is monitored according to the following colorimetric procedures (Obzansky and Richardson, 1983):

Oxalic acid + 0 ₂ ------> 2CO ₂ + H ₂ 0 ₂ + oxalate oxidase

Hj0 ₂ + MWH + DMA --------> indamine + H ₂ O + peroxidase

MWTH = 3-methyl-2-benzothiazolinone hydrazone

DMA = Ν, Ν-dimethylalanine

This allows the purification of a protein that has an molecular weight of 26,000 daltons on acrylamide gel under denaturing conditions. Part of the purified oxalate oxidase is used to prepare rabbit antioxal oxidase antibodies; the remainder of the protein is used to carry out the native protein sequencing (N-terminal) or after cleavage with cyanobromide to sequence some internal peptides.

The results obtained are as follows:

N end: “DPDPLQDF - VADLDG KAVSVNGH Internal Peptide No. 2: HFQFNVGKTEAY cDNA

Comparison of the peptide sequences described above with the data contained in the Swiss-Port protein bank makes it possible to identify a cereal protein called Germine and published in 1989 by Dratewka-kos et al. The experiments performed allow us to determine that the cDNA published by the authors encodes a protein consisting of 201 amino acids and exhibiting oxalate oxidase activity. In the remainder of the description of the present experiments, the nucleotide numbering of FIG. 2 of the authors' article, published in J. Biol.Chem., 264, 4896-4900.

The sequence of this cDNA consists of 1075 nucleotides in length, with 85 untranslated residues at the 5 'end, an open reading frame of 672 nucleotides (positions 86 to 757), and 318 untranslated residues at the 5' end.

Comparison of the peptide sequence derived from the cDNA sequence with that obtained by sequencing the native protein shows that the cDNA encodes not only a "mature" oxalate oxidase but also a signal peptide of 23 amino acids at the N terminus. Therefore, oxalate oxidase is synthesized in the form of a preprotein (signal peptide and mature peptide), which is further matured by removing the signal peptide in order to release the mature active enzyme.

We will further use either the portion encoding the preprotein (nucleotides 86 to 757) or only that portion encoding the mature protein (from positions 155 to 757). In the latter case, the AUG codon encoding methionine should be placed before the ACC codon encoding threonine, the first amino acid of the mature protein.

Since the attack on Sclerotinia Sclerotiorum plants is predominantly through the stem of the plant, it is advisable to be able to express oxalate oxidase or in chlorophyll tissues, and therefore the promoter of the small ribulose 1,5-diphosphate carboxylase carboxylase subunit carboxylase promoter may be used. / PSuHa, Waksman et al., 1987 / or in different tissues of the plant, which is why they use the universal promoter 35S of RNA of the cauliflower mosaic virus / CaMV 35S /, part of which is duplicated and called "double caMV" .

The chimeric genes of the invention can be constructed, for example, from the following elements:

A. A double CaMV promoter followed by a portion of the oxalate oxidase cDNA encoding the preprotein (signaling protein and mature protein) and the "nos" terminator derived from the pTi 37 nopalin synthesis gene (Bevan et al., 1983).

B. A double CaMV promoter followed by that portion of the oxalate oxidase cDNA encoding only the mature protein, followed by the "nos" terminator.

C. A gene identical to "A" but with a promoter of the small ribulose subunit 1.5diphosphate carboxylase / PSuHa / from sunflower instead of double CaMV

D. A gene identical to "B" but with a PSuHa promoter instead of the double CaMV.

Each chimeric gene is introduced into the plant cell through a system using Agrobacterium or any other known plant cell transformation system. Plants are regenerated by these transformed cells. They exhibit increased tolerance for Sclerotinia sclerotiorum.

SPECIFIC EXAMPLES FOR IMPLEMENTATION

Example 1. Preparation of two coding sequences.

Preprotein. Obtained from the above-described DNA digested with HindIII (position 66). The resulting adhesive end is blunted by Klenow polymerase treatment. This DNA was then digested with Nhel (at position 811).

Plasmid PUC 19 (Yanisch-Perron et al., 1985) was digested in parallel with Sacl.

The resulting adhesive end is blunted by Klenow polymerase treatment. The plasmid was then digested with Xbal (compatible with Nhel).

The cDNA fragment and the plasmid prepared above are bound. The new plasmid thus obtained is called pRPAoho-01 and its map is shown in FIG. 1.

B. Mature protein. Obtained from the cDNA described above after digestion with BstNI (at position 173). The resulting fragment and linker in sequence:

5 '3'

ATGACCGACCCAGACCCTCTCC TACTGGCTGGGTCTGGGAGAGGT 3 '5' are ligated. This results in a modification of the N-terminal sequence of the mature protein, which changes from TDPDPLQ to MTDPDPLQ.

This cDNA fragment was then digested with Nhel (at position 811) so that it could be ligated with plasmid pUC19 prepared as described above. The new plasmid thus formed is called pRPA-oxo-02 and its map is shown in FIG. 1.

Example 2. Production of chimeric genes.

a / Preparation of vectors containing the promoter and terminator "nos"; - Example double CaMV: this vector was obtained from plasmid pRPA-BL-410, obtained as follows:

Merger (Fusion) of PSU transit peptide from RuBisCO / Aroa maize gene

The PSU transit peptide from the maize Ru BisCO gene was derived from the 192 - bp EcoRI-SphI fragment (base pairs); is derived from a cDNA corresponding to the PSU gene of the maize RuBisCO gene described by Lebrun et al (1987) having an Ncol site comprising the translation initiation codon and an SphI site corresponding to the cleavage site of the transit peptide.

The translational fusion between the maize transit peptide and the bacterial EPSPS gene is obtained by treating the SphI end with bacteriophage T4 polymerase and ligation with the Ncol end treated with the Klenow polymerase to the AcoA gene of pRPA-BL 104, re-cut with EcoRI .

Fusion (fusion) of PSB maize transit peptide from RuBisCO maize / sequence of 22 amino acids from the mature PSU maize RuBisCO / AgoA gene.

Similarly, an EcoRI-HindIII fragment of 228 bp from PSU cDNA of the maize RuBisCO gene was ligated with the Ncol end treated with Klenow polymerase to the AgoA gene of pRPABL 104 and re-cut with EcoRI. The translation fusion takes place between the PSB maize transit peptide of RuBisCO maize, the 22 amino acids of the mature PSU maize of RuBisCO, and the bacterial EPSPS gene.

PSU transit peptide from RuBisCO sunflower.

The fragment was obtained from cDNA isolated from Waksman and Freyssinet (1987). An SphI site was created according to the method of Zoller and Smith (1984) at the transit peptide cleavage site. The transit peptide thus obtained from the PSU from sunflower RuBisCO represents an EcoRI-SphI fragment with 171 bp.

Fusion of a PSB transit peptide from the Sunflower RuBiSCO sequence of 22 amino acids from the mature portion of the PSU of the maize RuBiSCO / AgoA gene.

The structure containing the PSB maize PSU peptide of RuBiSCO maize, a sequence of 22 amino acids of the PSU of maize RuBiSCO from the mature part of the maize fusion gene is cut with an EcoRI-SphI of 171 bp corresponding to the transit peptide of PSU from PSUCO of g PSU . The resulting structure shows replacement of the EcoRI-SphI fragments and is a translational fusion, a PSU transit peptide of the sunflower RuBiSCO sequence of 22 amino acids from the mature portion of the maize RuBiSCO / AgoA gene.

The EcoRI-Sall fragment was ligated with the Sall-SstI fragment containing the 3 'nos sequence and the straight end of T-DNA. The resulting EcoRI-SstI fragment, including the "transit peptide of the PSU from RuBiSCO sunflower / a sequence of 22 amino acids of the mature PSU of the maize RuBiSCO / AroA gene / 3 '" nos "/ T-DNA right end" replaces the EcoRI-SstI fragment containing the right end of T-DNA from plasmid 150 A 2 containing the double CaMV promoter. The transcription fusion “double CaMV / PSB transit peptide from RuBiSCO sunflower / a sequence of 22 amino acids from the mature PSU of the maize RuBiSCO / AroA gene / 3” nos in vector 150 Aa 2 is called pRPA-BL 294.

Fusion of PSB sunflower peptide peptide RuBiSCO sequence of 22 amino acids PSU of maize RuBiSCO transit peptide PSU of maize RuBiSCO / AgoA gene.

The engineered structure was excised with Ncol-HindIII, releasing the AgoA gene. It was then ligated with a 1.5 sq. Ncol-HindIII fragment containing the fused "PSU maize transit peptide from the RuBiSCO / AroA gene". The resulting structure shows the replacement of Ncol-HindIII fragments and is a translational fusion "PSB transcript peptide from RuBiSCO sunflower / sequence of 22 amino acids from PSB from RuBiSCO from the mature maize gene / PSU transcript peptide from maize RuBSS maize RuBiSCO.

The EcoRI-Sall fragment was ligated with

The Sall-SstI fragment containing the 3 '' nos' sequence and the right end of T-DNA. The resulting EcoRI-Sstl fragment containing a "transit peptide of PSU from sunflower RuBiSCO sequence of 22 amino acids from PSU from RuBiSCO from the mature part of the maize gene / transit peptide from PSU from maize RuBiSCO / AroA gene / T" nos / T end ”, is replaced by the EcoRI-SstRI fragment containing the right T-DNA end of plasmid 150 A a 2 containing the double CaMV promoter. The transcription fusion "dual CaMV / PSB peptide transcript from RuBiSCO sunflower / sequence of 22 amino acids from PSB from RuBiSCO from the mature part of the maize gene / PSB transit peptide from maize RuBiSCO / AroA gene / 150 'A" nos a 2 is called pRPABL 410. This plasmid was digested with EcoRI and Sall in order to isolate the structural gene "optimized transit peptide - region encoding mature EPSPS, deleted pRPA-BL-410 / see FIG. 1 /.

- PSU Example of: this vector was obtained from plasmid pRPA-BL-207 / described in EP 0337899, which was digested with EcoRI and HindIII, in order to separate the nitrile-encoding region, pRPA-BL-207, deleted / see .fig. 1 /.

b. Construction of chimeric genes.

- pRPA-oo-OO: obtained by grinding pRPA-oxo-01 with EcoRI and Sall. The resulting protein-coding fragment is inserted between the EcoRI and Sall sites below the double CaMV and above the "nos" terminator.

- pRPA-oxo-04: obtained by grinding pRPA-oxo-02 with EcoRI and Sall.

The resulting fragment encoding the mature protein is then inserted between the EcoRI and Sall sites below the double CaMV and above the "nos" terminator.

- pRPA-oxo-05: obtained by mixing pRPA-oxo-01 with EcoRI and HindIII.

The resulting protein-coding fragment was then inserted between the EcoRI and HindIII sites below the double PSU and above the "nos" terminator.

- pRPA-oxo-06: obtained by grinding pRPA-oxo-02 with EcoRI and HindIII. The resulting fragment encoding the mature protein is then inserted between the EcoRI and HindIII sites below the PSU of the promoter 25 and the "nos" terminator.

Table 1

Schematic representation of the four chimeric genes.

Identification The promoter Oxalatoxidase coding region Terminator pRPA-oxo-03 dCaMV preprotein nos pRPA-oxo-04 dCaMV mature nos pRPA-oxo-05 PSUHa preprotein nos pRPA-oxo-06 PSUHa mature nos

Example 3. Preparation of transgenic rapeseed

a. Transformation

Each vector, as described above, was inserted into the non-oncogenic Agrobacterium tumefaciens strain EHA 101 (Hood et al., 1987), bearing the cosmid pTVK (Komari et al., 1986).

The method of transformation of rapeseed, Westar variety, is mainly based on the described transformation by boulter et al. (1990) using a bacterial concentration of 2.5x10 'per ml / DO 600 nm 1 /.

b. Regeneration.

The regeneration method is based largely on the one described by Boulter et al. / 1990 /. Plants are planted in the environment of De Block et al. / 1989 /. They are then transferred to the greenhouse for the flowering stage.

Example 4. Measurement of rapeseed resistance to Sclerotinia Sclerotirum.

In vitro:

- Leaf petals: Resistance is measured by weighing the mass of three leaf petals after 11 days of growth on Murashige and SKoog / MS / c hormone media to which 1 mM oxalic acid is added.

Under these conditions, it has been observed that in the leaf petals derived from rapeseed modified with one of the chimeric genes, pRPAoho-03, pRPA-oxo-04, pRPA-oxo-05 and pRPAoho-06, the mass of the leaf petioles increases significantly while in the case of leaf petioles obtained from unmodified rape, the mass remains unchanged or even decreases.

Extension of roots. Resistance is also measured in vitro by measuring root elongation after growth for two days in water to which 5 mM oxalic acid is added. It is observed in this case that the roots of rapeseed plants modified in one of the chimeric genes, pRPA-oxo-03, pRPA-oxo-04, are capable of growing and increasing their length, whereas the roots of unmodified rapeseed show no growth at these conditions.

In vivo:

In vivo resistance is measured in a greenhouse after infecting rape plants obtained from regeneration as soon as the first flowers have appeared, either by placing spores of S. sclerotiorum on the petals, whereby leaf infection naturally occurs during fallout. of the petals, or by directly placing the micelles or the micelles-impregnated petals on the leaves. Plants modified with one of the chimeric genes, pRPAoho-03, pRPA-oxo-04, pRPA-oxo-05 and pRPAoho-06, do not allow the mold to develop and exhibit no symptoms characteristic of sclerotiniosis rot , while unmodified plants are soon conquered by the decay characteristic of Sclerotinia sclerotiorum.

DESCRIPTION OF THE ANNEXED 10 FIGURES

A method for producing the four chimeric genes from the two structural genes, pRPA10-01, and pRPA-xox-02H, HindIII; B, BstN; Hel, Nhel; Ε, EcoRI; Sc, SacI; S, Sall and X, Xbal.

Claims (8)

Claims 1. A DNA sequence encoding an oxalate oxidase that is useful for conferring plant resistance to diseases caused by Sclerotinia sp. 2. A protein, oxalate oxidase, which is used to give plants resistance to diseases caused by Sclerotinia sp. A chimeric gene comprising the DNA coding sequence of claim 1. A plant transformation vector comprising the chimeric gene of claim 3. A transformed plant cell comprising a vector according to claim 4. A transformed plant derived from a cell according to claim 5. A plant according to claim 6, which is bi-weekly. The plant of claim 7, which is rapeseed.