CN103421807A - Application of OsMYB91 transcription factor in rice growth and stress-tolerance - Google Patents

Abstract

The invention belongs to the technical field of rice genetic engineering, and in particular relates to functions and application of a transcription factor gene OsMYB91 in an MYB family relevant to stress-tolerance. The gene has the nucleotide sequence length of 990 bp, and is induced by various stress conditions such as drought simulation, cold, salt, heat shock, and plant hormones including ABA, ACC, NAA, 6-BA, JA, SA and the like; under the natural growing condition, the plant height of an over-expression pant of the gene is obviously lowered than that of a wild plant and an inhibited plant; when a rooting culture medium containing mannitol and ABA is used for treating the seedlings of over-expression, RNAi and wild plants, the over-expression of the gene is discovered to be capable of increasing the resistance to mannitol, and meanwhile, the growth and the germination rate of the transgenic plant are both influenced by an exogenous ABA; measurement of physiological indexes relevant to stress-tolerance of different transgenic plants after the NaCl treatment shows that the gene has the function of reinforcing the resistance of the rice.

Description

The OsMYB91 transcription factor gene Development of Rice and degeneration-resistant in application

Technical field

The invention belongs to the plant gene engineering technology field.Be specifically related to a transcription factor gene OsMYB91 of paddy rice MYB family functional verification and Development of Rice and degeneration-resistant in application.

Background technology

Transcription factor, also claim trans-acting factor, be can with gene promoter region in the interactional DBP of cis-acting elements generation specificity.In plant many inducible genes can be regularly, quantitatively and at specific position express, all with in specific transcription factor and genes involved specifically cis-acting elements mutually regulate and control relevant.

MYB class family transcription factor refers to a class transcription factor that contains the MYB structural domain.The MYB structural domain is one section approximately 51～52 amino acid whose peptide section, wherein contain 3 tryptophan residues, these 3 residues are separated by 18～19 amino-acid residues, form a hydrophobic core, comprise a series of conservative amino-acid residues and intervening sequence, make the MYB structural domain be folded into the helix turn helix structure.The number repeated according to its conservative territory tryptophane, MYB albumen can be divided into to four types: R2R3-MYB, 1R-MYB, 3R-MYB and 4R-MYB (Dubos, et al.2010.MYB transcription factors in Arabidopsis.Trends Plant Sci10:573-581), myb transcription factor family extensively is present in (Lippold et al. in animals and plants and fungi, 2009.AtMyb41 regulates transcriptional and metabolic responses to osmotic stress in Arabidopsis.Plant Physiology149:1761-1772).And, in plant, R2R3 class MYB albumen occupies great majority, in 198 MYB family members of Arabidopis thaliana known today, there are 126 for R2R3 class MYB albumen; And in 183 MYB encoding genes having identified in rice genome, the R2R3 class members has 109 (Chen et al., 2006.The MYB transcription factor super family of Arabidopsis:expression analysis and phylogenetic comparison with the rice MYB family.Plant Molecular Biology60:107-124).By to Arabidopis thaliana arid, high salt and ABA, inducing the promoter region of MYB genoid to be analyzed, the core sequence that has identified the MYB binding site is PyAACTG (Zhang et al., 2010.Carbon starved anther encodes a MYB domain protein that regulates sugar partitioning required for rice pollen development.Plant Cell, 22:672-689); These transcription factors are present in high salt, low temperature and arid ABA Dependent of replying, when the PyAACTG core sequence of itself and downstream target gene promoters in conjunction with after, can induce expression (Abe et al., 1997.Role of Arabidopsis MYC and MYB homologs in drought and abscisic acid-regulated gene expression.Plant Cell 9:1859～1868 of stress resistance gene; Lescot et al., 2002.Plant CARE, a data base of plant cis-acting regulatory elements and a portal to tools in silico analysis of promoter sequences.Nucleic Acids Res.30:325-327; Zhang et al., 2010.Carbon Starved Anther Encodes a MYB Domain Protein That Regulates Sugar Partitioning Required for Rice Pollen Development.Plant Cell, 22:672-689).At present, about myb gene research of function in Arabidopis thaliana of plant generally believe that their participate in growing, hormone signal conduction, secondary metabolism, biology and abiotic stress is replied and (Liu Lei etc., effect and molecule mechanism .HEREDITAS30 (10): the 1265-1271.s thereof of 2008.MYB transcription factor in plant stress-resistance is coerced such as susceptibility of ABA; Harald et al.1998.Towards functional characterisation of the members of the R2R3-MYB gene family from Arabidopsis thaliana.The Plant Journa.16 (2), 263-276; Ralf et al.2001.Current Opinion in Plant Biology 4:447-456 The R2R3-MYB gene family in Arabidopsis thaliana; Chen et al., 2006.The MYB transcription factor super family of Arabidopsis:expression analysis and phylogenetic comparison with the rice MYB family.Plant Molecular Biology60:107-124; ).The myb gene of also having found some R2R3 types recent years also participates in growing building up as root architecture in paddy rice, the growth of pollen and to the resistance of abiotic stress, nitrogen phosphorus efficiency utilization etc., but and the research in Arabidopis thaliana comparatively speaking, still relatively less (Zhang et al., 2010.Plant Biologists Carbon Starved Anther Encodes a MYB Domain Protein That Regulates Sugar Partitioning Required for Rice Pollen Development.The Plant Cell, Vol.22:672-689, Dai et al., 2013.OsMYB2P-1, an R2R3 MYB Transcription Factor, Is Involved in the Regulation of Phosphate-Starvation Responses and Root Architecture in Rice.Plant Physiology 159:169-183, Yang et al, 2012.A R2R3-type MYB gene, OsMYB2, is involved in salt, cold, and dehydration tolerance in rice.J Exp Bot63:2541-2556, Ashraf et al., The Rice R2R3-MYB Transcription Factor OsMYB55 Is Involved in the Tolerance to High Temperature and Modulates Amino Acid Metabolism).

Plant growth hormones is the important regulatory factor of growth and development of plants (seed germination, bloom, solid) and metabolic process, five large classes be can be divided into, growth hormone (IAA), Plant hormones regulators,gibberellins (GA), phytokinin (KT), dormin (ABA) and ethene (Eth) etc. comprised.Dormin is the class major hormone in the Water Stress signal.AtMyb2 gene in Arabidopis thaliana MYB family is induced relevant (Takeshi et al. by first confirmation to water stress and ABA, 1996.A transcriptional activation domain of ATMYB2, a drought-inducible Arabidopsis Myb-related protein.The Plant Journal10:1145-1148).In addition, also find that in Arabidopis thaliana a plurality of MYB members participate in the responsing reaction of growth hormone, ethene and phytokinin (Dubos et al., 2010.MYB transcription factors in Arabidopsis.Trends Plant Sci 15:573-581).And about MYB genoid in paddy rice, the research of hormone response is reported seldom to (Lu et al. in recent years, 2002.Three Novel MYB Proteins with One DNA Binding Repeat Mediate Sugar and Hormone Regulation of a-Amylase Gene Expression.The Plant Cell, Vol.14,1963-1980).

In addition, a series of report finds that the expression in the adverse circumstance environment has extremely important effect to transcription factor in apparent modification.In corn the ZmMI gene at low temperatures abduction delivering just be accompanied by the methylated minimizing of nucleosome core regional DNA (Steward et al., 2002.Periodic DNA methylation in maize nucleosomes and demethylation by environmental stress.J Biol Chem277:37741-37746).And in tobacco, multiple degeneration-resistant mechanism can cause that the demethylation of NtGPDL coding affects the expression (Choi CS et al., 2007Abiotic-stress induces demethylation and transcriptional activation of a gene encoding a glycerophosphodiesterase-like protein in tobacco plants.Mol Genet Genomics277:589-600) of gene thus.After rice seedling is met waterlogging; the H3K4me3 of the gene of coding ethanol dehydrogenase and pyruvic carboxylase and degree of acetylation all reduce and make corresponding gene up-regulated expression (Tsuii H; et al., 2006.Dynamic and reversible changes in histone H3-Lys4 methylation and H3 acetylation occurring at submergence-inducible genes in rice.Plant Cell Physiol47:995-1003).And the transcribe situation of the discovery Stress response transcription factors such as Song in the adverse circumstance treating processes is subject to impact (the Song Y of DNA methylation and histone modification, et al., 2012The Dynamic Changes of DNA Methylation and Histone Modifications of Salt Responsive Transcription Factor Genes in Soybean.PLoS one.e41274).

In sum, growth conditions in the rice growth process is affected by hormon and multiple ambient conditions, and can strengthen paddy rice about MYB class transcription factor, the research of adaptive capacity to environment is still few to external world, and the degeneration-resistant mechanism of this genoid neither be very clear, the present invention is studied the OsMYB91 biological function by methods such as transgenosis, cytobiology, molecular biology, and further disclosed it has important effect in rice growth and abiotic stress.

Summary of the invention

The object of the invention is to clone one to Development of Rice and degeneration-resistant relevant transcription factor gene, by rice transformation itself, obtain this clone's transfer-gen plant.By to whole growth period of transgenic paddy rice on the ground and the research of underground part Phenotypic Observation and analysis and associated molecule mechanism, determined the effect of this gene in rice growth and degeneration-resistant process, for paddy rice anti contravariance breed improvement etc. provides reference.

To achieve these goals, the present invention is achieved through the following technical solutions:

(1) the present invention from paddy rice, separate obtain one to Development of Rice and degeneration-resistant relevant transcription factor gene OsMYB91 (LOC_Os12g38400), its nucleotide sequence is as shown in sequence table SEQ NO:1, wherein the sequence shown in the 1-990 position in this sequence table is the coding region of this gene, the albumen of its coding is in different plant species, the highest the highest with Arabidopis thaliana AtMYB91 homology, reach 54%, we are OsMYB91 by this unnamed gene.Built the overexpression vector of this gene according to this full length gene cDNA sequence information after sequence verification, built double-stranded inhibition RNAi carrier simultaneously, it is the DNA sequence dna shown in the 1-375 position in sequence table SEQ NO:2.In order to determine the expressive site of this gene at cell, further built GFP-NLS (nuclear localization signal) carrier, according to the GFP expression, determine the expression pattern of gene, it is the DNA sequence dna shown in sequence table SEQ NO:1.

The gene of transcription factor of the present invention (SEQ ID NO:1) derives from paddy rice, and by 990 based compositions, the protein coding sequence of its supposition has 330 bases, is that sequence 1 holds the 1st bit base to form to 990 bit bases from 5 '.This gene not yet has any bibliographical information on reaching the impact of rice growth on hormone, Stress response.By different HORMONE TREATMENT wild-type rice plants, detect the expression of this gene, find that this gene is subject to arid (PEG), cold (4 ℃ of processing), NaCl, heat shock (42 ℃ of pyroprocessing), each kind of plant exogenous hormone, as inducing of dormin (ABA), 1-amino-cyclopropane-1-carboxylic acid (ACC), naphthylacetic acid (NAA), 6-benzylaminopurine (6-BA), jasmonic (JA), Whitfield's ointment (SA) etc.Build overexpression vector pU1301 (sequence is as shown in SEQ ID NO:1), the dsRNAi carrier (sequence is as shown in SEQ ID NO:2) of this gene, obtain conversion carrier pU1301-OsMYB91, pDS1301-OsMYB91, this conversion carrier is transformed into to rice varieties " in spend 11 ", obtain this gene overexpression, suppress the transgenic positive rice plant of expressing.Find after the Phenotypic Observation statistical study that the transgenic rice plant of this gene overexpression is obviously than wild-type rice plant short (being shown in Fig. 8 A).Get respectively mature tissue and intercalary meristem and carry out the resin embedding ultrathin section(ing), discovery is greater than dsRNAi in maturation zone overexpression transfer-gen plant individual cells length, and to be less than wild-type be that overexpression is less than wild-type and is less than dsRNAi (seeing Fig. 8 B) in intercalary meristem, detect and the cell fission genes involved: IP type CTK oxydase, synthetic enzyme and transhipment key enzyme at mature tissue and merismatic expression, illustrate the change of overexpression plant plant height short be the coefficient result of cell fission and cell elongation (seeing Figure 10).When overexpression, wild-type and dsRNAi transfer-gen plant being carried out to the processing of N.F,USP MANNITOL (concentration is 200 μ M) simulating drought, find that the over-ground part growing way of overexpression plant is significantly better than wild-type, and the transfer-gen plant growth retardation of dsRNAi, this illustrates that the overexpression of this gene can improve the resistance (see Figure 11) of rice seedling to N.F,USP MANNITOL.When overexpression, wild-type and dsRNAi transfer-gen plant being carried out to dormin, be that ABA (concentration is 3 μ M) is while processing, with respect to control group, its over-ground part height all has been subject to inhibition, but the degree suppressed is different, illustrates that Exogenous ABA can affect the expression of OsMYB91 gene.Cultivate the seed of overexpression plant, wild-type plant and dsRNAi transfer-gen plant with the root media containing different concns (0 μ M, 1 μ M, 3 μ M) ABA, add up its percentage of germination situation after 7 days, the percentage of germination of finding overexpression transfer-gen plant seed obviously is greater than control group, and the percentage of germination of dsRNAi transfer-gen plant seed is starkly lower than control group (seeing Figure 13).Show that this gene can strengthen the resistance to ABA during seed germination.With in methylase inhibitor 5-Aza-U-18496 and treated with sodium butyrate rice varieties, spending 11 seedling, detect the OsMYB91 gene expression amount, find that its expression amount of prolongation along with the treatment time rises, the tolerance of this gene pairs hypersaline environment may cause due to apparent modifications such as DNA methylations.

Concrete operation step is as follows:

1) full-length cDNA of amplification OsMYB91 gene, after the upper paddy rice sequence alignment of announcing of the sequence that order-checking is obtained and Rice Genome (http://rice.plantbiology.msu.edu/index.shtml), the accession number of knowing this gene is LOC_Os12g38400.According to the primer of the sequences Design related vector checked order, take rice cDNA as template, its total length that increases (990 to downstream bases of translation initiation site), obtain DNA fragmentation, and as shown in SEQ IDNO:1, the primer sequence is as follows:

OsMYB91-F：5’-CGCGGATCCTGGCGAACACCGATGCAG-3’，

OsMYB91-R：5’-CCGGAATTCGATCTCTACGGGCGGCCAG-3’.

2) according to the OsMYB91 gene order information of order-checking, the double-stranded dsRNAi of inhibition of design primer builds pDS1301 gene inhibition expression vector pDS1301-OsMYB91, and primed DNA sequence used is as follows:

dsMYB91-F：5’-GGG?ACTAGT?GGTACC?AAGCGGCTGGGCAAGTGGT-3’，

dsMYB91-R：5’-GGG?GAGCTC?GGATCC?TCTGCCCTTCCTCCATCTCC-3’。

5) by step 1) and 2) the middle corresponding digestion with restriction enzyme of fragment that increases and obtain, and cut respectively overexpression vector pU1301 (Sun and Zhou with corresponding restriction enzyme simultaneously, 2008, RicejmjC domain-containing gene JMJ706encodes H3K9 demethylase required for floral organ development.PNAS.36:13679-13684) upper (Fig. 1) and dsRNAi carrier pDS1301 (Fig. 2).Connecting heat shock with ligase enzyme again is transformed in competence DH10B.PU1301 Genetic Transformation in Higher Plants carrier pCAMBIA1301 (Sun et al. commonly used in the world in being, 2004.Xa26, a gene conferring resistance to Xanthomonas oryzae pv.oryzae in rice, encoding a LRR receptor kinase-like protein.Plant Journal.37:517-527) transform on basis and form.Obtain conversion carrier OsMYB91-pU1301 and OsMYB91-pDS1301; Utilize agriculture bacillus mediated transgenic method (Hiei et.al., 1994.Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA.PlantJ6:271-282) described carrier is spent to 11 in the Introduced into Rice acceptor respectively, obtains transformed plant OxMYB91 and dsMYB91;

6) identify positive transfer-gen plant by the method for PCR, recycling quantitative fluorescent PCR, the expression amount of genes involved in the detection transfer-gen plant; Identify the phenotype of transfer-gen plant, and carry out statistical study;

7) with in high salt, the adverse circumstance such as cold, arid and various HORMONE TREATMENT wild-type rice varieties, spending the 11 germinations seedling of 10 days, detect OsMYB91 replying the Different stress condition;

8) overexpression of OsMYB91 and suppress that the transgenic positive plant carries out various adverse circumstances and hormone is coerced, observe its phenotype;

The overexpression of the OsMYB91 that 9) will germinate 14 days and inhibition transgenic positive plant 150mM NaCl solution-treated 48h for seedling, measure various degeneration-resistant relative physiologic indexes under salt stress.

10) spend 11 seedling in the treated with sodium butyrate rice varieties with the methylase inhibitor 5-nitrogen-2 ' of 100 μ M-Deoxyribose cytidine and 3mM, detect the OsMYB91 gene expression amount.

Compared with prior art, advantage of the present invention is as follows:

Paddy rice is as one of global staple food crop, and the degeneration-resistant molecule mechanism of Study On Rice, to alleviating food shortage, especially ensures that the grain security of China has great significance.How to improve rice yield, improve rice quality and become a significant problem in science.Certainly will contribute to improve the adaptive faculty of paddy rice to the adverse circumstance environment and find in paddy rice to degeneration-resistant relevant gene, enlarge the planting range of paddy rice under the different geographical varying environment, thereby improve output.Research finds that MYB class transcription factor can involved in plant replying adverse circumstance.But at present correlative study focuses mostly in Arabidopis thaliana, and about the MYB genoid report of the research in paddy rice less.The present invention's separation obtains a transcription factor OsMYB91 of paddy rice MYB family, by different HORMONE TREATMENT wild-type plant, detect the expression of this gene, find that this gene is subject to arid (N.F,USP MANNITOL), cold, NaCl, heat shock, ABA, ACC, NAA, 6-BA, the hormone inductions such as JA, SA, overexpression and dsRNAi carrier by this gene of genetic transformation, obtain corresponding transfer-gen plant.The overexpression plant of finding this gene obviously spends 11 plant short than it in corresponding wild-type.Process by N.F,USP MANNITOL and ABA, find that the overexpression plant of this gene is contrary with the double-stranded RNAi of inhibition plant variation tendency.Show that this gene can make and replying adverse circumstance, show the resistance to adverse circumstance.

The accompanying drawing explanation

Sequence table SEQ ID NO:1 is the nucleotide sequence of the R2R3 class myb transcription factor gene OsMYB91 that clones of the present invention.Sequence length is 990bp, 330 amino acid of encoding.

Sequence table SEQ ID NO:2 is the aminoacid sequence of the protein of the transcription factor gene OsMYB91 shown in sequence table SEQ ID NO:1,330 amino acid of encoding.

Sequence table SEQ ID NO:3 be the present invention build two strands suppress the nucleotide sequence of RNAi carrier (pDS1301-OsMYB91).Sequence length is 375bp.

Fig. 1: the schematic diagram of overexpression vector pU1301 and OsMYB91-pU1301.Upper part of this figure is expression vector plasmid pU1301 figure, and lower part is the OsMYB91-pU1301 overexpression vector figure that the present invention builds.

Fig. 2: double-stranded carrier pDS1301 and the OsMYB91-pDS1301 schematic diagram of suppressing.Upper part of this figure is expression vector plasmid pDS1301 figure, and lower part is that the OsMYB91-pDS1301 that the present invention builds suppresses carrier figure.

Fig. 3: the schematic diagram of appraising and deciding a carrier pU1391bGFP and OsMYB91-pU1391bGFP.Upper part of this figure is expression vector plasmid pU1391bGFP figure, and lower part is that the OsMYB91-pU1391bGFP that the present invention builds appraises and decides a carrier figure.

Fig. 4: the OsMYB91 gene is appraised and decided position and expression pattern analysis.Wherein

Fig. 4 A is that OsMYB91 rna level expression amount in callus (Ca), root (Ro), sheath (Sh), joint (In), leaf (Le), sword-like leave (F1), three phase children's fringes (Pa3) and five phases children's fringes (Pa5) detects.

Fig. 4 B is that the expressive site of Ubi-OsMYB91-GFP in onion epidermis cell detects, and wherein 1 is the onion epidermis cell that turns the GFP control vector.GFP is arranged in the light field that each position 2 of cell is 1 onion epidermis cells.The 3rd, turn the onion epidermis cell of OsMYB91-GFP fusion expression vector.The OsMYB91-GFP fusion rotein is positioned at nucleus.4 is light fields of onion epidermis cell in 3.

Fig. 5: wild-type rice plant OsMYB91 gene RNA horizontal expression amount after arid, cold, NaCl, heat shock, optical processing condition detects.

Fig. 6: the wild-type rice plant is after dormin (ABA), 1-amino-cyclopropane-1-carboxylic acid (ACC), naphthylacetic acid (NAA), 6-benzylaminopurine (6-BA), jasmonic (JA), Whitfield's ointment (SA) are processed, and different time points samples the OsMYB91 gene RNA horizontal expression amount situation detected.

Fig. 7: the detection of OsMYB91 gene expression amount in overexpression plant and RNAi transfer-gen plant thereof.The expression amount that wherein Fig. 7 A is OsMYB91 gene in OsMYB91 overexpression plant detects, and WT represents negative control; OX (1-n) represents that the T1 of the different familys of overexpression transgenic positive plant is for plant; Fig. 7 B is the expression amount detection that OsMYB91 suppresses to express OsMYB91 gene in plant, and WT represents negative control; RM (1-13) representative suppresses the T1 of the different familys of express transgenic positive plant for plant.

Fig. 8: under natural condition, OsMYB91 wild-type, overexpression and RNAi plant strain growth situation with and mature tissue and meristematic cell length.Wherein Fig. 8 A is different transgenosis over-ground parts under the grown in field situation; In Fig. 8 B upper and under, as the section of blade table chrotoplast, mature tissue and intercalary meristem's cell section.WT represents negative control, and OxMYB91, dsMYB91 represent respectively the OsMYB91 overexpression and suppress the express transgenic positive plant.

Fig. 9: OsMYB91 wild-type, overexpression and RNAi plant field growing height and every panel length statistics.The left side is different plants over-ground part total height, and the right is every joint length under fringe.WT represents negative control, and OxMYB91, dsMYB91 represent respectively the OsMYB91 overexpression and suppress the express transgenic positive plant.

Figure 10: the horizontal relative expression quantity of gene RNA relevant to cell fission in OsMYB91 wild-type, overexpression and RNAi plant mature tissue and intercalary meristem detects.

Figure 11: after 200 μ M treatment with mannitol OsMYB91 overexpressions, wild-type and double-stranded inhibition RNAi plant, corresponding transfer-gen plant aerial growth is highly added up.Figure 11 A is the phenotype record, and Figure 11 B is the plant height statistics.WT represents negative control, and OxMYB91, dsMYB91 represent respectively the OsMYB91 overexpression and suppress the express transgenic positive plant.

Figure 12: after 0 μ M and 3 μ M ABA process OsMYB91 overexpression plant, OsMYB91 double-stranded inhibition RNAi plant and wild-type plant, this transfer-gen plant growing state statistics.Figure 12 A is the phenotype record, and Figure 12 B is the plant height statistics.WT represents negative control, and OxMYB91, dsMYB91 represent respectively the OsMYB91 overexpression and suppress the express transgenic positive plant.

Figure 13: different concns ABA processes OsMYB91 overexpression plant, double-stranded RNAi plant and wild-type plant, the germination record of suppressing of OsMYB91.Figure 13 A is the phenotype record, and Figure 13 B is percentage of germination statistics under different concns.WT represents negative control, and OxMYB91, dsMYB91 represent respectively the OsMYB91 overexpression and suppress the express transgenic positive plant.

Figure 14: after 150 μ M NaCl process overexpression plant, OsMYB91 double-stranded inhibition RNAi plant and wild-type plant, the different plants phenotype records (Figure 14 A) and proline(Pro), hydrogen peroxide and Mda result (Figure 14 B).

Figure 15 spends 11 seedling in methylase inhibitor 5-aza-U-18496 and treated with sodium butyrate, and the OsMYB91 gene expression amount detects.

Embodiment

The clone of embodiment 1:OsMYB91 gene

The clone of gene OsMYB91 of the present invention (LOC_Os12g38400), the main method by RT-PCR obtains that (method is referring to J. Pehanorm Brooker, EF is Ritchie not, T Manny A Disi work, Huang Peitang, Wang Jiaxi etc. translate, molecular cloning experiment guide (third edition), Beijing, Science Press, 2002 editions).Concrete operation step is as follows:

1) extracting rice varieties " in spend 11 " (Institute of Crop Science, Chinese Academy of Agricultural Science) seedling leaves RNA, the Trizol extraction agent box (concrete operation step is shown in the specification sheets of this test kit) of Invitrogen company for the RNA extracting;

2) step of synthetic cDNA the first chain of RT-PCR reverse transcription is as follows: 1. prepare mixed solution 1: total RNA4 μ g, DNaseI2U, 10xDNaseI buffer 1 μ l, add DEPC (diethylpyrocarbonate, the strongly inhibited agent of RNA enzyme) process water (0.01%DEPC) to 10 μ l, after mixing, mixed solution 1 is placed to 20 minutes to remove DNA at 37 ℃, 2. after 20 minutes, mixed solution 1 is placed in to 65 ℃ of water-bath temperature and bathes 10 minutes to remove DNAse I activity, then be placed in 5 minutes on ice, 3. to the oligo (dT) that adds 1 μ l500 μ g/ml in mixed solution 1, 4. will be placed in immediately at the mixed solution 1 of cooled on ice 65 ℃ of water-bath temperature bathes 10 minutes, thoroughly to make the RNA sex change, then be placed in 5 minutes on ice, 5. prepare mixed solution 2: mixed solution 110 μ l, 5x first strand buffer 4 μ l, 0.1M DTT (mercaptoethanol) 2 μ l, 10mM dNTP mixture 1.5 μ l, DEPC processes water 0.5 μ l, ThermoScript II 2 μ l, after mixing, mixed solution 2 being placed in to temperature in 42 ℃ of water-baths bathes 1.5 hours, 6. reaction is placed in 90 ℃ of dry baths 10 minutes by mixed solution 2 after finishing, 7. preserve the reaction final product for-20 ℃, the reagent of using in reaction is all purchased from Invitrogen company.

The full length cDNA sequence of the OsMYB91 gene of 3) then announcing according to ncbi database (http://www.ncbi.nlm.nih.gov), design primer PCR amplified fragments.The system that PCR uses is 20 μ l, specifically joining method is: cDNA the first chain template 1 μ l, 10xPCR buffer 2 μ l, 10mM dNTP 1.6 μ l, 2.5mM Mg2+1.5 μ l, each 0.4 μ l of forward primer F and reverse primer R, r Taq enzyme 0.2 μ l, add water to 20 μ l (PCR buffer used, dNTP, Mg2+, rTaq enzyme etc. are all purchased from precious biotechnology Dalian company limited).The PCR reaction conditions is as follows: 1. 94 ℃ 4 minutes, 2. 94 ℃ 30 seconds, 3. 58 ℃ 30 seconds, 4. 72 ℃ 60 seconds, 5. from 2.-4. circulating 35 times, 6. 72 ℃ 7 minutes, 7. 4 ℃ of preservations.

The primer that is used for cloning the OsMYB91 total length is:

OsMYB91-F：5’-CGCGGATCCTGGCGAACACCGATGCAG-3’

OsMYB91-R：5’-CCGGAATTCGATCTCTACGGGCGGCCAG-3’

Finally obtain the full length cDNA sequence of OsMYB91 gene, its nucleotide sequence is as shown in SEQ ID NO:1.

4) finally amplified production is connected to the upper T7 of using of T/A cloning vector pGEMT-vector (purchased from Pu Luomaige (Beijing) Bioisystech Co., Ltd, i.e. U.S. Promega company) and SP6 primer sequence verification.

The structure of embodiment 2:OsMYB91 overexpression vector

1) the design enzyme cut-grafting head that is suitable for building the primer of overexpression vector and adds KpnI and BamH I at the primer two ends, the full-length cDNA obtained of take in embodiment 1 is template, the method amplification by PCR obtains the OsMYB91 gene order.

2) cut PCR product and overexpression vector plasmid pU1301 (seeing Fig. 1) with Kpn I and BamH I enzyme respectively, the purpose fragment connects with ligase enzyme after reclaiming purifying, (electric conversion instrument is eppendorf company product to the method that the connection product transforms by electricity, applied voltage is 1800v, working method is shown in this instrument specification sheets) import intestinal bacteria DH10B (purchased from Pu Luomaige (Beijing) Bioisystech Co., Ltd, be U.S. Promega company), at the LA that contains 250ppm kantlex (purchased from Roche biotech firm product), (LA fills a prescription referring to J. Pehanorm Brooker, EF is Ritchie not, T Manny A Disi work, Huang Peitang, Wang Jiaxi etc. translate, molecular cloning experiment guide (third edition), Science Press, 2002 editions) be coated with ware on the resistance culture base and cultivate,

3) the single bacterium colony grown on LA resistance culture base is inoculated in to the 10ml centrifuge tube of sterilizing at Bechtop, in pipe, adds in advance 3ml to contain the LB resistance culture base of 250ppm kantlex, then on 37 ℃ of shaking tables, cultivate 16-18 hour.According to J Pehanorm Brooker and D.W. Russell work, Huang Peitang etc. translate, " molecular cloning experiment guide ", Science Press, the method extracting plasmid of 2002 editions reports, cut and electrophoresis detection with Kpn I and Bam HI enzyme, according to the size of Insert Fragment, obtain positive overexpression vector: pU1301-OsMYB91.The primer that is used for cloning OsMYB91 overexpression vector fragment is:

OsMYB91-F：5’-CGCGGATCCTGGCGAACACCGATGCAG-3’

OsMYB91-R：5’-CCGGAATTCGATCTCTACGGGCGGCCAG-3’

Embodiment 3: the double-stranded structure that suppresses the dsRNAi carrier

Full length gene cDNA sequence according to resulting OsMYB91 in embodiment 1, the double-stranded dsRNAi primer that suppresses of design, and add Spe I and Kpn I restriction endonuclease sites, at downstream primer 5 ' end, sequentially add Sac I and BamH I restriction endonuclease sites at upstream primer 5 ' end.After pcr amplification goes out this aim sequence, amplified production is cloned and is connected to pGEMT-vector (purchased from Pu Luomaige (Beijing) Bioisystech Co., Ltd, i.e. U.S. Promega company) and carries out the DNA fragmentation of its amplification of sequence verification as shown in sequence table SEQ ID NO:2 by T/A.Concrete steps are as follows:

1) will be with the T/A of the RNAi fragment of OsMYB91 Kpn I and BamH I digestion with restriction enzyme for the clone, reclaim target stripe, with the vector plasmid pDS1301 cut through Kpn I and BamH I enzyme, (professor Chu Zhaohui of Agriculture in Shandong Province microorganism key lab of Shandong Agricultural University gives; Fig. 2 is shown in by the collection of illustrative plates of this plasmid; Referring to document: Chu etc., Promoter mutations of an essential gene for pollen development result in disease resistance in rice.Genes Dev, 2006,20:1250-1255.) (restriction endonuclease used is all purchased from precious biotechnology Dalian company limited, the product description that using method and consumption provide according to the said firm in connection; Ligase enzyme is the handsome biotech company in Shanghai product, and usage and consumption are according to the said firm's product description);

2), according to the method in embodiment 1, will connect product and forward in intestinal bacteria DH10B competence, and picking is cloned sub-sequence verification.

3) with Spe I and the cut of Sac I enzyme with the correct plasmid that contains the first chain of T/A Cloning and sequencing of the fragment of the RNAi with OsMYB91, and the enzyme connected after reclaiming with the DNA enzyme is cut product, is transformed into intestinal bacteria DH10B use carrier primer sequence verification.The primer that is used for building the double-stranded dsRNAi of inhibition carrier is:

dsMYB91-F：5’-GGG?ACTAGT?GGTACC?AAGCGGCTGGGCAAGTGGT-3’

dsMYB91-R：5’-GGG?GAGCTC?GGATCC?TCTGCCCTTCCTCCATCTCC-3’

The OsMYB91 Gene Double chain inhibition RNA carrier pDS1301-OsMYB91 finally obtained.

Embodiment 4: the functional study of the transcription factor OsMYB91 of paddy rice MYB family in paddy rice anti contravariance the steps include:

The expression pattern of A.OsMYB91 gene

Fetch water respectively in rice varieties and spend the different tissues of 11 different growing stages, Trizol extraction agent box (concrete operation step is shown in the specification sheets of this test kit) extracting RNA with Invitrogen company, detect the OsMYB91 gene at callus (Ca) with quantitative real time PCR Instrument after reverse transcription, root (Ro), sheath (Sh), joint (In), leaf (Le), sword-like leave (Fl), three phase children fringes (Pa3), expression amount in five phase children's fringes (Pa5), result is as Fig. 4 A, as seen from the figure, this gene all has expression in the paddy rice different tissues, wherein in young fringe, expression amount is the highest, in joint, take second place, expression amount in blade is level placed in the middle, can be used for the expression trend that sampling detects gene.

The Subcellular Localization of B.OsMYB91 gene

1) structure of Subcellular Localization carrier.Carrier for the research of gene Subcellular Localization is pU1391bGFP, is based on pCAMBIA1391Xb, by State Key Laboratory of Crop Genetic Improvent doctor Cai Hongmei transformation, is formed.Concrete building process is as follows: first with Bgl II and BstEII, the gus gene of pCAMBIA1391Xb carrier is cut, then by pFX-E24.2-15R (Wu, et al., 2003) the GFP gene on carrier scales off with BamH I and BstE II, be connected on the pCAMBIA1391Xb carrier and take the gus gene (Bgl II and BamH I are same tail terminal enzyme) that replacement cuts, finally with Hind III and BamH II, the strong promoter Ubiquitin enzyme on pU1301 is scaled off and is connected to the upper pU1391bGFP carrier (seeing Fig. 3) that obtains of pCAMBIA1391Xb-GFP.

2) take the carrier pU1301-OsMYB91 built in above-described embodiment 1 is template, by amplification program (94 ℃ of denaturation 3min; 94 ℃ of 30sec, 58 ℃ of 1min, 72 ℃ of 1min, 30 circulations; 72 ℃ are extended 8min) it is increased out, amplified production, by Kpn I and BamH I double digestion, is connected into the pU1391bGFP carrier that carries out same double digestion; Extract carrier primer sequence verification for plasmid after transforming intestinal bacteria.Obtain OsMYB91-pU1391bGFP carrier (seeing Fig. 3).The primer that is used for building the Subcellular Localization carrier is:

OsMYB91-GFP-F：CGGGGTACCTGGCGAACACCGATGCAG

OsMYB91-GFP-R：GTGGATCCGATCTCTACGGGCGGCCAG

For the albumen of determining this genetic expression, whether in core, we adopt particle bombardment transient expression onion epidermis.Detailed process: the plasmid DNA (5 μ g) and the bronze of 3mg diameter 1 μ m that build are mixed, then use 60 μ l raw spirits by these mixture resuspensions, suspension is divided into to 5 deciles and carries out particle bombardment.Before particle bombardment, onion epidermis is torn, be cut into 1cm ²The small pieces of left and right, be layered on moistening culture dish compactly.Utilize PDS-1000 System (BioRad), at the helium of 1100psi, depress and carry out particle bombardment, the onion epidermis after bombardment is cultivated after 24 hours and is observed in the dark situation of 25 ℃.The Laser Scanning Confocal Microscope of Leica company is used for observing the expressive site of GFP in onion epidermis cell, and the contrast of using is not for inserting the empty carrier of OsMYB91 gene.Observations is as Fig. 4 B, and hence one can see that, and this assignment of genes gene mapping is in nucleus.C. different condition detects OsMYB91 replying adverse circumstance after processing the wild-type plant

1) expression that OsMYB91 processes under as arid processing, light, deepfreeze, NaCl processing, heat shock and treatment with mannitol condition at abiotic stress.When arid is processed, first cultivate after two weeks to transfer in the little red bucket that field mud is housed on the MS root media and cultivate, during water always, to 4 leaf after dates, stopping watering is stopping watering 1 day respectively, 2 days, sampling afterwards in 3 days, sampled after covering afterwards water 12h; Different illumination conditions is processed: in germinateing in the little square box of root media, spending 11, wherein the control group seedling is cultivated 5 days under normal sunshine, the treatment group seedling is after dark condition is cultivated 5 days, 0h exposes respectively, 4h, 8h, detect the expression of OsMYB91 gene after 12h, following experiment is all with the processing of in germination at the normal illumination temperature 14 days, spending 11 seedling to carry out.Wherein deepfreeze is carried out in 4 ℃ of illumination boxs, and the seedling germinateed 14 days under room temperature condition on root media is transferred in 4 ℃ of illumination boxs and cultivates), 0.5h, 2h, 12h, 24h sampling after processing respectively; Heat-shock temperature is 42 ℃, 0h, and 1h, 3h, 6h, sample after 12h, and NaCl processes and uses containing 0h after the aqueous solution soaking seedling of 150mM, 3h, 6h, 12h, 24h sampling; Treatment with mannitol is used containing 0h after the aqueous solution soaking seedling of 200 μ M, 30min, 1h, 3h, 6h sampling, above-mentioned processing sampling point is blade, and reverse transcription product is for the expression amount of fluorescence quantitative PCR detection OsMYB91 gene, and described result is as Fig. 5, as shown in Figure 5, this gene expression amount when arid, illumination, heat shock, NaCl and treatment with mannitol is all in rising trend, and contrary in cold coercing, and illustrates that these conditions induce or suppress the expression of this gene.

2) use respectively 200 μ M ABA, ACC, NAA, 6-BA, 250 μ M JA, 300 μ M SA exogenous hormones are processed in the wild-type of germinateing 10 days and are spent 11 seedling: will contain the 40mL root media, the seedling germinateed 13 days under sterile state shifted out the gnotobasis hardening after one day, spray the aqueous solution containing the above-mentioned exogenous hormone of 200 μ M at its blade surface, from spraying, the different time points sampling, according to the RNA method for extracting extracting RNA in embodiment 1, use the expression amount of fluorescence quantitative PCR detection OsMYB91 gene after reverse transcription, result is as Fig. 6, result shows that this gene expression amount after hormon is processed all rises.

D. the conversion of double base Ti-plasmids carrier and the transfer-gen plant positive and expression amount detect:

1) by embodiment 1, the carrier pU1301-OsMYB91 obtained in embodiment 2 is from embodiment 1), and pDS1301-OsMYB91 (from embodiment 2) transforms to paddy rice acceptor kind " in spend 11 ", method for transformation according to the standard method of State Key Laboratory of Crop Genetic Improvent (for example: patent No. ZL200710053552.9, the title of invention: the separating clone of rice wide compatibility gene S 5 and application; Patent publication No.: CN101200725A; License day: the patent documentation of on 04 21st, 2010) carry out.The T0 obtained is for transfer-gen plant called after oxMYB91-n or dsMYB91-n, n=1 wherein, and 2,3... represents genetically modified different family.

2) get T0 for the total DNA of transformed plant blade extracting.The DNA method for extracting be the CTAB method (Zhang etc., genetic diversity and differentiation of indica anjaponica rice detected by RFLP analysis, 1992, TheorAppl Genet, 83,495-499).The total DNA of the blade of take is template, by PCR method, duplex is suppressed to T0 and carries out positive detection for carrier the first strand primer (pMCG1F and pMCG1R) for transformed plant and the second strand primer (pMCG2F and pMCG2R).Then with the amplimer OsMYB91-F/OsMYB91-R in embodiment 2, overexpression T0 is carried out to positive PCR detection for transformed plant, with suppressing the double-stranded dsRNAi of inhibition of carrier primer pair plant, carry out positive detection.

The used carrier primer is as follows:

pMCG1F：5′-?CTGCTCCACACATGTCCATT-3’，

pMCG1R：5′-CCCACCATCTTGTGGAGCTA-3’；

pMCG2F：5’-GGCTCACCAAACCTTAAACAA-3’，

pMCG2R：5’-CTGAGCTACACATGCTCAGGTT-3’。

Above primer is given birth to by Shanghai

Biotechnology company limited is synthetic

PCR reaction cumulative volume is 20 μ l, specifically joins method and is: template 100ng, 10xPCR buffer2 μ l, 10mM dNTP1.6 μ l, 2.5mMMg ²⁺1.5 μ l, each 0.4 μ l of left and right primer (GUS-LF and GUS-LR), r-Taq enzyme 0.2 μ l, add deionized water to 20 μ l (PCR buffer used, dNTP, Mg ²⁺, r-Taq enzyme etc. is all purchased from precious biotechnology Dalian company limited).The PCR reaction conditions is as follows: 1. 94 ℃ 4 minutes, 2. 94 ℃ 30 seconds, 3. 57 ℃ 30 seconds, 4. 72 ℃ 1 minute, 5. from 2.-4. circulating 32 times, 6. 72 ℃ 7 minutes, 7. 4 ℃ of preservations.The PCR product is electrophoresis detection on the TBE sepharose of 1% (mass/volume).Because carrier the first strand primer (pMCG1F and pMCG1R) and the second strand primer (pMCG2F and pMCG2R) fragment are peculiar by conversion carrier, the transfer-gen plant that can amplify like this specific band is positive plant.To T0 for positive plant sowing son (be called T1 generation), for field planting and the proterties investigation in T1 generation are prepared.

3), in order to detect the expression amount of the target gene in the overexpression plant, the applicant adopts the method for Northern-blot to carry out expression analysis to transgenosis T0 for plant.Test total RNA used from the rice leaf in tillering phase, RNA extracting reagent is the Trizol extraction agent box (concrete operation step is shown in the test kit specification sheets) of Invitrogen company; Northern blot transferring film applied sample amount is 15 μ g, and probe mark adopts the method for random primer labelling, the isotopic label used for α- ³²P-dCTP, film first prehybridization in hybrid pipe, about 3 hours, then adds isotope-labeled probe, continues hybridization 12 hours; Hybridization with 2 * sodium citrate buffer solution (SSC), by Hybond membrane rinsing 10 minutes, then uses same film washing liquid 65 ℃ of rinsings under 0.1% sodium lauryl sulphate (SDS) normal temperature after finishing, and each two minutes, until signal value is suitable.Wash after film and film is placed in to clean filter paper dries, wrap with preservative film, then with phosphorus screen (Phosphorimage, FUJI, Japan) compressing tablet 6-9 hour, finally with FUJIFILMFLA5100, scan reading result.Final to T0 see Fig. 7 A for OsMYB91 expression of results in transfer-gen plant, WT represents negative control; OX (1-n) represents that the T1 of the different familys of overexpression transgenic positive plant is for plant; Result is presented in 10 detected familys has 7 family expression amounts obviously to raise, and these materials can be used for subsequent experimental.

4) in order to detect the expression amount of target gene in the double-stranded RNAi of inhibition plant, the applicant adopts the method for Real-time PCR to carry out expression analysis to transgenosis T0 for plant.Extracting T0 for total RNA of transfer-gen plant and carry out reverse transcription, the Trizol extraction agent box (concrete operation step is shown in the test kit specification sheets) that extracting is Invitrogen company with reagent, in RT-PCR, the step of synthetic cDNA the first chain of reverse transcription is as follows:

1. join mixed solution 1: total RNA4 μ g, DNaseI2M, 10xDNAseI buffer 1 μ l, add DEPC (diethylpyrocarbonate, the strongly inhibited agent of RNA enzyme) process water (0.01%DEPC) to 10 μ l, after mixing, mixed solution 1 is placed to 20 minutes to remove DNA at 37 ℃;

2. after 20 minutes, mixed solution 1 is placed in to 65 ℃ of water-bath temperature and bathes 10 minutes to remove DNAse I activity, then be placed in the oligo (dT) that 3. to mixed solution 1, adds 1 μ l500 μ g/ml on ice in 5 minutes;

4. will be placed in immediately at the mixed solution 1 of cooled on ice 65 ℃ of water-bath temperature and bathe 10 minutes, thoroughly to make the RNA sex change, then be placed in 5 minutes on ice;

5. join mixed solution 2: mixed solution 1 10 μ l, 5x first strand buffer 4 μ l, 0.1M DTT (mercaptoethanol) 2 μ l, 10mM dNTP mixture 1.5 μ l, DEPC processes water 0.5 μ l, ThermoScript II 2 μ l, after mixing be placed in mixed solution 2 temperature in 42 ℃ of water-baths and bathe 1.5 hours;

6. reaction is placed in 90 ℃ of dry baths 3 minutes by mixed solution 2 after finishing;

7. preserve the reaction final product for-20 ℃, the reagent of using in reaction is all purchased from Invitrogen company;

Obtain detecting by the method for real-time fluorescence quantitative PCR after product the expression amount of OsMYB91.Reagent is purchased from precious biotechnology Dalian company limited, and reaction system is referring to specification sheets.The PCR instrument is 7500 of American AB I company, and the PCR parameter is 95 ℃ of denaturations 10 seconds, enters the rear 95 ℃ of sex change of circulation 5 seconds, and 60 ℃ of annealing are extended 40 seconds, 45 circulations.Real-time PCR the primer sequence is:

osMYB91?Realtime?PCR-F：5′-TGGGAGGCTCACAAGAATCTTT-3’

osMYB91?Realtime?PCR-R：5′-TCTGTTCTTGGACCTCCCTAGCT-3’

The T0 finally obtained suppresses OsMYB91 expression of results in the RNAi transfer-gen plant for two strands and sees Fig. 7 B, WT represents negative control, RM (1-13) representative suppresses the T1 of the different familys of express transgenic positive plant for plant, in 13 detected familys, have 12 family rna level expression amounts to descend, inhibition is more obvious.

E.T1 investigates and expression analysis for proterties:

Phenotype statistics and mature tissue and intercalary meristem's slice analysis under a:OsMYB91 transfer-gen plant grown in field state

1) get OsMYB91 overexpression and dsRNA and wild-type mature tissue at heading stage, under fringe, second section cane mid-way and grouping are between two parties given birth to and are organized second section and the 3rd under fringe to save part between saving, be about the 1cm left and right, put into 50%FAA stationary liquid (formaldehyde 5ml after being cut into the fritter about 2mm with blade, Glacial acetic acid 5ml, 50% alcohol 90ml), after fixing in, vacuumize 30min and no longer include bubble to the cane tissue and emerge in vacuum drying oven (Hotpack Vacuum OVEN).After continuing to fix 24 hours under room temperature in 50% formaldehyde solution, transfer to successively 75%, 85%, in H and 95% ethanolic soln, dehydration is 1 hour, continue dehydration 1 hour after finally in 100% ethanol, adding the eosin dyestuff, repeating this step once uses pre-penetrating fluid (being mixed by equal-volume dehydrated alcohol and base liquid Technocit7100) to permeate in advance 1-2 hour afterwards, (1g stiffening agent I is dissolved in 100mL base liquid Technocit 7100 to add penetrating fluid, now with the current) 1-2 hour (being less than 5 hours) of rear infiltration, on 65 ℃ of exhibition sheet platforms, first in the semithin section particular manufacturing craft, add 150 μ l polymer fluids (1mL stiffening agent II is dissolved in the 15mL permeate agent and gets final product), with pincet, material is put down gently in middle position, mould right side again, after material flattens, rapidly mould is dripped full, within 2 hours, dry for 65 ℃, (resin used in semithin section, stiffening agent, permeate agents etc. are all purchased from Heraeus Kulzer Dental company).Proceed to 37 ℃ of thermostat container (electric heating constant temperature water-impermeable incubators, Huangshi Hengfeng medicine equipment company limited produces) middle polyase 13-4 day, on ultramicrotome, cut into slices, dry section after section on exhibition sheet platform, fast green dyeing 5min, single water ticket that steams is washed dyestuff off, then takes a picture and analyze on photomicroscope.Choosing clear, distinguishable tissue slice is analyzed and is added up, discovery is greater than dsRNAi in maturation zone overexpression transfer-gen plant individual cells length, and to be less than wild-type be that overexpression is less than wild-type and is less than dsRNAi in intercalary meristem, the results are shown in Figure 8B.

2) after accelerating germination of rice seed, the rice seedling bed growth is transplanted grown in field in about 30 days to heading stage, get each 3 familys of OsMYB91 overexpression and dsRNAi plant and in spend 11 each 30 strains, find that OsMYB91 overexpression above-ground plant parts height is generally short than wild-type, and plant height is expressed in its double-stranded inhibition and wild-type is similar, as Fig. 9.

3) get OsMYB91 overexpression and dsRNA and wild-type mature tissue at heading stage, under fringe, second section cane mid-way and grouping are between two parties given birth to and are organized second section and the 3rd under fringe to save part between saving, be about the 1cm left and right, total RNA with Trizol difference extracting different tissues, reverse transcription product is used for the expression result of fluorescence quantitative PCR detection and phytokinin genes involved as Figure 10, Os01g56810 wherein, Os01g71310, Os10g34230 belongs to the synthetic key enzyme of IPT (IPP transferase) IP type CTK, Os02g46380, Os01g48800 belongs to PUP (purine permease) transhipment CTK, Os05g47840 belongs to the synthetic key enzyme of IPT (IPP transferase) IP type CTK.Result show when this gene overexpression or after suppressing to express with the cell fission genes involved: the expression in mature tissue and meristematic tissue of IP type CTK oxydase, synthetic enzyme and transhipment key enzyme does not raise or reduction simultaneously, illustrate the change of overexpression plant plant height short be the coefficient result of cell fission and cell elongation.

Primer for above-mentioned quantitative fluorescent PCR is:

Os01g56810-F：5′-CACCGGCCAGGGAATCTT-3’，

Os01g56810-R：5′-GCCATCATCTTGTTCGTCGAT-3’；

Os01g71310-F：5′-AGCAAGGTGGGAGACATTTGA-3’，

Os01g71310-R：5′-TCTCTGCCCTGGAGCTAGGA-3’；

Os10g34230-F：5′-CCTTCACCAAAGACCAGGAGTT-3’，

Os10g34230-R：5′-CACGATGAAACCTTCCACATAGTC-3’；

Os02g46380-F：5′-CTCCTGTCAAGAGTTGGCAATG-3’，

Os02g46380-R：5′-GCGGTCTGACCGGCAAT-3’；

Os01g48800-F：5′-CAAGCGAAGCACATGGAAGA-3’，

Os01g48800-R：5′-TCTGCAGCTTCACCAGATTGA-3’；

Os05g47840-F：5′-GCCGCCAATTTTCCAGTGT-3’，

Os05g47840-R：5′-TCTATGTCACTGGCTACT-3’。

Above primer is given birth to by Shanghai

Biotechnology company limited is synthetic.

B: treatment with mannitol transfer-gen plant phenotype Classified statistics

1) by T1 for seed, 2 familys of overexpression plant (being respectively OsMYB91-3-20 and OsMYB91-12-29), double-stranded RNAi2 the family (being respectively dsMYB91-5 and dsMYB91-10) that suppress, be placed in and contain (the Roche company production of 50 μ g/ml Totomycin, on the plate that fills root media 50mg/ml), germinate 3 days, select the seed that the root growing way is consistent and transfer to not containing in the root media (little square box) of 200 μ M N.F,USP MANNITOL containing Totomycin, continue to cultivate the over-ground part growing way of 15 days discovery overexpression plant significantly better than wild-type, and the transfer-gen plant growth retardation of dsRNAi, this illustrates that the overexpression of this gene can improve the resistance of rice seedling to N.F,USP MANNITOL, record growing state and the results are shown in Figure 11A.2) plant in square ware is taken out, after water-washing away substratum, observe phenotype and take a picture.Measure over-ground part length, record the radical order, the results are shown in Figure 11B.

C:ABA processes transfer-gen plant phenotype Classified statistics

1) by T1 for 2 familys of seed overexpression plant, be respectively OsMYB91-3-20, OsMYB91-12-29, double-stranded 2 familys that suppress RNAi, be respectively dsMYB91-5, dsMYB91-10 is placed in and contains (the Roche company production of 50 μ g/ml Totomycin, on the plate that fills root media 50mg/ml), germinate 5 days (about 1cm left and right), be transferred to containing cultivating 6 days in the root media of 3 μ mABA, the growing state record is as Figure 12 A, after water-washing away substratum, measure over-ground part length, record the radical order, with respect to control group, its over-ground part height all has been subject to inhibition, but the degree suppressed is different, illustrate that Exogenous ABA can affect the expression of OsMYB91 gene.

2) wild-type, overexpression and the double-stranded RNAi of inhibition plant seed are containing 0 μ mol/L respectively, growing state after germinateing 7 days on the root media of 1 μ mol/L and 3 μ mol/LABA, record is as Figure 13 A, the statistics percentage of germination, the percentage of germination of finding the overexpression transgenic seed obviously is greater than control group, the percentage of germination of dsRNAi transgenic seed is starkly lower than control group, shows that this gene can strengthen the resistance to ABA during seed germination.Result is as Figure 13 B.

The d:OsMYB91 transfer-gen plant under salt stress, the mensuration of various physical signs

Containing spending 11 in cultivating on the root media of 150mM NaCl, OxMYB91 and dsMYB91 transfer-gen plant be after 14 days, after containing aqueous solution soaking (making solution just the not have root) 48h of 150mMNaCl, record phenotype as Figure 14 A, and mensuration to degeneration-resistant relevant physical signs as Figure 14 B.Concrete grammar is as follows:

1) PA.Paddy rice is under the abiotic stress condition, and in body, proline(Pro) (proline) content significantly increases.Available sulphosalicylic acid extracts proline(Pro) in rice tissue, after then using the acid ninhydrine heat treated, solution redness, then with the toluene extraction, pigment all is transferred in extraction liquid.The depth of pigment means the height of proline content.Colorimetric estimation absorbancy under the 520nm wavelength, then calculate the content of proline(Pro) in rice tissue according to typical curve.

1. drawing standard curve: accurately take the 10mg proline(Pro) on analytical balance, pour in small beaker, dissolve with a small amount of distilled water, then pour in the 100mL volumetric flask, adding distil water is settled to scale, in this reference liquid every milliliter containing proline(Pro) 100 μ g.Get 6 50mL volumetric flasks, contain respectively into proline(Pro) stoste 0.5mL, 1.0mL, 1.5mL, 2.0mL, 2.5mL and 3.0mL, be settled to scale with distilled water, shake up, the concentration of proline of each bottle is respectively 1 μ g/mL, 2 μ g/mL, 3 μ g/mL, 4 μ g/mL, 5 μ g/mL and 6 μ g/mL.Get 6 10mL centrifuge tubes, draw respectively proline(Pro) solution and 2mL Glacial acetic acid and the 2mL acid ninhydrine solution of 2mL series standard concentration, every pipe heats 30min in boiling water bath.After cooling, each test tube accurately adds 4mL toluene as extraction liquid, and vibration 1min, in standing a moment, all go in extraction liquid pigment.Respectively manage upper strata proline(Pro) toluene solution to cuvette by the pipettor gentle aspiration, take toluene solution as blank, in the 520nm wavelength, place carries out colorimetric.The drafting of typical curve: first obtain the regression equation that absorbance (Y) becomes according to concentration of proline (X), then, by regression equation drawing standard curve, calculate the content (μ g/mL) that 2mL measures proline(Pro) in liquid.2. the mensuration of sample.Sampling, greenhouse or field are sampled in sampling bag or stopple coupon.Accurately take each 0.2-0.5g of rice tissue to be measured of different treatment, scissors shreds, be placed in respectively the 10mL centrifuge tube, then add respectively the sulphosalicylic acid solution of 5mL3% to each pipe, extract 10min-30min (will often shake in leaching process) in boiling water bath, be the extracting solution of proline(Pro) after naturally cooling.Draw in the 10mL centrifuge tube that the 2mL extracting solution is clean in another, add 2mL Glacial acetic acid and 2mL acid ninhydrine reagent, heat 30min in boiling water bath, solution take on a red color.Add 4mL toluene after naturally cooling, sway 1min, standing 10min, also can room temperature place 1-3 days to be determined, getting upper strata has color solution to the 1.5mL centrifuge tube, at the centrifugal 15min of 12000r/min.In cuvette, take toluene as blank with the red toluene solution of pipettor gentle aspiration upper strata proline(Pro), on spectrophotometer, 520nm wavelength place colorimetric, try to achieve absorbance.3. result is calculated: go out according to regression equation calculation the concentration X (μ g/mL) that (or finding from typical curve) measures proline(Pro) in liquid, then calculate proline content in every gram fresh weight sample (μ g/g FW).Calculation formula is as follows: the proline content of unit fresh weight sample (μ g/g FW)=(X*5)/sample weight, the result mapping is as Figure 14 B, after showing that NaCl processes, in different plants, proline content all rises, and wherein the proline content in the overexpression plant significantly rises.

2) hydrogen peroxide quantitative assay.When the superoxide enzyme exists; hydrogen peroxide and 10-ethanoyl-3; 7-dihydroxyphenazine (10-Acetyl-3; when 7-dihy exists when the superoxide enzyme; hydrogen peroxide and 10-ethanoyl-3; 7-dihydroxyphenazine (10-Acetyl-3,7-dihydroxyphenoxazine, ADHP) produces fluorescence-causing substance resorufin (resorufin) under Catalyzed Synthesis By Peroxidase.By microplate reader, resorufin is measured the content that can calculate hydrogen peroxide.

Paddy rice sample liquid nitrogen grinding, get the 0.1g sample to the 1.5ml centrifuge tube, adds immediately the 20mM phosphoric acid buffer (pH6.5) of 1ml4 ℃ of precooling, and fully concussion mixes.4 ℃ of centrifugal 10min of 12000rpm low temperature, supernatant liquor proceeds in new centrifuge tube for subsequent experimental.The method provided according to test kit Amplex Red hydrogen peroxide/peroxidase assay kit (Molecular Probes) is carried out quantitative assay to hydrogen peroxide.After recording the NaCl processing, the content of hydrogen peroxide in overexpression OxMYB91 plant has no change substantially, and the content that suppresses to express in the dsMYB91 plant significantly raises, and sees Figure 14 B.

3) mensuration of mda (MDA) content.Rice organ is old and feeble or under the abiotic stress condition, film fat generation peroxidation, and mda is one of its product, usually utilizes it as film lipid peroxidation index.Ice chest sampling paddy rice leaf sample, be placed in the plastics bag of sealing, takes back laboratory and measure immediately.Balance takes the 0.5g rice leaf, after scissors shreds, adds 5%TCA5mL, with the mortar of precooling, is placed in and is ground to the homogenate shape on ice, pours in the 10mL centrifuge tube.Freezing under 3000rpm (4 ℃) centrifugal 10min, get supernatant liquor 2mL to new 10mL centrifuge tube, add wherein 0.67%TBA2mL, boil 30min after mixing in 100 ℃ of boiling water, get the 1.5mL supernatant after the room temperature naturally cooling to new 1.5mL centrifuge tube, after room temperature 12000rpm is centrifugal, get supernatant.Measure respectively the absorbance of supernatant liquor at 450nm, 532nm and 600nm place with spectrophotometer.And calculate MDA concentration by formula, then the MDA content in the unit's of calculating fresh weight tissue (μ mol/g).Result is calculated, and presses formula C/ μ mol/L=6.45 (A532-A600)-0.56A450.After net result is found the OsMYB91 overexpression, under the NaCl condition, its peroxidation degree reduces.Draw as Figure 14 B,

F. the methylase inhibitor is processed in wild-type and is spent 11, detects the OsMYB91 gene expression amount.

The 3mM treated with sodium butyrate germinate two weeks in spend 11 seedling, 0h, 12h, 24h, 48h, the 72h sampling, spend 11 seeds in cultivating with the root media of the decitabine (purchased from Sigma-Aldrich company) containing 100 μ M simultaneously, after fortnight, sample, with the expression amount of fluorescence quantitative PCR detection OsMYB91 gene after the method reverse transcription acquisition cDNA of embodiment 1, change, find that its expression amount of prolongation along with the treatment time rises, the tolerance of this gene pairs hypersaline environment may cause due to apparent modifications such as DNA methylations, as Figure 15.

Special instruction: patent application of the present invention obtains the subsidy of " central colleges and universities' basic scientific research operating cost special funds (2012ZYTS057) "

Claims (2)

1. A transcription factor gene OsMYB91 Development of Rice and degeneration-resistant in application, it is characterized in that, the nucleotide sequence of described transcription factor gene is as described in sequence table SEQ ID NO:1.
2. 2. application claimed in claim 1, comprising the drought resistance at adjusting and controlling rice plant height and adjusting and controlling rice.

Images