CN102329805A - Coding sequence for OsMYB gene in rice and applications - Google Patents

Abstract

The invention belongs to the technical field of molecular biology and gene engineering, and particularly relates to a coding sequence for expressing a transcription factor OsMYB in rice. The coding sequence has the main action that the resistance of the rice (including but not limited to drought resistance, low temperature and high-salt stress resistance) can be enhanced, and simultaneously the expression induced by drought is achieved. The coding sequence also comprises a recombined carrier of the gene sequence and a transgenic plant applying the carrier for transformation. The resistance of the transgenic rice can be improved by applying the gene for transformed expression in the plant. In the gene provided by the invention, the action in the plant resistance is obvious, the application value is very high, the loss for the yield and the biological yield of crops under the conditions such as drought, semi-drought, or high salinity and low temperature and the like can be obviously reduced.

Description

A kind of encoding sequence of rice Os myb gene and application

Technical field

The invention belongs to molecular biology, gene engineering technology field, be specifically related to a kind of transcription factor of in paddy rice, expressing OsMYBThe clone of gene, the structure of transgene carrier, and the application of gene.

Background technology

Paddy rice is the most important food crop of China, also is the maximum crop of water in the agriculture prodn simultaneously.Arid has had a strong impact on the output of paddy rice, how to reduce the dependence of paddy rice to water, makes its characteristic with saving water, resisting drought, and is significant to grain, water and the ecological security of China.Utilize molecular biology and genetic engineering technique to carry out molecular breeding, gene related to drought tolerance is changed in the good rice varieties, improve its drought resistance, the new crop varieties of cultivating not only drought resisting but also high yield and high quality is one of effective way of drought resisting breeding.The method of this research through the paddy gene chip screened a plurality of drought-induced genes as ( OsMYB), through the Level of Expression of Retinoic Acid that transgenic technology is regulated these genes, can change the drought-resistant ability of paddy rice.

The myb transcription factor that relates among the application is one of family maximum in the plant transcription factor; To contain conservative MYB structural domain is common trait; Present research proves; It has extensively participated in (Qiao Meng etc., 2009 such as Secondary Metabolism of Plant regulation and control, cellular form generation, stress response, meristematic tissue formation and cell cycle control; Xie et al., 2010).MYB family contain 1 ~ 3 by 51 ~ 53 amino acid form in the shape of a spiral-the incomplete Tumor-necrosis factor glycoproteins of turnover-helical conformation; Be divided into 3 subtribes according to structural domain R (repetition) quantity: the R1-MYB subtribe that contains 1 R structural domain; The R2R3-MYB subtribe and the R1R2R3-MYB subtribe (Stracke et al., 2001) that contains 3 R that contain two R.Most myb transcription factors belong to the R2R3-MYB subtribe in the plant, and containing the DNA combined function territory that is made up of two MYB structural domains with the N-end is common trait (Martin and Paz-Ares, 1997).

In the plant MYBNumber gene is numerous, and people are right over past ten years MYBGene has carried out a large amount of and extensive studies has been identified 198,183,80 and 200 respectively in Arabidopis thaliana, paddy rice, corn and cotton MYBGene, and in wheat, only identify 23 MYBGene (Chen et al., 2005) has also had deep understanding to its function.The experimental results shows MYBMultiple biochemical reactions in the gene involved in plant process of growth, as regulate and control secondary metabolic plant, cellular form takes place, the formation of regulation and control flower and seed, control cell cycle etc.In addition, MYBGene also plays an important role resisting and reply in the environment stress, like paddy rice OsMYB4In coercing the signal transduction network, play an important role, the transgenic arabidopsis of overexpression and tomato all show strong anti-low temperature and arid effect (Vannini et al., 2004; Candida et al., 2007); Abe etc. (2003) prove AtMYB2The participation drought stress is replied, and Dai etc. (2007) find OsMYB3R-2Overexpression can improve the resistance of transgenic arabidopsis to low temperature, arid, high salt etc.; Liang etc. (2005) find that the switching of AtMYB61 participation adjusting pore is to reduce moisture loss.There is also evidence specifically expressing among the stomata guard cell AtMYB60Gene has been participated in negative regulation effect (Cominelli et al. 2005) that drought stress is replied.Arabidopis thaliana AtMYC2With AtMYB2 transcription factors are expressed enhancing under adverse circumstance, also strengthened arid response gene simultaneously Rd22With AtADH1Expression.Under drought stress, AtMYC2With AtMYB2Albumen is also brought into play function (Abe et al., 2003) as the transcription activator of ABA approach.

Summary of the invention

The object of the present invention is to provide a kind of drought-induced transcription factor that receives OsMYB, its encoding sequence and the carrier and the host that contain this nucleotide sequence.

Another object of the present invention provides the application of coding rice Os MYB proteic gene in improving stress resistance of plant (including but not limited to drought resisting, cold-resistant, anti-salt etc.).

A purpose more of the present invention provides the proteic gene of coding rice Os MYB regulating the stress resistance of plant related gene expression, strengthens the application of paddy rice anti contravariance property.

In order to realize above purpose, one side of the present invention provides a new rice transcription factor OsMYBNucleotide sequence, its coding one receive drought-induced transcription factor OsMYB(Os05g0442400), relate to other gene transcription of regulation and control, main performance is the drought resistance that can increase paddy rice.Paddy rice OsMYB(Os05g0442400) full length gene 1198bp, its OsMYBORFs be 930bp, wherein intron 268bp (underscore marks) and the long 549bp of cDNA coding region sequence (black matrix mark), shown in SEQ ID NO.1 and SEQ ID NO.2,182 amino acid of this genes encoding are shown in SEQ ID NO.3.

The present invention also provides and has been used for from paddy rice mRNA through this transcription factor of reverse transcription PCR clone OsMYBPrimer sequence, this amplifying rice OsMYBThe primer of gene is (SEQ ID NO.4):

BamHIOs05g0442400(c)-F1： CGCGGATCCATGGCGTTCTACCTCGGCAGCA

SacIOs05g0442400(c)-R： CGAGCTCTCATGGGGCAGTGATGTCGTG

Aforesaid rice Os MYB albumen contains 2 SANT zones in its structure.

The present invention also provides and contains above-mentioned paddy rice OsMYBThe carrier of gene.

The present invention also provides and contains above-mentioned paddy rice OsMYBThe host of genophore.Preferably, said host is an eukaryotic cell.More preferably, said host is a paddy rice.

The present invention also provides and contains above-mentioned paddy rice OsMYBThe transformed plant cells of gene.

The present invention also provides above-mentioned paddy rice OsMYBThe application of gene in improving stress resistance of plant (including but not limited to drought resisting, cold-resistant, anti-salt etc.).

The present invention further provides above-mentioned paddy rice OsMYBGene is being regulated plant stress-resistance related gene expression, the application in the enhancement of plant resistance.

The present invention also provides a kind of transgenic technology rice transcription factor of will encoding that utilizes OsMYBNucleotide sequence be transformed in the paddy rice, with the method for the ability that changes paddy drought resistance, concrete steps are following:

(1) with paddy rice OsMYBThe coding region of gene is connected in plant expression vector, forms to contain paddy rice OsMYBThe plant of gene crosses expression vector.

(2) plant in the step 1 is crossed expression vector and change among the Agrobacterium EHA105, the Agrobacterium that will contain expression vector is infected rice callus, and (at 28 ℃) obtain paddy rice through cultivation altogether, degerming, antibiotic-screening and differentiation (about 4 months time) OsMYBThe transfer-gen plant of crossing expression of gene.Cross in the paddy rice and express OsMYBThe transgenic paddy rice of gene can improve the drought-resistant ability of paddy rice.

The present invention also provides a kind of method that is used for detecting the transgenic paddy rice expression amount, mainly utilizes the method for quantitative fluorescent PCR.Concrete steps are: get the blade of transgenic paddy rice, with TRIzol method extracting paddy rice RNA, and use the DNaseI dna digestion, reverse transcription forms cDNA then, is that template is carried out quantitative fluorescent PCR and analyzed with it.The fluorescence quantification PCR primer nucleotides sequence is classified (SEQ ID NO.5) as:

qPCR-4424-F: GGTCGGTGAAGACGCGGACTC

qPCR-4424-R: TGTCGTGGATGCTCTTACGCTTG 。

The present invention also provides a kind of OsMYB method of protein as previously mentioned of in escherichia expression system, expressing, and concrete steps are following: OsMYBGene (SEQ ID NO.2) is connected in the pET32a carrier, is transformed into e. coli bl21 (DE3) trxB ^-, in the LB substratum, cultivate host bacterium (kantlex 50mg/L).37 ℃ are cultured to and add when OD600 is 0.6 left and right sides that 0.1mM sec.-propyl-β-D-sulfo-galactopyranoside carries out the expression of inducible protein, induces 20 hours for 16 ℃.Collect thalline, ultrasonic disruption, centrifugal collection supernatant is crossed nickel column separating purification albumen, the purifying situation of last SDS-PAGE analyzing proteins.

Further, the rice Os MYB albumen described in the present invention, it is polypeptide or its active fragments with the aminoacid sequence shown in SEQ ID NO. 3.

Among the present invention, can select various carrier known in the art for use, the carrier as commercially available comprises plasmid, clay etc.When producing rice Os MYB polypeptide of the present invention, can be with the rice Os MYB encoding sequence expression regulation sequence that is operably connected, thus form rice Os MYB protein expression vector.

Among the present invention, available fluorescent quantitative PCR technique analyzing rice OsMYBExpression of gene, i.e. analyzing rice OsMYBThe existence of rna transcription thing in cell whether and expression amount.

The present invention has advantage and beneficial effect at least:

(1) paddy rice provided by the invention OsMYBGene and proteins encoded thereof have tangible effect aspect stress resistance of plant, can obviously be reduced in the loss of various farm crop on biological yield of planting on the Arid lands, have very big using value.

(2) utilize the paddy rice of the present invention that contains that transgenic technology obtains improveing OsMYBThe conversion plant of gene is under conditions such as arid, high salt, and growth, survival state obviously are superior to wild-type plant, have shown paddy rice OsMYBGene can obviously improve the resistance of plant.

(3) paddy rice provided by the invention OsMYBGene can effectively be regulated adverse circumstance relevant transcription factor and albumen, has potential, huge using value.

Among the present invention, term " OsMYBORFs " the proteic nucleotide sequence of complete rice Os MYB that refers to encode, like Nucleotide among the SEQ NO.1 and degenerate sequence thereof.This degenerate sequence is meant, is arranged in the nucleotide sequence of SEQ ID NO.2, and having one or more codon to be encoded, the degenerate codon of same amino acid replaces and the sequence that produces.Because the degeneracy of codon, so be low to moderate about 85% the degenerate sequence described sequence of SEQ ID NO.3 of also encoding out with the homology of nucleotide sequence of SEQ ID NO.1.This term also is included under the rigorous condition of moderate, more under highly rigorous condition with SEQ ID NO.1 in homology of nucleotide sequence at least 85%, preferable at least 80%, more at least 90%, best at least 95 nucleotide sequence.

Term also comprises encoding to have and natural paddy rice OsMYBThe variant form of open reading frame sequence among the proteinic SEQ ID NO.1 of gene identical function.These variant forms include, but is not limited to: disappearance, insertion or the replacement of several (being generally 1-90, best 1-10) Nucleotide, and at several (be generally in 60, best is in 5) Nucleotide of 5 ' and/or 3 ' end interpolation.

Description of drawings

Paddy rice under Fig. 1 drought stress condition OsMYBExpression.

Fig. 2 paddy rice OsMYBSequence information and homology analysis (AT: Arabidopis thaliana; OS: paddy rice).

The evaluation of Fig. 3 transfer-gen plant.Wherein, numbering 1 ~ 6 is different transgenic rice plant.

The growing state of Fig. 4 different treatment (dormin, sodium-chlor, N.F,USP MANNITOL) rice seedling on substratum.

Fig. 5 rice seedling arid situation.

The fertility analysis of Fig. 6 paddy rice arid in generative phase pollen granule.

Fig. 7 OsMYBCross expression paddy rice medium drought resistant Expression of Related Genes spectrum.

The proteic prokaryotic expression analysis of Fig. 8 OsMYB.

The proteic transient expression of Fig. 9 OsMYB location.

Embodiment

Following examples are used to explain the present invention, but are not used for limiting scope of the present invention.

The experimental technique of unreceipted actual conditions in following examples; All according to normal condition; Sambrook equimolecular clone for example: laboratory manual (New York: Cold Spring Harbor Laboratory Press, the condition described in l989), or according to the condition of manufacturer's suggestion.

Embodiment 1Paddy gene when arid is handled OsMYBChip in the fine reproductive development phase of rice varieties Japan is expressed.

1. coerce processing

After the fine presprouting of seeds of paddy rice Japan, be transplanted in the soil of greenhouse plastic tub and cultivate, carry out arid processing in boot stage (reduction division period).When soil layer is anhydrous in the basin, begin to cut off the water supply, as the beginning of arid processing, when treating that soil moisture is reduced to 30% left and right sides; Keep a week, get different size (2 ~ 3mm, 3 ~ 4mm; 4 ~ 5mm, 5 ~ 7mm) paddy rice is collected respectively and numbers; As contrast, do three repetitions with the paddy rice under the normal growth condition.

2. gene chip is analyzed expression of gene under the drought condition

Under the drought condition paddy gene expression analysis by Agilent company for survey.Analyze different flower growth period OsMYBGene is in the fine expression of rice varieties Japan.The result shows OsMYBGene raises under the drought stress condition, and is consistent (shown in Figure 1) with quantitative fluorescent PCR proofing chip result.

Embodiment 2Paddy rice OsMYBThe clone of gene cDNA fragment.

1. the extraction of RNA: get the paddy rice that arid is handled, in mortar,, add the EP pipe that fills 1 ml TRIZOL reagent (Promega) with grinding to form powdery behind the liquid nitrogen freezing; Fully after the vibration, room temperature was placed 5 minutes, in 4 ℃; Behind the centrifugal 10min of 12000 rpm, supernatant moves in the new EP pipe, adds that 200 μ l chloroforms blend together emulsus; Room temperature left standstill 5 minutes, and behind the centrifugal 10min of 12000 rpm, supernatant moves in the new EP pipe; Add two volumes isopropanol precipitating RNA, dissolve back 37 ℃ with DNaseI (Fermentas) digestion degrade residual DNA 1 hour.On spectrophotometer, measure rna content then.

2. reverse transcription: according to the PrimeScript of TaKaRa company ^TMReverse Transcriptase specification sheets is operated: add the total RNA 5 μ l of paddy rice (5 μ g), Oligo (dT) in the centrifuge tube ₁₇Primer (50 μ mol/L) 1 μ l, dNTP (10 mmol/L) 1 μ l, and add to 10 μ l with distilled water; Instantaneously centrifugally liquid is concentrated on manage at the end, 65 ℃ of insulation 5 min are rapidly more than cooled on ice 2 min.In said mixture, add 5 * PrimeScript ^TMBuffer 4 μ l, RNase suppressor factor (40 U/ μ l) 0.5 μ l, PrimeScript ^TMReverse Transcriptase (200 U/ μ l) 0.5 μ l, distilled water adds to 20 μ l, centrifugally liquid concentrated on manage at the end, 42 ℃ of insulation 1 h, 70 ℃ of deactivation 15 min, cooled on ice obtains rice cDNA first chain.

3. the clone of cDNA

According to the sequence information that provides in the paddy rice database information among the GenBank, design primer (SEQ ID NO.4) adopts the RT-PCR method to carry out the cDNA full-length clone.

Obtain a coding region that includes complete ORF through RT-PCR, length is 549bp; Reclaim, be connected on the pMD19-T carrier, and check order.Sequencing result carries out BLAST on the NCBI website analyzes, and the result shows that itself and paddy rice note gene Os05g0442400 mate fully.Simultaneously, the AK367954.1 of its nucleotide sequence and known grass barley has the gene LOC100285249 of 80% homology and corn that 86% homology is arranged, and with the gene XM_002456635.1 of Chinese sorghum 80% homology is arranged.Contain 2 MYB structural domains in its structure.

Embodiment 3Paddy rice OsMYBSequence information and homology analysis.

Paddy rice of the present invention OsMYBThe length of full length coding region is 549bp, and its sequence is shown in SEQ ID NO.2.Derive the aminoacid sequence of rice Os MYB according to full-length cDNA, totally 182 amino-acid residues, molecular weight is 20381.5 dalton, and iso-electric point (pI) is 7.11, and its sequence is shown in SEQ NO.3.Prediction shows that this albumen is unsettled hydrophobic proteins.

This albumen is carried out the BLAST comparison at GenBank, obtain the albumen of albumen homology therewith, compare, make up evolutionary tree (Fig. 2) with MEGA 4 softwares according to contiguous method then with Clustal X software.

Embodiment 4Paddy rice OsMYBGene is crossed the evaluation of expression and transfer-gen plant in paddy rice

1. paddy rice OsMYBThe structure of expression carrier:

According to paddy gene OsMYBFull length sequence, design amplifies the primer that complete coding is read frame, and on the upstream and downstream primer, introduces restriction endonuclease sites (this is decided by the carrier of selecting for use) respectively, so that construction of expression vector.Amplified production to obtain among the embodiment 1 is a template, behind pcr amplification, with paddy gene OsMYBCDNA be cloned into intermediate carrier (like the simple carrier of pMD19-T; TAKARA), further be cloned on the expression vector (like pCAMBIA1301U) order-checking; Under guaranteeing the correct prerequisite of reading frame, will be somebody's turn to do expression vector again and change in the Agrobacterium, and transformation mode plant paddy rice Japan is fine.

2. agrobacterium-mediated transformation carries out the paddy rice transgenic.

A. evoked callus

1) choose the seed of mature and plump, coetonium in removing, with pure washing 3-4 time, use 70% alcohol immersion 2min again, with pure washing 7-8 time, the mercuric chloride with 0.1% is handled 15min, 100rpm.

2) in super clean bench, discard mercuric chloride, use aseptic washed several times with water, suck dry moisture on aseptic clean filter paper places on the N6D substratum, embryo down or the contact substratum, 28 ℃, secretly cultivated 21 days.12-15 grain/tissue culture bottle.

B. succeeding transfer culture

Radicle, plumule around the callus are divested totally, and callus is dried in the air on clean filter paper, is transferred on the N6D subculture medium, 28 ℃, secretly cultivates 7-10 days.

C. cultivate before

The callus of subculture is transferred on the preceding substratum, 28 ℃, secretly cultivated 3-4 days.

D. the cultivation of Agrobacterium EHA105

The correct clone's who obtains in the last branch experiment Agrobacterium bacterium liquid is coated on the YEB three anti-dull and stereotyped (Streptomycin sulphate, Rifampin and kalamycin resistance), 28 ℃, secretly cultivated about 36 hours.

E. infect together and cultivate

1) callus of preceding cultivation is dried in the air on aseptic filter paper, be transferred in the plate in the union.

2) get the little spoon of sterilization and scrape and get Agrobacterium 4-6 spoon in the liquid nutrient medium that infects usefulness, be stirred to suspend evenly (no big bacterium piece existence).

3) callus is gone in the centrifuge tube, the mixing that overturns gently leaves standstill 15～20min, during at interval the 5min mixing is once.

4) bacterium liquid is poured out, callus places and dries up approximately more than 1.5 hours on the aseptic filter paper, guarantees that bacterium liquid blots, and is connected on the common culture medium, 20 ℃, secretly cultivates 2-3 days.

F. degerming

1) callus that will cultivate altogether is transferred to the centrifuge tube of 50mL, and is more than 3 times, more limpid until flowing fluid ratio with sterile water wash.

2) pour out sterilized water, clean, each 100rpm, 15～20min, 3～4 times with the N6D liquid nutrient medium that contains the 500mg/L cephamycin.

3) callus is poured on the clean sterilization filter paper, blots and dry up more than 2 hours, guarantee to blot.

4) the exsiccant callus is gone to except that on the bacterium culture medium, 28 ℃, dark cultivation, 7～10 days.

G. screening

The callus that to do not polluted by Agrobacterium is transferred on the screening culture medium (N6D+50mg/L HYG+250mg/L cephamycin), and 28 ℃, the dark cultivation.Can change a subculture in per 15～20 days, screening time must not be less than 45 days.

H. differentiation

To pass through the new longer callus of screening and be transferred to 28 ℃ of division culture mediums (MS+2mg/L 6-BA+0.2mg/L NAA+2mg/L KT+0.2mg/L IAA+ 50mg/L Totomycin+250mg/L cephamycin), light was cultivated in 16 hours.Before carrying out differentiation culture, can be earlier cultivate several days with as presorting with callus is dark.Also need regular replacing substratum.

I. take root

The transgenic seedling (> 1cm that differentiation is come out is high), divest unnecessary callus, and cut off root (staying about 0.5cm), move in the 1/2MS substratum and take root.28 ℃, light was cultivated in 16 hours.

J. refine seedling and transplanting

Take root finish after, can remove root media after, seedling is steeped in water a few days refines seedling, transplant the middle growth of burying then.

3. the evaluation of transfer-gen plant

Clip transgenic paddy rice blade extracts rice leaf DNA with the CTAB method, identifies transgenic situation (Fig. 3) through the method that detects hygromycin gene.

And with TRIZOL method extraction blade RNA, reverse transcription becomes cDNA (method is with instance 2), carries out quantitative fluorescent PCR according to gene order design primer and analyzes in the transgenic paddy rice OsMYBExpression of gene situation, concrete operations are according to TAKARA company test kit description operation, and quantitative real time PCR Instrument is ABI Steponeplus ^TM

Embodiment 5 OsMYBCrossing the resistance of express transgenic rice plant identifies

Because Ben Jiyin is drought-induced, chip analysis shows that this gene is expressed obviously and improved under drought condition.Therefore to containing paddy rice OsMYBThe mistake express transgenic paddy rice of gene (Japan fine) seedling stage with become strain phase water stress to test the analyzing rice gene OsMYBDegeneration-resistant (including but not limited to drought resisting, anti-salt etc.) effect.

Drought resisting in 1 seedling stage is handled

Japanese fine rice paddy seed and transgenic paddy rice seed; After peelling off shell; After sterilizing 20 minutes with 50% chlorine bleach liquor; Sowing is containing 1/2MS and is containing respectively in the 1/2MS substratum of ABA (4uM), NaCl (150mM), N.F,USP MANNITOL (200mM), and paddy rice just can receive coercing of ABA, NaCl and N.F,USP MANNITOL (as the stand-in of drought stress) always like this, and 28 ℃ of illumination cultivation (8 hours dark of illumination in 16 hours) are after 12 days; Measure the growing height of paddy rice, and the quality of the single paddy rice that in N.F,USP MANNITOL, grows.The paddy rice relative growth rate equals height or the length of growth paddy rice under height or the length/normal condition of different treatment paddy rice.The result shows, crosses and expresses OsMYBThe prolongation speed that the transgenic paddy rice of gene can significantly be increased in the growth velocity under the stress conditions, particularly root will significantly be higher than contrast (Fig. 4).

(black earth: contrast and transgenic paddy rice that the plantation of vermiculite=7:3) is 5-6 in good each basin of paddy rice (Japanese warm and fine transgenic paddy rice) that germinates; Treat that paddy rice length lets its moisture spontaneous evaporation carry out arid to 5 leaves and handles during the phase in the paddy rice booth; Approximately arid is after 8 days, and the survival degree of the blade of transgenic paddy rice is obviously higher.After the rehydration 3 days, transgenic paddy rice turn green survival rate also obviously comparison according to high.Anthrone method measures soluble sugar and acid ninhydrine method mensuration proline(Pro) shows, under drought condition, a large amount of soluble sugar and the proline(Pro) of genetically modified paddy rice accumulation shows stronger drought resistance (Fig. 5).

Drought resisting in 2 flowering period is handled

Become strain phase paddy rice implementation moisture spontaneous evaporation arid method.Paddy rice is planted in the square basin that contains rice soil, treats about moisture evaporation to 30%, keeps 3 days, measures the proline content of sword-like leave, and uses I ₂-KI dyes and observes the activity of paddy pollen: get and just open grain husk but the also uncracked flower of flower pesticide and gather the paddy rice mature anther, flower pesticide on slide glass, is added 1 zero(ppm) water, with tweezers flower pesticide is smashed to pieces, pollen granule is discharged.Dry, approximately 10min; Add 1～2 I ₂-KI solution, covered, 5min; Examine under a microscope, observe 2～3 slice, thin pieces, get 3-5 the visual field for every; The rate of dyeing of statistics pollen; Wherein navy blue pollen is the fertile flower powder, and purplish red or xanchromatic is a pollen sterile, and pollen fertility equals fertile flower powder number/(can educate and add the pollen sterile number).The result shows, changes OsMYBThe fertility of the paddy pollen grain of gene will be apparently higher than the paddy rice (Fig. 6) of control group under drought condition.

Embodiment 6Use fluorescence quantifying PCR method and detect commentaries on classics OsMYBAdversity gene change of Expression in the trans-genetic hybrid rice

Extracting changes OsMYBThe RNA of trans-genetic hybrid rice blade, reverse transcription becomes cDNA, utilizes the quantitative fluorescent PCR kit of TAKARA company to carry out quantitative fluorescence analysis (concrete operations are with reference to the specification sheets of associated companies) then.The expression of basis-Δ Δ CT analyzing gene then.The gene of concrete analysis is respectively for the gene relevant with drought resisting of existing report LEA, DREB, P5CS, DR22Deng.Crossing of result's demonstration (Fig. 7) this gene expressed and can significantly be increased LEAWith DR22Expression, simultaneously explain that also the drought resistance of this gene possibly be the purpose that reaches drought resisting through the transcriptional control gene related to drought tolerance.

The gene title	Gene number
		MYB	Os05g0442400
DR22	Os01g0733500
		DREB	AY064403.1
LEA	Os05g0542500。

Embodiment 7Utilize the mode of prokaryotic expression to express OsMYB albumen

OsMYBGene is connected in the pET32a carrier, is transformed into e. coli bl21 (DE3) trxB ^-, in the LB substratum, cultivate host bacterium (kantlex 50mg/L).37 ℃ are cultured to and add when OD600 is 0.6 left and right sides that 0.1mM sec.-propyl-β-D-sulfo-galactopyranoside carries out the expression of inducible protein, 16 ℃ 20 hours.Collect thalline, ultrasonic disruption, centrifugal collection supernatant is crossed nickel column separating purification albumen, the purifying situation of last SDS-PAGE analyzing proteins.Electrophoresis result shows (Fig. 8), and we have been separated to the OsMYB albumen of prokaryotic expression.

Embodiment 8Analyzing rice in the tobacco OsMYBThe transient expression of gene

OsMYBGene is connected on the transient expression pEYFP carrier; Transform Agrobacterium; Be expelled to the Agrobacterium that contains the transient expression plasmid in the tobacco leaf along the tobacco vein with micro-syringe, cultivate after 3 days, tear the blade of getting injection position and under fluorescent microscope, observe and take a picture; The result shows that (Fig. 9) this albumen is positioned in the nucleus, is nucleus albumen.

SEQUENCE LISTING

< 110>Fudan University

< 120>a kind of encoding sequence of rice Os myb gene and application

<130> 001

<160> 7

<170> PatentIn version 3.3

<210> 1

<211> 1198

<212> DNA

<213> (SEQ ID NO.1)

<400> 1

agatccaagg ctatctaagc accggcattt gcatacagcc gcctaagcaa agagcacagc 60

aagtatacgc gaatctgagt gtgtgagaga gactagtagc acagacgaag gtatggcgtt 120

ctacctcggc agcatgggtg gctcgccatc gtcatggggg gtggcggagg tgccggtgcc 180

gagcagcagg ccgtggagca aggcggagga caaggtgttc gagagcgcgc tcgtggcgtt 240

cccggagcac acgcacaacc ggtgggcgct cgtcgcgtcg cggctcccgg ggcgctcggc 300

gcacgaggtt tgggaacact accaggtgct cgtggacgat gtcgacctca tcgagcgtgg 360

catggttgcg tccccgggct gctgggacga cgacaacaac agcgccggcc acggccgtgg 420

cagtggtggg gatgagcgtc gtcgcggcgt gccctggact gaggaggagc acaggtatgt 480

gtccaatacg tgccatcaaa tcccggttct attccatgtt atttttcatt ttttctgtta 540

ttttcggtgc gctctttgag atcctaggta ttattatatt gttcttttca catcggatta 600

cttccctggc ccacatcacc tgtctcacca acacgcaggc cctagatttc cctatagcaa 660

cagtaccttg cactacacgt ctactatatc gagttacggc taatttcctc tttctctctt 720

tttctattat tattatgaat aggctatttc ttgaagggct agagaaatat gggcgtggcg 780

actggcgcaa catctcgcgc tggtcggtga agacgcggac tccgacgcaa gtggcgagcc 840

atgcgcagaa gttcttcatc cgacaggcca acgccagcag ccgtggcgac tccaagcgta 900

agagcatcca cgacatcact gccccatgat gtgtggtccg atcgaggata tgcattatga 960

tccggtccag tctaggttta gttgtatttc catcaattcc aactagcttt caaccccatt 1020

tcaaagagga gagaacgaag ggagtttagt cgtcggccct ccctgttagt tcctctctct 1080

gtgttgtgta aaatatagct aggcaatagc taaaactaag cttggctgga acctgagatc 1140

aattgttgtg atactagttt gtgtacttgt caaataatat ttgtatccgt ttaatttc 1198

<210> 2

<211> 549

<212> DNA

< 213>the cDNA sequence 549bp of OsMYB (Os05g0442400) (SEQ ID NO.2)

<400> 2

atggcgttct acctcggcag catgggtggc tcgccatcgt catggggggt ggcggaggtg 60

ccggtgccga gcagcaggcc gtggagcaag gcggaggaca aggtgttcga gagcgcgctc 120

gtggcgttcc cggagcacac gcacaaccgg tgggcgctcg tcgcgtcgcg gctcccgggg 180

cgctcggcgc acgaggtttg ggaacactac caggtgctcg tggacgatgt cgacctcatc 240

gagcgtggca tggttgcgtc cccgggctgc tgggacgacg acaacaacag cgccggccac 300

ggccgtggca gtggtgggga tgagcgtcgt cgcggcgtgc cctggactga ggaggagcac 360

aggctatttc ttgaagggct agagaaatat gggcgtggcg actggcgcaa catctcgcgc 420

tggtcggtga agacgcggac tccgacgcaa gtggcgagcc atgcgcagaa gttcttcatc 480

cgacaggcca acgccagcag ccgtggcgac tccaagcgta agagcatcca cgacatcact 540

gccccatga 549

<210> 3

<211> 182

<212> PRT

<213> (SEQ ID NO.3)

<400> 3

Met Ala Phe Tyr Leu Gly Ser Met Gly Gly Ser Pro Ser Ser Trp Gly

1 5 10 15

Val Ala Glu Val Pro Val Pro Ser Ser Arg Pro Trp Ser Lys Ala Glu

20 25 30

Asp Lys Val Phe Glu Ser Ala Leu Val Ala Phe Pro Glu His Thr His

35 40 45

Asn Arg Trp Ala Leu Val Ala Ser Arg Leu Pro Gly Arg Ser Ala His

50 55 60

Glu Val Trp Glu His Tyr Gln Val Leu Val Asp Asp Val Asp Leu Ile

65 70 75 80

Glu Arg Gly Met Val Ala Ser Pro Gly Cys Trp Asp Asp Asp Asn Asn

85 90 95

Ser Ala Gly His Gly Arg Gly Ser Gly Gly Asp Glu Arg Arg Arg Gly

100 105 110

Val Pro Trp Thr Glu Glu Glu His Arg Leu Phe Leu Glu Gly Leu Glu

115 120 125

Lys Tyr Gly Arg Gly Asp Trp Arg Asn Ile Ser Arg Trp Ser Val Lys

130 135 140

Thr Arg Thr Pro Thr Gln Val Ala Ser His Ala Gln Lys Phe Phe Ile

145 150 155 160

Arg Gln Ala Asn Ala Ser Ser Arg Gly Asp Ser Lys Arg Lys Ser Ile

165 170 175

His Asp Ile Thr Ala Pro

180

<210> 4

<211> 31

<212> DNA

< 213>BamHIOs05g0442400 (c)-F1 (SEQ ID NO.4 leading portion)

<400> 4

cgcggatcca tggcgttcta cctcggcagc a 31

<210> 5

<211> 28

<212> DNA

< 213>SacIOs05g0442400 (c)-R (SEQ ID NO.4 back segment)

<400> 5

cgagctctca tggggcagtg atgtcgtg 28

<210> 6

<211> 21

<212> DNA

< 213>qPCR-4424-F (SEQ ID NO.5 leading portion)

<400> 6

ggtcggtgaa gacgcggact c 21

<210> 7

<211> 23

<212> DNA

< 213>qPCR-4424-R (SEQ ID NO.5 back segment)

<400> 7

tgtcgtggat gctcttacgc ttg 23

Claims (5)

1. isolated paddy rice OsMYBGene is characterized in that the dna molecular for a kind of particular sequence, long 1198bp, and nucleotide sequence is shown in SEQ ID NO.1.

2. one kind requires 1 described paddy rice like right descriptions OsMYBThe protein molecule of gene is characterized in that amino acid coding is shown in SEQ ID NO.3.

3. one kind with the described paddy rice of claim 1 OsMYBBeing transformed in the paddy rice of gene, and the method for change paddy drought resistance is characterized in that concrete steps are following:

(1) coding had paddy rice OsMYBThe exercisable plant expression vector that connects into of the ORFs of gene;

(2) plant in the step (1) is crossed expression vector and change in the Agrobacterium, the Agrobacterium that will contain expression vector is infected rice callus, through cultivation altogether, degerming, antibiotic-screening and differentiation, obtains paddy rice OsMYBThe transfer-gen plant of crossing expression of gene.

4. one kind is used for vitro detection OsMYBThe method of gene expression amount in plant; Mainly utilize the method for quantitative fluorescent PCR; It is characterized in that concrete steps are: get the blade of transgenic paddy rice,, and use the DNaseI dna digestion with TRIzol method extracting paddy rice RNA; Reverse transcription forms cDNA then, is that template is carried out quantitative fluorescent PCR and analyzed with it; The fluorescence quantification PCR primer sequence is the nucleotide sequence shown in the SEQ ID NO.5.

5. in escherichia expression system, express for one kind, it is characterized in that concrete steps are following: SEQ ID NO.1's like the said OsMYB method of protein of claim 2 OsMYBGene is connected in the pET32a carrier, is transformed into e. coli bl21 (DE3) trxB ^-, in the LB substratum, cultivate the host bacterium, 37 ℃ are cultured to and add when OD600 is 0.6 left and right sides that 0.1mM sec.-propyl-β-D-sulfo-galactopyranoside carries out the expression of inducible protein, induces 20 hours for 16 ℃; Collect thalline, ultrasonic disruption, centrifugal collection supernatant is crossed nickel column separating purification albumen, the purifying situation of last SDS-PAGE analyzing proteins.

Images