CN102533788A - EADT1 gene capable of improving drought resistance of rice in growth period, coding sequence and application - Google Patents

Abstract

The invention belongs to the technical fields of molecular biology and genomic engineering, in particular to an EADT1 gene capable of improving drought resistance of rice in a growth period, a coding sequence and application. The invention relates to a coding sequence of a plant lipid transfer protein gene EADT1 expressed in the rice, and the coding sequence mainly has effects of improving the drought resistance of the rice in the growth period (including but not limited to the growth period) and improving the maturing rate of the rice. The invention also discloses a recombinant vector comprising the gene sequence, and a transgenic plant transformed by the vector. The gene is subjected to transformation expression in a plant, the maturing rate of the transgenic rice under drought stress can be improved, and the yield loss of crops in adverse situations such as drought is reduced.

Description

Can improve EADT1 gene, encoding sequence and the application of paddy rice drought resistance in generative phase

Technical field

The invention belongs to molecular biology, gene engineering technology field, be specifically related to a kind of lipid transfer protein of in paddy rice, expressing EADT1The clone of gene, the structure of transgene carrier and the application in improving rice drought tolerance and setting percentage.

Background technology

Paddy rice is the most important food crop of China, also is the maximum crop of water in the agriculture prodn simultaneously.Arid has had a strong impact on the output of paddy rice, how to reduce the dependence of paddy rice to water, makes its characteristic with saving water, resisting drought, and is significant to grain, water and the ecological security of China.The important determinative of output is exactly the setting percentage of paddy rice at the florescence.Paddy rice at different development stage for the tolerance of arid different (Saini & Lalonde, 1998; Yang & Zhang, 2006).When vegetative phase moisture lacks, as long as can keep minimum water requirement, changing the reproductive growth after date over to so, moisture is supplied with competent words, often can blossom and bear fruit, and not necessarily can cause the serious underproduction.Production practice show that also the rice nutrition phase can grow fully on semi-humid soil; But arrived reproductive stage (florescence), certain water layer then need be kept in the field, because this moment, water requirement of rice was maximum.If suffer water stress, the pollen granule fertility tends to be affected, and causes setting percentage seriously descend (Saini & Lalonde, 1998).In the meiophase of paddy rice, the arid about 4 days short period of time all can cause serious 80% (Sheoran Saini, 1996) that descend of output.Therefore, improve rice fertility and setting percentage under the drought stress, crucial meaning is arranged for the rice yield that improves under the adverse circumstance.

Utilize molecular biology and genetic engineering technique to carry out molecular breeding, gene related to drought tolerance changed in the good rice varieties, improve its drought resistance, cultivation be drought resisting again the new crop varieties of high yield and high quality be one of effective way of drought resisting breeding.The method of this research through the paddy gene chip screened one and received drought-induced gene at the florescence EADT1, improve this gene expression level in vivo through transgenic technology, can change the drought-resistant ability at paddy rice florescence, improve setting percentage.

EADT1( Enhance Anthesis Drought Tolerance 1) lipid transfer protein of genes encoding (Lipid Transfer Protein, LTP) ,LTP is one type to have at the active small protein of intermembranous transhipment lipid molecule (Kader, 1975).Its intramolecularly has 8 conserved cysteine residue usually, forms 4 stable disulfide linkage, can be divided into LTP1 and LTP2 family according to different disulfide bond assignment modes, and the LTP1 molecular weight is big slightly usually, between 9-14 kDa, among the present invention EADT1Gene just belongs to LTP1 family.And the molecular weight of LTP2 about 7 Da (Carvalho & Gomes, 2007) usually; The protein that also has one type of LTP-like; Although on primary structure and disulfide bond assignment mode, have similarity with LTP; But molecular memory is at too much charged amino acid; The external activity that does not shift lipid is only found (Cammue et al, 1995) at present in onion seed.LTPGenerally there is the order of coded signal peptide in 5 ' end of gene, and this segment signal peptide is cut off in maturation protein, is present in the cell walls so it is generally acknowledged LTP.A huge lipid transfer protein family is arranged in the paddy rice, and by 52 genes encodings (Boutrot et al, 2008), but the member in this family possibly have different physiological function (Carvalho & Gomes, 2007).In different plant species, the functional segregation of LTP is very various, and concrete report comprises: synthetic (Kim et al, 2008 of participating in cell stratum corneum and wax; Lee et al, 2009); Signal conduction and signal identification (Park et al, 2000; Blein et al, 2002); The transmission of systemic acquired resistance signal (Maldonado et al, 2002); Pollen granule growth course (Li et al, 2006; Zhang et al, 2010); Resist pathogenic bacterial infection (Ge et al, 2003; Lee et al, 2009; Sarowar et al, 2009) etc.Therefore, this gene possibly participate in mainly that some relate to the physiological process of lipid transfer in the plant materials, but the physiological significance that these processes possibly had nothing in common with each other.Among the present invention EADT1Gene has participated in regulating the microgamete growth course under the drought stress.

Summary of the invention

The object of the present invention is to provide a kind of drought-induced lipid transfer protein gene that receives EADT1And encoding sequence, and utilize this gene pairs host plant to carry out the transformation in the heredity, the setting percentage when resistance of raising crop and lack of water.

In order to realize above purpose, one side of the present invention provides the nucleotide sequence of a new paddy rice lipid transfer protein, and its one of coding receives drought-induced lipid transfer protein gene EADT1, external function is to be responsible for the transhipment of lipid, function is to increase the paddy rice drought resistance in generative phase in the body, improves output.Paddy rice EADT1Full length gene 1287bp, ORFs 934bp, introne 3 53bp; The long 348bp of cDNA coding region sequence. EADT1Gene order and cDNA order are respectively shown in SEQ ID NO.1 and SEQ ID NO.2; 115 amino acid of encoding are shown in SEQ ID NO.3.

The present invention also provides from paddy rice mRNA through this lipid transfer protein gene of reverse transcription PCR clone EADT1Primer sequence SEQID NO.4 and SEQID NO.5, the order as follows:

SEQID NO.4 （EADT1-F）： ATGTCTCAGCTCAAGTCTTCTAG

SEQID NO.5 （EADT1-R）： TCAGTGTGGCCAATCAAGTG

The present invention also provides and contains above-mentioned paddy rice EADT1The host of genophore.Preferably, said host is an eukaryotic cell.More preferably, said host is a paddy rice.

The present invention also provides a kind of transgenic technology of utilizing to incite somebody to action EADT1Nucleotide sequence be transformed in the paddy rice, improve its expression in paddy rice, to strengthen drought resistance and the method for setting percentage in its, concrete steps are following in generative phase:

(1) with paddy rice EADT1The coding region of gene is connected in plant expression vector, forms to contain paddy rice EADT1The plant of gene crosses expression vector; Used expression vector can be the carrier of commercialization or laboratory structure, for example pCAMBIA1301U;

(2) plant in the step (1) being crossed expression vector changes among the Agrobacterium EHA105; The Agrobacterium that will contain expression vector is infected rice callus; (at 28 ℃) obtain paddy rice through cultivation altogether, degerming, antibiotic-screening and differentiation (about 4 months time) EADT1The mistake express transgenic plant of gene.Cross expression EADT1The transgenic paddy rice of gene can improve the drought resistance and the setting percentage in the generative phase of paddy rice.

The present invention also provides a kind of method that is used for detecting the transgenic paddy rice expression amount, mainly utilizes the method for quantitative fluorescent PCR.Concrete steps are: get the blade of transgenic paddy rice, with TRIzol method extracting paddy rice RNA, and use the DNaseI dna digestion, reverse transcription forms cDNA then, is that template is carried out quantitative fluorescent PCR and analyzed with it.The fluorescence quantification PCR primer nucleotides sequence is classified SEQID NO.6 and SEQID NO.7 as, as follows:

SEQID NO.6 (qEADT1-F)：CTGCACTGCTGATCTTCCTCCTG

SEQID NO.7 (qEADT1-R)：AGCTTCGGCCCGTCCTTCTC

Among the present invention, can select various carrier known in the art for use, like commercially available carrier and transform thus and other carriers of coming, will EADT1Gene coded sequence is operatively coupled on after the expression regulation sequence, thereby forms EADT1Transgene carrier.

Among the present invention, available fluorescent quantitative PCR technique analysis EADT1Expression of gene, i.e. analyzing rice EADT1The existence of rna transcription thing in cell whether and expression amount.

The present invention has advantage and beneficial effect at least:

(1) paddy rice provided by the invention EADT1Gene and proteins encoded thereof have tangible effect aspect the stress resistance of plant improving, and can obviously improve the increment of paddy rice under arid and high salt condition, have very big using value.

(2) utilize containing that transgenic technology obtains improveing EADT1The conversion plant of gene is under drought condition, and growth, survival state and setting percentage obviously are superior to wild-type plant, have shown paddy rice EADT1Gene can obviously improve the output of crop under drought stress.

(3) paddy rice provided by the invention EADT1The albumen of genes encoding has the activity at intermembranous transfer lipid, has the using value of potential.

Among the present invention, term " EADT1ORFs " refer to the proteic nucleotide sequence of paddy rice EADT1 of encoding complete, like Nucleotide among the SEQ NO.1 and degenerate sequence thereof.This degenerate sequence is meant, is arranged in the nucleotide sequence of SEQ ID NO.2, and having one or more codon to be encoded, the degenerate codon of same amino acid replaces and the sequence that produces.Because the degeneracy of codon, so be low to moderate about 85% the degenerate sequence described sequence of SEQ ID NO.3 of also encoding out with the homology of nucleotide sequence of SEQ ID NO.2.This term also comprise with SEQID NO.1 in homology of nucleotide sequence at least 85%, better 90%, best 95% nucleotide sequence.

Term also comprises encoding to have and natural paddy rice EADT1The variant form of open reading frame sequence among the proteinic SEQ ID NO.1 of gene identical function.These variant forms include, but is not limited to: disappearance, insertion or the replacement of several (being generally 1-90, best 1-10) Nucleotide, and at several (be generally in 60, best is in 5) Nucleotide of 5 ' and/or 3 ' end interpolation.

Description of drawings

Gene chip and qRT-PCR identify paddy rice under Fig. 1 drought stress condition EADT1Expression change.

Fig. 2 paddy rice EADT1Evolutionary analysis (the AT: Arabidopis thaliana of the homologous sequence in sequence and other species; OS: paddy rice).

The evaluation of Fig. 3 transfer-gen plant dna level.Wherein, numbering 1,2 is different expression paddy rice 1 excessively ^#, 12 ^#Plant;

R1, R2 are that RNA disturbs plant r40, R853-1.This figure only explains that carrier changes in the host plant.

Fig. 4 paddy rice seedling is coerced the growing state on substratum under the processing (dormin, sodium-chlor, N.F,USP MANNITOL) in difference.

Fig. 5 paddy rice seedling is coerced the relative growth rate on substratum under the processing (sodium-chlor, N.F,USP MANNITOL) in difference.Wherein A is the growth velocity in containing the N.F,USP MANNITOL substratum; B is the relative growth rate in the sodium chloride-containing substratum.

Fig. 6 rice seedling EADT1Cross to express and reach EADT1Express and disturb (RNAi) strain to tie up to the phenotype under the drought stress.

Fig. 7 rice seedling EADT1Cross to express and reach EADT1Express and disturb (RNAi) strain to tie up to the survival rate under the drought stress.

A is that two mistakes are expressed strain and tied up to the survival rate under the drought stress; B is that two RNA disturb strain to tie up to the survival rate under the drought stress, compares with wild-type, and variation tendency is opposite.

Wild-type and the strain of mistake express transgenic are 12 under Fig. 8 drought stress in generative phase ^#Phenotype contrast.

Wild-type and the strain of mistake express transgenic are 12 under Fig. 9 drought stress in generative phase ^#Pollen granule fertility iodine dyes analysis.

Wild-type and the strain of mistake express transgenic are 12 under Figure 10 drought stress in generative phase ^#The statistical study of pollen granule fertility per-cent.

Wild-type and mistake expression strain are 12 behind Figure 11 drought stress in generative phase ^#Solid situation analysis.

Wild-type and mistake expression strain are 12 behind Figure 12 drought stress in generative phase ^#Setting percentage relatively.

The proteic Subcellular Localization of Figure 13 EADT1.

Embodiment

Following examples are used to explain the present invention, but are not used for limiting scope of the present invention.

The experimental technique of unreceipted actual conditions in following examples; All according to normal condition; Sambrook equimolecular clone for example: laboratory manual (New York: Cold Spring Harbor Laboratory Press, the condition described in l989), or according to the condition of manufacturer's suggestion.

Embodiment 1Paddy rice when arid is handled EADT1Gene is identified at the expression level of rice varieties Japan's fine reproductive development phase

1. coerce processing

After the fine presprouting of seeds of paddy rice Japan, move on in the potting soil and cultivate, stop to water, carry out arid and handle in boot stage; When treating that soil moisture is reduced to 30% left and right sides, keep a week, get different size (2 ~ 3mm; 3 ~ 4mm, 4 ~ 5mm, 5 ~ 7mm) paddy rice; Collect respectively and number, as contrast, do three repetitions with the paddy rice under the normal growth condition.

2. gene chip and quantitative fluorescent PCR are analyzed expression of gene under the drought condition

Utilize the expression of paddy gene under the paddy rice chip analysis drought condition of Agilent company.Different flower growth period under arid and the normal circumstances relatively EADT1Gene is in the expression of the fine flower of rice varieties Japan.The result shows EADT1Gene under the drought stress condition reduction division period (3 ~ 4mm, 4 ~ 5mm) spend middle rise.Utilize quantitative fluorescent PCR to carry out the expression level checking, the result who obtains is consistent (shown in Figure 1) with gene chip result's variation tendency.

Embodiment 2Paddy rice EADT1The clone of gene cDNA fragment

1. the extraction of RNA: get the paddy rice that arid is handled, in mortar,, add the EP pipe that fills 1 ml TRIzol reagent (Promega), fully after the vibration with grinding to form powdery behind the liquid nitrogen freezing; Room temperature was placed 5 minutes, in 4 ℃, behind the centrifugal 10min of 12000 rpm; Supernatant moves in the new EP pipe, adds that 200 μ l chloroforms blend together emulsus, and room temperature left standstill 5 minutes; The centrifugal 10min of 12000 rpm, supernatant move in the new EP pipe, add two volumes isopropanol precipitating RNA; Centrifugal, be dissolved in water after the deposition drying, on spectrophotometer, measure rna content then.

2. reverse transcription: according to the PrimeScript of TaKaRa company ^TMReverse Transcriptase specification sheets is operated: add the total RNA 5 μ l of paddy rice (5 μ g), Oligo (dT) in the centrifuge tube ₁₅Primer (50 μ mol/L) 1 μ l, dNTP (10 mmol/L) 1 μ l, and add to 10 μ l with distilled water; Instantaneously centrifugally liquid is concentrated on manage at the end, 65 ℃ of insulation 5 min are rapidly more than cooled on ice 2 min.In said mixture, add 5 * PrimeScript ^TMBuffer 4 μ l, RNase suppressor factor (40 U/ μ l) 0.5 μ l, PrimeScript ^TMReverse Transcriptase (200 U/ μ l) 0.5 μ l, distilled water adds to 20 μ l, centrifugally liquid concentrated on manage at the end, 42 ℃ of insulation 1 h, 70 ℃ of deactivation 15 min, cooled on ice obtains rice cDNA first chain.

3. EADT1The clone of cDNA

According to the sequence information that provides in the paddy rice database information among the GenBank, design primer (SEQ ID NO.4) utilizes above-mentioned reverse transcription product to be template, adopts PCR method to carry out the cDNA sequence amplification.

Obtain a coding region that includes complete ORF through RT-PCR, length is 348bp; Reclaim, be connected on the pMD19-T carrier, and check order.Sequencing result carries out BLAST on the NCBI website analyzes, and the result shows that itself and paddy rice note gene Os10g0148000 mate fully.Simultaneously; The AK331192.1 of its nucleotide sequence and known grass common wheat has 81% homology; With the gene XM_003573684.1 of two fringe false bromegrasses 72% homology is arranged; With the Gene A K372510.1 of barley 76% homology is arranged, 68% homology is arranged with the gene XM_002467303.1 of Chinese sorghum.

Embodiment 3Paddy rice EADT1Sequence information and homology analysis

EADT1The length of gene coding region is 348bp, and its sequence is shown in SEQ ID NO.2.Derive the aminoacid sequence of paddy rice EADT1 according to full-length cDNA, totally 115 amino-acid residues, molecular weight is 12223.1 dalton, and iso-electric point (pI) is 5.67, and its sequence is shown in SEQ NO.3.Bioinformatic analysis shows that this albumen is unsettled hydrophobic proteins.

This albumen is carried out the BLAST comparison at GenBank, obtain the protein sequence of albumen homology therewith, compare, make up evolutionary tree (Fig. 2) with MEGA5 software according to contiguous method then with Clustal X software.

Embodiment 4 EADT1In paddy rice, crossing the transfer-gen plant of expressing identifies

1. paddy rice EADT1Expression carrier makes up:

According to paddy gene EADT1Full length sequence, design upstream and downstream primer, and introduce restriction endonuclease sites (this is decided by the carrier of selecting for use) is so that construction of expression vector.Amplified production to obtain among the embodiment 1 is a template, behind pcr amplification, with paddy gene EADT1CDNA be cloned into intermediate carrier (the pMD19-T carrier TAKARA), further be cloned on the expression vector pCAMBIA1301U, and order-checking under guaranteeing the correct prerequisite of reading frame, will be somebody's turn to do expression vector again and change in the Agrobacterium, and rice transformation Japan is fine.

2. agrobacterium-mediated transformation carries out the paddy rice transgenic:

A. evoked callus

1) choose the seed of mature and plump, coetonium shell in removing with pure washing 3-4 time, is used 70% alcohol immersion 2min again, and with pure washing 7-8 time, the mercuric chloride with 0.1% is handled 15min, 100rpm.

2) in super clean bench, discard mercuric chloride, use aseptic washed several times with water, suck dry moisture on aseptic clean filter paper places on the N6D substratum, embryo down or the contact substratum, 28 ℃, secretly cultivated 21 days.12-15 grain/tissue culture bottle.

B. succeeding transfer culture

Radicle, plumule around the callus are divested totally, and callus is dried in the air on clean filter paper, is transferred on the N6D subculture medium, 28 ℃, secretly cultivates 7-10 days.

C. cultivate before

The callus of subculture is transferred on the preceding substratum, 28 ℃, secretly cultivated 3-4 days.

D. the cultivation of Agrobacterium EHA105

The correct clone's who obtains in the last branch experiment Agrobacterium bacterium liquid is coated on the YEB three anti-dull and stereotyped (Streptomycin sulphate, Rifampin and kalamycin resistance), 28 ℃, secretly cultivated about 36 hours.

E. infect together and cultivate

1) callus of preceding cultivation is dried in the air on aseptic filter paper, be transferred in the plate in the union.

2) get the little spoon of sterilization and scrape and get Agrobacterium 4-6 spoon in the liquid nutrient medium that infects usefulness, be stirred to suspend evenly (no big bacterium piece existence).

3) callus is gone in the centrifuge tube, the mixing that overturns gently leaves standstill 15～20min, during at interval the 5min mixing is once.

4) bacterium liquid is poured out, callus places and dries up approximately more than 1.5 hours on the aseptic filter paper, guarantees that bacterium liquid blots, and is connected on the common culture medium, 20 ℃, secretly cultivates 2-3 days.

F. degerming

1) callus that will cultivate altogether is transferred to the centrifuge tube of 50mL, and is more than 3 times, more limpid until flowing fluid ratio with sterile water wash.

2) pour out sterilized water, clean, each 100rpm, 15～20min, 3～4 times with the N6D liquid nutrient medium that contains the 500mg/L cephamycin.

3) callus is poured on the clean sterilization filter paper, blots and dry up more than 2 hours, guarantee to blot.

4) the exsiccant callus is gone to except that on the bacterium culture medium, 28 ℃, dark cultivation, 7～10 days.

G. screening

The callus that to do not polluted by Agrobacterium is transferred on the screening culture medium (N6D+50mg/L HYG+250mg/L cephamycin), and 28 ℃, the dark cultivation.Can change a subculture in per 15～20 days, screening time must not be less than 45 days.

H. differentiation

To pass through the new longer callus of screening and be transferred to 28 ℃ of division culture mediums (MS+2mg/L 6-BA+0.2mg/L NAA+2mg/L KT+0.2mg/L IAA+ 50mg/L Totomycin+250mg/L cephamycin), light was cultivated in 16 hours.Before carrying out differentiation culture, can be earlier cultivate several days with as presorting with callus is dark.Also need regular replacing substratum.

I. take root

The transgenic seedling (> 1cm that differentiation is come out is high), divest unnecessary callus, and cut off root (staying about 0.5cm), move in the 1/2MS substratum and take root.28 ℃, light was cultivated in 16 hours.

J. refine seedling and transplanting

Take root finish after, can remove root media after, seedling is steeped in water a few days refines seedling, transplant the middle growth of burying then.

3. the evaluation of transfer-gen plant

Clip transgenic paddy rice blade extracts DNA with the CTAB method, identifies transgenic situation (Fig. 3) through the method that detects hygromycin gene.

And with TRIzol method extraction blade RNA, reverse transcription becomes cDNA (method is with instance 2), carries out quantitative fluorescent PCR according to gene order design primer and analyzes in the transgenic paddy rice EADT1Expression of gene situation, concrete operations are according to TAKARA company test kit description operation, and quantitative real time PCR Instrument is ABI Steponeplus ^TM

Embodiment 5 EADT1Crossing the resistance of express transgenic plant identifies

The gene chip analysis revealed, EADT1Express obviously in gene the spending behind drought stress and improve.To seedling stage and boot stage EADT1Mistake express transgenic strain system (Japan is fine) carry out experiments such as arid and salt stress respectively, the resistance of observation transgenic paddy rice contrasts with wild-type.

1. the drought resisting in seedling stage is handled

Japanese fine rice paddy seed and transgenic paddy rice seed; After peelling off shell; After sterilizing 20 minutes with 50% chlorine bleach liquor; Sowing is containing 1/2MS and is containing respectively in the 1/2MS substratum of ABA (4uM), NaCl (150mM), N.F,USP MANNITOL (200mM), observes sprouting and the growing state of paddy rice under ABA, NaCl and N.F,USP MANNITOL (as the stand-in of drought stress) stress conditions.28 ℃ of illumination cultivation (16 hours illumination/8 hour dark) were measured the growing height of paddy rice after 12 days, and the weight of the individual plant paddy rice that in N.F,USP MANNITOL, grows.The paddy rice relative growth rate equals height or the length of growth paddy rice under height or the length/normal condition of paddy rice under the different treatment condition.The result shows, crosses and expresses EADT1The growth velocity of the transgenic paddy rice of gene under stress conditions obviously increases, and particularly the growth velocity of root will significantly be higher than contrast (Fig. 4,5).

Plant the contrast of 5-6 germination or transfer-gen plant (Japanese warm and fine transgenic paddy rice) in each basin (black earth: vermiculite=7:3); Treat that paddy rice length stops during the phase watering to 5 leaves; In booth, let its moisture spontaneous evaporation; Carry out arid and handle, approximately arid is after 8 days, and the survival degree of the blade of transgenic paddy rice is obviously higher.After the rehydration 3 days, transgenic paddy rice turn green survival rate also obviously comparison according to high.Anthrone method measures soluble sugar and acid ninhydrine method mensuration proline(Pro) shows, under drought condition, a large amount of soluble sugar and the proline(Pro) of genetically modified paddy rice accumulation shows stronger drought resistance (Fig. 6,7).

2. arid is handled before blooming

When treating paddy rice length, carry out moisture natural drought method to meiophase.Paddy rice is planted in the square basin that contains rice soil, treats moisture evaporation to water ratio about 15%, keeps this water ratio 15 days, recovers later on to water, cross express the plant survival plant far away more than control group (Fig. 8), the result shows, crosses and expresses EADT1Can effectively improve the drought resistance of paddy rice.

3. the drought resisting in flowering period is handled

Boot stage, paddy rice was carried out moisture natural drought method.Paddy growth in the earth of square basin, change reproductive growth over to after, stop to water, treat that soil moisture content reduces to about 15% backs and kept these water ratio 3 days, measure the proline content of sword-like leave, and use I ₂-KI dyes and observes the activity of paddy pollen: get clever shell and just open, but the also uncracked flower of flower pesticide is gathered the paddy rice mature anther, and flower pesticide on slide glass, is added 1 zero(ppm) water, with tweezers flower pesticide is smashed to pieces, pollen granule is discharged.Dry, approximately 10min; Add 1～2 I ₂-KI solution, covered, 5min; Examine under a microscope 2～3 slides; Get 3-5 the visual field for every, the rate of dyeing of statistics pollen, wherein the pollen of grape is the fertile flower powder; Red or xanchromatic is a pollen sterile, and the pollen granule fertility is a fertile flower powder number divided by the total resulting percentage ratio that can educate with the sterile flower powder.The result shows, changes EADT1The fertility of the paddy rice of gene pollen granule under drought condition will be apparently higher than the paddy rice (Fig. 9,10) of control group.Recover behind the florescence drought stress to water, treat to add up setting percentage behind the seed maturity, the result shows, crosses the express transgenic paddy rice and can improve the setting percentage of paddy rice, and the transgenic paddy rice setting percentage is higher than according to group (Figure 11,12).

Embodiment 6The proteic Subcellular Localization of analyzing rice EADT1 in the tobacco

EADT1Gene is connected on the transient expression carrier p35S::EYFP; Transform Agrobacterium; Be expelled to the Agrobacterium that contains expression plasmid in the tobacco leaf along the tobacco vein with micro-syringe; Cultivate after 3 days, the blade that cuts injection position is observed under Laser Scanning Confocal Microscope and is taken a picture, and the result shows that this albumen is positioned (Figure 13) around cytolemma and the nuclear membrane.

< 110>Fudan University

< 120>can improve EADT1 gene, encoding sequence and the application of paddy rice drought resistance in generative phase

<130> 001

<160> 7

<170> PatentIn version 3.3

<210> 1

<211> 1287

<212> DNA

<213>

<400> 1

taaatcaaac acgtagccat gaaccattca cctcacaagt cacaagcatt gcatttctat 60

ggttaccagt gcaggacgaa atgctcaact agcccaagca agaatggagc atgacaacct 120

caggcaccaa aagctctata aatatttgca ttgcacaaat caaaagtttc caagttttaa 180

tcagagaagt tcaagatatc agaaagaaca acacatacca ggatgtctca gctcaagtct 240

tctagcctgg ctgcactgct gatcttcctc ctggcagtgt tcaccactgc agcagcagcg 300

gcaggtacag aatgccagaa cgatgtcgag gtgctgaaga caacctgcta caagttcgtt 360

gagaaggacg ggccgaagct gcagccatca cctgactgct gcacctccat gaagggcgtc 420

aacgtgccct gcgtctgcac ctacctgggc agcccaggcg tcagggacaa catcaacatg 480

gataaggtgt tctatgtcac caagcagtgt ggcatcgcca tccccgggaa ctgcggaggt 540

gagcaggctt cacttgattg gccacactga tcacctgggt aagaactgac aataacacgc 600

cggctcctct ggattgcgac ttccagtggg gcccaggtgt cggtgtcagc tgggtaagtt 660

ggtgtcatct ggtatgggaa actttgatgt tttgtacatg tggtggtgct cttgtcaaca 720

ttatatagat aaggagagaa taggacaaac atgacgcttg aatagcagaa gagaagttct 780

atccagcaat atcaaaagta cagctgtcat tttcaaaaaa tgtaaaacaa aaataaaacg 840

aaaaacccac tatactagtg ccaataaaag aagaaacaaa agagaactac attattgtca 900

atgccatttg ttgatgttat tattactttt gtttataaga ataacaattg tacttataag 960

gcctacgatt tattacagga tccaaggtct aaaacaagaa ctgattgact tggtgaagtt 1020

ggctgacaaa agcaaggcac ctagcagttg cacggctgat ataggtaaat aatgttggtc 1080

aacttttaga gtacacggat tgtacgtcaa ccttcagcat gttgtgataa caaaatatgt 1140

atcaatgatg gttgtctata tacactgaaa atgcaagagt atttttaaat cacatgttgt 1200

attgagtatt gacccagcta tcaactgttt gttgatgtgc cctgttcctt agtctgataa 1260

atgctaatat agcacattgc taaaagc 1287

<210> 2

<211> 348

<212> DNA

<213>

<400> 2

atgtctcagc tcaagtcttc tagcctggct gcactgctga tcttcctcct ggcagtgttc 60

accactgcag cagcagcggc aggtacagaa tgccagaacg atgtcgaggt gctgaagaca 120

acctgctaca agttcgttga gaaggacggg ccgaagctgc agccatcacc tgactgctgc 180

acctccatga agggcgtcaa cgtgccctgc gtctgcacct acctgggcag cccaggcgtc 240

agggacaaca tcaacatgga taaggtgttc tatgtcacca agcagtgtgg catcgccatc 300

cccgggaact gcggaggtga gcaggcttca cttgattggc cacactga 348

<210> 3

<211> 115

<212> PRT

<213>

<400> 3

Met Ser Gln Leu Lys Ser Ser Ser Leu Ala Ala Leu Leu Ile Phe Leu

1 5 10 15

Leu Ala Val Phe Thr Thr Ala Ala Ala Ala Ala Gly Thr Glu Cys Gln

20 25 30

Asn Asp Val Glu Val Leu Lys Thr Thr Cys Tyr Lys Phe Val Glu Lys

35 40 45

Asp Gly Pro Lys Leu Gln Pro Ser Pro Asp Cys Cys Thr Ser Met Lys

50 55 60

Gly Val Asn Val Pro Cys Val Cys Thr Tyr Leu Gly Ser Pro Gly Val

65 70 75 80

Arg Asp Asn Ile Asn Met Asp Lys Val Phe Tyr Val Thr Lys Gln Cys

85 90 95

Gly Ile Ala Ile Pro Gly Asn Cys Gly Gly Glu Gln Ala Ser Leu Asp

100 105 110

Trp Pro His

115

<210> 4

<211> 23

<212> DNA

<213>

<400> 4

atgtctcagc tcaagtcttc tag 23

<210> 5

<211> 20

<212> DNA

<213>

<400> 5

tcagtgtggc caatcaagtg 20

<210> 6

<211> 23

<212> DNA

<213>

<400> 6

ctgcactgct gatcttcctc ctg 23

<210> 7

<211> 20

<212> DNA

<213>

<400> 7

agcttcggcc cgtccttctc 20

Claims (6)

1. isolated paddy rice EADT1Gene is characterized in that the dna molecular for a kind of particular sequence, long 1287bp, and nucleotide sequence is shown in SEQ ID NO.1.

2. one kind is come from paddy rice mRNA reverse transcription EADT1The cDNA order is characterized in that the dna molecular for a kind of particular sequence, long 348bp, and nucleotide sequence is shown in SEQ ID NO.2.

3. one kind requires 1 described paddy rice like right descriptions EADT1The protein molecule of genes encoding is characterized in that aminoacid sequence is shown in SEQ ID NO.3.

4. one kind with claim 1 or 2 described paddy rice EADT1Gene transformation strengthens paddy drought resistance and the method that improves paddy rice setting percentage under the drought stress in paddy rice, it is characterized in that concrete steps are:

(1) coding had paddy rice EADT1The ORFs of gene connects into plant transgene and crosses expression vector pCAMBIA1301U;

(2) plant in the step (1) is crossed expression vector and change in the Agrobacterium, infect rice callus then,, obtain paddy rice through cultivation altogether, degerming, antibiotic-screening and differentiation EADT1The mistake express transgenic plant of gene.

5. one kind is used for vitro detection EADT1The method of gene expression amount in plant; It is characterized in that concrete steps are: get the blade of transgenic paddy rice,, and use the DNaseI dna digestion with TRIzol method extracting paddy rice RNA; Reverse transcription forms cDNA then, is that template is carried out quantitative fluorescent PCR and analyzed with it; The fluorescence quantification PCR primer sequence is the nucleotide sequence shown in the SEQ ID NO.5.

6. utilize nucleotide sequence to carry out the host plant that transgenic obtains like claim 1 or claim 2.

Images