CN103088027A - PDR transport protein gene promoter for controlling ginsenoside accumulation, and its application - Google Patents

Abstract

The invention discloses a PDR transport protein gene promoter for controlling ginsenoside accumulation, and its application. A promoter ProPDR1 has a DNA sequence represented by SEQIDNo.1 or has a DNA sequence having a homology of above 99% to SEQIDNo.1. A PgPDR1 transport protein gene promoter sequence is obtained through cloning by adopting genome walker in the invention, and includes a TCA element and TCCACCT-Motif. A promoter expression vector pBI121-ProPDR1::GUS is constructed in the invention, and reporter gene GUS is strongly controlled by ginsenoside, salicylic acid, methyl jasmonate and abscisic acid in transgenic tobacco under the driving of the promoter ProPDR1, so the ginseng PgPDR1 gene expression promoted by the promoter is closely related to the ginsenoside accumulation. The promoter provided by the invention has very important application values in the medical plant secondary metabolite synthesis and accumulation control gene engineering.

Description

A kind of PDR transporter gene promotor and application thereof that regulates and controls the ginsenoside accumulation

Technical field

The invention belongs to the plant gene engineering technology field, be specifically related to a promotor that can regulate and control the PDR transporter gene of ginsenoside accumulation.

Background technology

Ginseng ( P. ginsengC.A. being Meyer) Araliaceae Panax per nnial herb, is rare traditional Chinese medicine.Contain multiple medicinal ingredients in ginseng, wherein ginsenoside is the topmost activeconstituents of ginseng.Isolated at present more than 50 and plant ginsenoside from ginseng, modern medicine study proves that each saponin monomer has important pharmaceutical use, and has been widely used in clinical.That but some of them have is antitumor, anti-ageing, inhibited apoptosis and the strong saponin content of strengthening immunity isoreactivity extremely low.Utilize the relevant gene regulating technology of ginsenoside anabolism to promote the synthetic and accumulation of ginsenoside to have important theory value and application prospect.

Effective transcript and expression of gene is the essential condition of its gene function of performance, and gene success transcript and expression need to rely on promotor to its regulation and control, and promotor and RNA polymerase, transcriptional regulator etc. interact and bring into play the function of its regulation and control.TATA in eukaryote and CAAT box, they have determined initiation site and the efficient of transcribing, and are responsible for and the RNA polymerase combination, start the basic transcription process.Promoter component has many different types, comprises pathogeny evoked type functional element, organizing specific type functional element and chemical derivatization element etc.Wherein chemical substance induction type functional element is promoting secondary metabolite to play an important role aspect synthetic.In the synthetic expression process with accumulating genes involved of secondary metabolite, cis-acting elements is by bringing into play important regulating and controlling effect with the interaction of transcription factor: environmental stimulus is through after a series of signal transduction, transmitting, activate the interaction of defence associated transcription factor and special cis-acting elements, thereby realize the expression of relevant defense function gene.Above-mentioned important regulating and controlling effect in view of cis-acting elements, use the resistant gene of inducible promoter mediation to have undoubtedly many-sided advantage, identify that therefore the synthetic inducible promoter relevant to accumulation of secondary metabolite become one of focus of present molecular biology of plants research.In the ginseng Secondary Metabolic Regulation of Callus, can be by the multistep rate-limiting reaction in the gene regulating route of synthesis such as importing key enzyme, the expression of perhaps synthesizing, transporting and accumulate genes involved at the transcriptional level control ginsenoside by cis-acting elements, thereby the content of raising ginsenoside.

Plant ABC(ATP-binding cassette transporter) translocator is present known maximum, function is protein family the most widely, abc transport albumen belongs to the cross-film transport protein, energy transhipment organic acid, alkaloid, products of cellular metabolism and the medicine etc. that utilize hydrolysising ATP to discharge.Participate in bacterial drug resistance, secondary metabolite accumulation, coerce reaction and tumour resistance etc.The abc transport protein family comprises multidirectional resistance albumen (pleiotropic drug resistance, PDR), multidrug resistance albumen (multidrug resistance, MDR) etc.PDR is wherein maximum subtribe, is distinctive a kind of abc transport albumen in plant and fungi.But very few to the research of plant PDR gene-correlation at present, in vitro cell culture, sclareol can be induced NpPDR1The gene up-regulated expression, in cell NpPDR1 albumen accumulation strengthened cell transport outside born of the same parents sclareol with and the ability of analogue.Arabidopis thaliana ( A. thaliana) in cell the accumulation of sclareol also can induce AtPDR12The gene up-regulated expression detects the sclareol that AtPDR12 albumen is transported simultaneously outside born of the same parents in the extracellular, infer that terpene substances may be AtPDR12The upstream regulation and control substance of genetic expression.In petunia, PhPDR1 albumen can be transported a kind of newfound plant hormone-solely angle gold lactone, and then promotion petunia branch.Thereby the PDR transporter gene has important potentiality aspect the accumulation of regulation and control secondary metabolite.Yet, there is no the report of PDR protein gene and controlling element thereof in ginseng.

Summary of the invention

The present invention is intended to isolate the inducible promoter that is subjected to the chemical substance induction regulating controllings such as ginsenoside from ginseng, can regulate and control the ginsenoside transhipment genetic resources relevant to accumulation thereby provide a kind of, for the Future Development gene engineering product lays the foundation.

For achieving the above object, the invention provides a kind of regulate and control ginsenoside transhipment and accumulation PgPDR1The promotor ProPDR1 of gene, its sequence is as shown in SEQ ID NO.1.The sequence of promotor ProPDR1 of the present invention can be also the DNA sequence dna that has 99% above homology with SEQ ID NO.1.

The preparation method of promotor ProPDR1 provided by the invention is: (1) extracts the ginseng genome DNA, take the total DNA of ginseng as template, builds four promoter libraries: DraThe I library, EcoR V library, PvuThe II library and StuThe I library; (2) respectively to build DraThe I library, EcoR V library, PvuThe II library and StuThe I library is template, according to ginseng PgPDR5 ' terminal sequence design primer of 1 gene carries out pcr amplification; (3) glue reclaims the PCR product, and this product namely gets promotor ProPDR1 of the present invention.

In aforesaid method, in described step (2) according to ginseng PgPDRThe primer of 5 ' terminal sequence design of 1 gene is a primer pair: outside primer and nested primer, outside primer are as shown in SEQ ID NO.2, and nested primer is as shown in SEQ ID NO.3.

The present invention also provides the recombinant vectors that contains the ProPDR1 promotor, specifically comprise: plant expression vector pBI121, namely exactly the ProPDR1 promotor is connected in empty carrier pBI121, obtains the recombinant vectors pBI121-ProPDR1::GUS of the gus reporter gene of ProPDR1 promoters driven.The ProPDR1 promotor also can be cloned in other empty carriers, or is prepared into transgenic cell and recombinant bacterium.

The construction process of recombinant vectors pBI121-ProPDR1::GUS provided by the invention is: (1) is according to corresponding the comprising of ProPDR1 promoter sequence design fragment HinD III/ BamThe Auele Specific Primer of HI restriction enzyme site is used respectively Bam HI and Nco I double digestion pBI121 and promotor ProPDR1, reclaims pBI121 carrier and ProPDR1 promoter fragment; (2) two fragments connected and transform DH5 α; (3) identify by kantlex screening, PCR and Bam HI/Nco I double digestion, namely obtain described recombinant vectors pBI121-ProPDR1::GUS.

In the structure of above-mentioned recombinant vectors pBI121-ProPDR1::GUS, step (1) is according to corresponding the comprising of ProPDR1 promoter sequence design fragment HinD III/ BamThe Auele Specific Primer of HI restriction enzyme site is as shown in SEQ ID NO.4 and SEQ ID NO.5.In step (3), PCR identifies that designed primer is as shown in SEQ ID NO.6 and SEQ ID NO.7.

Of the present invention studies show that has the function that promotes the transhipment of regulation and control ginsenoside and accumulation aspect, the application of the recombinant vectors that therefore provides the ProPDR1 promotor and contained promotor in the transhipment of regulation and control ginsenoside and accumulation and in the ginseng breeding.

The present invention utilizes plant gene engineering technology, 5 ' terminal sequence according to the ginseng PgPDR1 gene of having cloned, adopt genomic walking (Genowalker) technical point from the ProPDR1 promoter sequence, build the recombinant expression vector of ProPDR1::GUS reporter gene, and changing gene over to tobacco by agrobacterium tumefaciens-mediated transformation, ProPDR1 transcribes and the driving function of expressing gus reporter gene through the heterogenous expression assay certificate.The gus gene of ProPDR1 promoters driven is expressed to have tissue specificity and is subjected to inducing of the chemical substances such as Whitfield's ointment, Plant hormones regulators,gibberellins and ginsenoside, shows that described ProPDR1 promotor has the function that promotes the transhipment of regulation and control ginsenoside and accumulation aspect.Can be by this regulation and control of promotor or derivatives thereof or improvement ginseng and other plant, obtain the high good plant kind of content of ginsenoside, this is for the regulative transcription factor gene of the key in follow-up clone's ginsenoside encoding transport signals approach, and lays a good foundation for researchs such as the transhipment that regulates and controls the terpenoids such as ginsenoside by transgenic method and accumulation.

Description of drawings

Fig. 1 is the ginseng ProPDR1 promoter fragment electrophoresis result that the present invention increases; In figure, 1 expression pcr amplification product, M represents Marker;

Fig. 2 is the ginseng ProPDR1 promotor cis-acting elements analysis chart that the present invention increases;

Fig. 3 is the ginseng ProPDR1 promoter fragment electrophoresis result that increases in transgene tobacco; In figure, 1 ~ 6 expression pcr amplification product, M represents Marker;

Fig. 4 is that ProPDR1 promotor of the present invention starts the expression level figure of gus reporter gene in the transgene tobacco different tissues;

Fig. 5 is that ProPDR1 promotor startup gus reporter gene of the present invention is induced lower expression level view at 20 μ M GA, 50 μ M SA, 20 μ M ABA and 20mg/L GS, and wherein GA is that Plant hormones regulators,gibberellins, SA are that Whitfield's ointment, ABA are that dormin, GS are Radix Ginseng total saponins.

Embodiment

Below describe concrete enforcement of the present invention in detail, the explanation of all embodiment should not be construed as limiting the scope of the invention.

The acquisition of embodiment 1 ProPDR1 promotor

1, the structure of ginseng DNA extraction and promoter library thereof

Get the 4 years living ginsengs in Changbai mountain, Jilin ginseng producing region, tap water soaks the 45min post-flush 2 times, first uses 75% alcohol immersion 30 seconds (sec), aseptic water washing 2 times.With reference to Omega Plant DNA Kit(Omega company) illustrate and extract genomic dna, take the total DNA of ginseng as template, build according to Genomewalker test kit (Takara company) specification sheets DraI library (DL1), EcoR V library (DL2), PvuII library (DL3) and StuI library (DL4).

2, design of primers and pcr amplification

(1) design of primers is with synthetic

According to the ginseng of having cloned PgPDR5 ' end group of 1 gene (accession number is KC013236, and number of patent application is 201210464442.2) designs the outside and nested primer because of sequence, adopts Primer Premier 5.0 software design primers as follows:

Pro1-SP：5′-TGAAGCCAGCACCCTGCGATCCAAGAA-3′；（SEQ?ID?NO.2）

Pro1-Nest-SP：5′-TCCCTTGAACTACTCCTGCTGCTTTGC-3′。（SEQ?ID?NO.3）

Primer is synthetic by Shanghai English fine horse biological company limited.

(2) pcr amplification

Respectively take four promoter libraries (DL1, DL2, DL3 and DL4) of building as template, utilize in Pro1-SP primer and test kit outside primer AP1 (5' – GTAATACGACTCACTATAGGGC – 3') carry out first round pcr amplification.

Reaction system is: 10 * PCR damping fluid, 5 μ L, MgCl ₂(25mmol/L) 5 μ L, dNTP(2.5mmol/L) 8 μ L, Pro1-SP(10 μ mol/L) 2 μ L, AP1(10 μ mol/L) 2 μ L, library DNA 1 μ L, ddH ₂O 26.5 μ L and LA Taq DNA polymerase(5U/ μ L) 0.5 μ L.

Reaction conditions is: 94 ℃ of sex change 25sec, and 72 ℃ are extended 3min, 7 circulations; 94 ℃ of sex change 25sec, 67 ℃ of annealing 3min, 32 circulations; 72 ℃ are extended 10min.

With 50 times of above-mentioned first round PCR product dilutions, then the nested primer AP2(5' – ACTATAGGGCACGCGTGGT – 3' to provide in test kit) and the Pro1-Nest-SP primer, with above-mentioned same system, 94 ℃ of sex change 25sec, 72 ℃ are extended 3min, 5 circulations; 94 ℃ of sex change 25sec, 67 ℃ of annealing 3min, 25 circulations; 72 ℃ are extended 10min.1.0% agarose gel electrophoresis is analyzed the PCR product.

(3) amplified fragments glue reclaims, connects, checks order and analyzes

Be connected on pGEM-T Easy carrier after will PCR product glue reclaiming, and transform bacillus coli DH 5 alpha, recombinant plasmid pGEM-ProPDR1 will be served the order-checking of Hai Yingjun company.The sequence length that obtains after order-checking is the gene fragment of 877bp, to the gene order that obtains with PgPDR1Gene 5' end overlap sequence is compared, through compare accurate after, sequence to the clone adopts PlantCARE (http://bioinformatiCS.psb.ugent.be/webtoo1s/plantCare/html/) on-line analysis instrument to carry out the cis element analysis to the promoter fragment of cloning, analytical results is seen Fig. 2, and result shows that clone's sequence contains the due primary element of promotor (TATA-Box and CAAT-Box) and multiple cis-acting elements.In its sequence table shown in SEQ ID NO.1.

Structure and the conversion of embodiment 2 plant expression vectors

1, the structure of plant expression vector

(1) according to corresponding the comprising of ProPDR1 promoter sequence design fragment HinD III/ BamThe special primer of HI restriction enzyme site, the upstream and downstream primer is called after P1 and P2 respectively.

P1：5′-CGCGGATCCATCTTATACTCCATCCGTCCC-3′；（SEQ?ID?NO.4）

P2：5′-CCCAAGCTTATTAACATCAGAATACCCAGA-3′。（SEQ?ID?NO.5）

Use respectively HinD III and BamHI double digestion pBI121 and ProPDR1 reclaim pBI121 carrier and ProPDR1 promoter fragment.Two fragments are connected and transform DH5 α, by kantlex screening, PCR and HinD III/ BamThe HI double digestion is identified and is obtained recon, recombinant plasmid called after pBI121-ProPDR1::GUS.

(2) preparation of agrobacterium tumefaciens competent cell

1. streak culture Agrobacterium EHA105 on the YEB flat board that contains 100 μ g/mL rifomycins, secretly cultivate 2d for 28 ℃.

2. picking list colony inoculation is in the YEB substratum that contains 100 μ g/mL rifomycins, and 28 ℃ of shaking culture are spent the night.

3. the Agrobacterium of activation of spending the night contains to 50mL by the dilution proportion of l:50 in the YEB substratum of kanamycin of 100 μ g/mL, and 28 ℃ of shaking culture are about 0.4-0.6 to OD600, ice bath 30min.

4. in 4 ℃, the centrifugal 10min of 5000rpm abandons supernatant liquor, with 10mL 0.15mM NaCl suspension thalline.

5. in 4 ℃, the centrifugal 10min of 5000rpm abandons supernatant liquor, with 2mL 20mM CaCl ₂The suspension thalline.

6. every pipe 200 μ L packing, liquid nitrogen flash freezer ,-70 ℃ of preservations.

(3) conversion of agrobacterium tumefaciens competent cell

1. the agrobacterium tumefaciens competent cell is placed on ice, slowly thaws.

2. add 0.5 μ g pBI121-ProPDR1::GUS plasmid DNA, mixing gently, ice bath 30min.

3. put freezing 2min in liquid nitrogen, move into rapidly heat shock 5min in 37 ℃ of water-baths, rapider ice bath 2min, add afterwards 800 μ L YEB liquid nutrient mediums, in 28 ℃ of shaking culture 3-4h.

4. the centrifugal 5min of 5000rpm precipitation thalline discards Eddy diffusion thalline after 800 μ L supernatants, evenly coats on the YEB substratum that contains 100 μ g/mL rifomycins and 50 μ g/mL kantlex, cultivates 2-3d for 28 ℃.

(4) agrobacterium tumefaciens plasmid extraction and evaluation

1. PCR identifies

The single colony inoculation of the Agrobacterium that picking transforms contains 37 ℃ of shaking culture in the LB liquid nutrient medium of kantlex in 1.5mL, differentiates with ProPDR1 promotor Auele Specific Primer, and primer is as follows:

P3：5′-CCAAGGTGGAAAGTGGTTGC-3′；（SEQ?ID?NO.6）

P4：5′-TGTCCACTGTGCAGTAGTGAT-3′；（SEQ?ID?NO.7）

After pcr amplification, agarose gel electrophoresis detects whether contain the expection fragment.The PCR response procedures is as follows: 94 ℃ of 30sec, 58 ℃ of 30sec, 72 ℃ of 30sec, 35 circulations; 72 ℃ of 2min.

2. enzyme is cut evaluation

Picking picking PCR is accredited as the single colony inoculation of positive Agrobacterium in the YEB substratum of the kantlex of the rifomycin that contains 100 μ g/mL and 50 μ g/mL, 28 ℃ of overnight incubation are cultivated, extract recombinant plasmid pBI121-ProPDR1::GUS, adopt aforesaid method with HinD III/ BamThe plasmid that the HI double digestion extracts.After cutting and identify correctly, the process enzyme obtains to contain the Agrobacterium of recombinant plasmid pBI121-ProPDR1::GUS.

2, the screening of gene transformation and transgene tobacco

(1) agrobacterium tumefaciens that contains the pBI121-ProPDR1::GUS plasmid is cultivated

The Agrobacterium that 28 ℃ streak culture contains the pBI121-ProPDR1::GUS plasmid is 2d approximately.Picking list colony inoculation is in the YEB liquid nutrient medium that contains 100mg/L rifomycin and 50mg/L kantlex, and 28 ℃ of shaking culture are spent the night, and be about at 0.6 o'clock to OD600 and collect bacterium liquid, the centrifugal 10min of 4000rpm, precipitation is resuspended in the 1/2MS liquid nutrient medium.

(2) leaf dish method infects tobacco

With tobacco ( Nicotiana benthamiana) spire is placed in tap water and rinses 3-4 time, then soaks 30-60sec in 70% ethanol, the 10-20min that sterilizes in 10% clorox, more fully rinse with sterilized water, then be placed in sterile petri dish, blade is cut into 0.5-lcm ²Small pieces, the blade that shears is put into respectively the Agrobacterium bacterium liquid that contains the pBI121-ProPDR1::GUS plasmid infects 5min, the bacterium liquid on blade is blotted with aseptic filter paper.

(3) cultivate altogether

Infected and blotted the leaf dish of surperficial bacterium liquid, pore faces up, and nestles up to be placed on (MS+6-BA 1.0mg/L+IAA 0.1mg/L) on common substratum, and 2d is cultivated at dark place.

(4) screening and differentiation culture

After dark cultivation 2d, be transformed on the screening division culture medium (MS+6-BA 1.0mg/L+IAA 0.lmg/L+Kan 100mg/L+Cef 300mg/L), every 15d changes the primary screening division culture medium, goes in root media when the tobacco that differentiates grows to 3-5cm.

(5) root culture

The tobacco that breaks up to 3-5cm is downcut respectively, be transferred to root media (1/2MS+IBA 2.0mg/L).

(6) transplant

When the root of regeneration plant grows to 5-8cm, open sealed membrane hardening 2-3d, with seedling replanting to flowerpot, the initial upper transparent plastics of 5-l0d cover after transplanting, the humidity of maintenance 90%-100%, and beat a little apertures be beneficial to gaseous interchange on covering.The matrix of transplanting and flowerpot be sterilization in advance all.

(7) transfer-gen plant PCR identifies

Take the genomic dna of transfer-gen plant as template, adopt ProPDR1 gene-specific primer (P3 and P4) to carry out pcr amplification, PCR reaction system and reaction conditions are the same.Transgenic tobacco plant PCR detected result is seen Fig. 3, wherein 1 ~ No. 4 T for conversion pBI121-ProPDR1::GUS success and seedling differentiation ₀For positive transfer-gen plant, No. 5 for transforming the T of pBI121-ProPDR1::GUS failure and seedling differentiation ₀For positive transfer-gen plant, No. 6 for turning the T of empty carrier pBI121 success and seedling differentiation ₀For positive transfer-gen plant.

(8) ProPDR1 starts GUS expression and active detection the thereof

Utilize GUS can with substrate MUG(3,4-methyl umbellate form ketone-beta-glucuronidase) reaction produces fluorescent substance MU(4-methyl umbellate form ketone).The excitation wavelength of MU is 365nm, and emission wavelength is 456nm, and its content can be measured by spectrophotofluorometer.What of the fluorescent substance that produces within the unit time according to the plant total protein of unit mass come quantitative detection GUS content.

Reagent preparation: 1mol/L Na ₂HPO ₄Solution: 35.814g Na ₂HPO ₄Be dissolved in 100mL water.1mol/L NaH ₂PO ₄Solution: 15.601g NaH ₂PO ₄Be dissolved in 100mL water.0.1M phosphoric acid buffer (pH7.0): 1mol/L Na ₂HPO ₄Get 5.77mL, 1mol/L NaH ₂PO ₄Get 4.23mL, be settled to 100mL.10% SDS solution: 90mL water is heated a little, add 10g SDS, stirring and dissolving adds several concentrated hydrochloric acids to regulate pH to 7.2, then adds water and is settled to 100mL.0.5 M EDTA (pH8.0): add 18.61g Na in 80mL water ₂EDTA2H ₂O transfers pH to 8.0(approximately to need the solid NaOH of 2g left and right with NaOH), be settled to 100mL after dissolving.The GUS zyme extract: 0.1M phosphoric acid buffer (pH7.0) is got 50mL; 10% SDS gets 1mL; 0.5M EDTA (pH8.0) gets 2mL; Triton X-100 gets 100 μ L; Beta-mercaptoethanol 100 μ L; Water is settled to 100mL.MUG substrate: claim 8.8mg MUG, be dissolved in 10mL GUS zyme extract, be mixed with the working concentration of 2mmol/L.Reaction terminating liquid (0.2 mol/L Na ₂CO ₃): claim 2.12g Na ₂CO ₃, water is settled to 100mL.Coomassie brilliant blue G250 solution: Coomassie brilliant blue G250 10mg, 95% ethanol 5m1, H ₃PO ₄10mL is settled to l00mL, filters rear 4 ℃ of preservations.1mg/mL BSA:20mg BSA is settled to 20mL with the GUS Extraction buffer.

1. the extraction of plant total protein

Get fresh plant tissue 100mg left and right, with the biomaterial IQF, then adopt the mode of liquid nitrogen grinding to grind tissue with liquid nitrogen in mortar.If do not grind immediately, the plant tissue that can first liquid nitrogen freezing be processed is stored in-80 ℃ of refrigerators.Forward in the Ep pipe grinding broken tissue, and add immediately the GUS Extraction buffer of 1mL, fully mixing.12,000rpm, 4 ℃ of centrifugal 5min go to another clean Ep pipe with supernatant, place stand-by on ice.

2. the mensuration of protein concentration

Get 7 Ep pipes, add respectively the BSA reference liquid of 0 μ L, 2 μ L, 4 μ L, 8 μ L, 12 μ L, 16 μ L, 20 μ L, water is mended to equal volume 20 μ L.The Coomassie brilliant blue G250 solution that adds 980 μ L, fully mixing, standing 5min on ice.Measure the absorption value at 595nm place with ultraviolet spectrophotometer.(mg/mL) does typical curve to absorption value A595 with protein concentration.Get testing protein sample 10 μ L, add 10 μ L water, add the Coomassie brilliant blue G250 solution of 980 μ L, abundant mixing, standing 5min, with the absorption value at ultraviolet spectrophotometer mensuration 595nm place, calculate the concentration of protein sample on ice.

3. the quantitative assay of GUS expression level

Get 100 μ L albumen supernatants, add in the GUS Extraction buffer of 37 ℃ of preheatings of 400 μ L, then add 500 μ L MUG substrates, 37 ℃ of temperature are bathed.Get respectively mixed reactant 200 μ L at 0min, 15min, 30min, 45min and 60min and join 800 μ L reaction terminating liquids, room temperature keeps in Dark Place.Under excitation wavelength 365nm, emission wavelength 455nm, measure the fluorescence intensity level of different time points with spectrophotofluorometer during slit 10nm.With fluorescence intensity level, the reaction times is made curve, the fluorescence intensity of obtaining the unit time changes.Fluorescence intensity with the unit time changes divided by the protein content of participating in reaction, and the fluorescence intensity of obtaining the albumen unit time of unit mass changes.

Fig. 4 and Fig. 5 are respectively under different tissues and different inductor effect the active relative value (multiple) with contrast tobacco (turning the pBI121 empty carrier) of GUS in transgene tobacco.Fig. 4 shows that the ProPDR1 promoter expression has obvious tissue specificity, and its activity in root is the highest, and ginseng is the vitals of ginsenoside accumulation.Fig. 5 result shows that the ProPDR1 promotor is subjected to Whitfield's ointment (SA), Plant hormones regulators,gibberellins (GA) and ginsenoside (GS, inducing ginsenosides), result show that the responsing reaction of ProPDR1 startup is relevant with the TCCACCT-motif cis-acting elements with the TCA-element on it.This promotor is subjected to inducing of ginsenoside, shows that it participates in the regulation and control of ginsenoside accumulation.

Claims (9)

1. the PDR transporter gene promotor of ginsenoside accumulation, is characterized in that, the DNA sequence dna of described promotor is as shown in SEQ NO.1, or the DNA sequence dna that has 99% above homology with SEQ ID NO.1.

2. the preparation method of promotor according to claim 1 is characterized in that comprising the following steps successively: (1) extracts the ginseng genome DNA, take the total DNA of ginseng as template, builds four promoter libraries: DraThe I library, EcoR V library, PvuThe II library and StuThe I library; (2) respectively to build DraThe I library, EcoR V library, PvuThe II library and StuThe I library is template, according to ginseng PgPDR5 ' terminal sequence design primer of 1 gene carries out pcr amplification; (3) glue reclaims the PCR product, and this product namely gets promotor ProPDR1 of the present invention.

3. method according to claim 2 is characterized in that: in described step (2) according to ginseng PgPDRThe primer of 5 ' terminal sequence design of 1 gene is a primer pair: outside primer and nested primer, outside primer are as shown in SEQ ID NO.2, and nested primer is as shown in SEQ ID NO.3.

4. contain the recombinant vectors of the described promotor of claim 1, it is characterized in that: described recombinant vectors is pBI121-ProPDR1::GUS, and its hollow carrier is the pBI121 carrier, connects gus reporter gene in the downstream of ProPDR1 promotor.

5. the construction process of recombinant vectors as claimed in claim 4 is characterized in that being followed successively by following steps: (1) is according to corresponding the comprising of ProPDR1 promoter sequence design fragment HinD III/ BamThe Auele Specific Primer of HI restriction enzyme site is used respectively Bam HI and Nco I double digestion pBI121 and promotor ProPDR1, reclaims pBI121 carrier and ProPDR1 promoter fragment; (2) two fragments connected and transform DH5 α; (3) identify by kantlex screening, PCR and Bam HI/Nco I double digestion, namely obtain described recombinant vectors pBI121-ProPDR1::GUS.

6. method according to claim 5 is characterized in that: step (1) is according to corresponding the comprising of ProPDR1 promoter sequence design fragment HinD III/ BamThe Auele Specific Primer of HI restriction enzyme site is as shown in SEQ ID NO.4 and SEQ ID NO.5.

7. according to claim 5 or 6 described methods is characterized in that: in step (3), PCR identifies that designed primer is as shown in SEQ ID NO.6 and SEQ ID NO.7.

8. the application of promotor ProPDR1 as claimed in claim 1 in regulation and control ginsenoside transhipment and accumulation or ginseng breeding.

9. the application of recombinant vectors pBI121-ProPDR1::GUS as claimed in claim 4 in regulation and control ginsenoside transhipment and accumulation or ginseng breeding.

Images