KR101700102B1 - CuCRTISO promoter from Citrus unshiu and uses thereof - Google Patents

Abstract

The present invention relates to a citrus-derived CuCRTISO promoter and its use. Specifically, a promoter region of CuCRTISO, a carotenoid isomerase gene from citrus fruits, is transformed into a transformant line (pCiso-Prom1) containing the entire promoter region and a promoter region (PCiso-Prom2 and pCiso-Prom3), and the three promoter regions of the truncated promoter region were ligated to the GUS gene, which is a marker gene, to transform into Arabidopsis thaliana to produce hormones and abiotic As a result of confirming the expression of GUS by treating the stress, it was confirmed that the expression of CuCRTISO promoter was regulated in developmental stage and tissue-specific manner and was regulated in response to heat treatment, low temperature treatment and ethylene treatment. Therefore, using the promoter of the present invention Hormone and abiotic stress treatment to regulate the expression of the gene of interest It will be available.

Description

Citrus-derived CCRTPISO promoter and uses thereof {CuCRTISO promoter from Citrus unshiu and uses thereof}

The present invention relates to citrus-derived CuCRTISO promoters and uses thereof.

Carotenoids are the second most abundant pigment found in plants, algae, fungi and bacteria. They are yellow, orange and red in fruits, vegetables and flowers. In addition, carotenoids collect light against excessive light, perform essential functions in photoprotection, and play essential functions in the production of apocarotenoid hormones such as ABA and strigolactone. Carotenoid biosynthesis is regulated throughout the life cycle of plants in response to developmental stages and environmental stimuli. Carotenoid isomerase (CRTISO) catalyzes the isomerization of prolycopene to the all-trans-lycopene substrate of the lycopene cyclase. CRTISO was first identified in tangerine tomato and Arabidopsis ccr2 mutants. These plant mutants accumulated cis-carotene in the variegated body of fruit and the white body of seedlings grown in dark conditions. CRTISO expression requires chromatin-modified histone methyltransferase during seedling development, and the promoters of these two genes caused the expression of the same tissue-specific marker gene in the hypocotyl and apical tissues, leaf veins, and pollen (non-patent literature). One).

In transgenic plants, many promoters have been reported to induce the expression of hormones, temperature changes, spatial, temporal, and developmental stages of external genes. Using ABA and dehydration-responsive promoters, we can understand how plants respond to ABA, abiotic stress, and water deprivation. The thermal shock promoter was identified by high temperature stress experiments. Phloem-specific promoters were used to understand resistance to phloem-specific infectious agents and pests. RA8, a drug-specific rice promoter, was identified, and the RTS promoter induced drug-specific gene expression in monocotyledons and dicotyledons. Orange sucrose synthase-1 promoter induces the expression of the GUS gene in response to phloem wounds in transgenic Arabidopsis and tobacco plants.

The PMT45L promoter of Sasuma mandarin showed higher expression level in the granulosa than in leaves, and induces its expression in the septum and turbidity of the Jangak family. Kim et al. (Non-Patent Literature 2) showed that the LeaP600 promoter caused GUS expression in mature Jangakaceae in transgenic Arabidopsis disorder. In lemons and limes, the Cl111 promoter showed specific expression for flesh and flowers.

Studies on the promoters of genes in the carotenoid biosynthetic pathway have also been conducted. The phytoene synthase promoter of Arabidopsis thaliana was activated in both photosynthetic and non-photosynthetic tissues. Tomato phytoene desaturase promoter showed high GUS expression patterns in petals, drugs, and mature fruits. The carotenoid cleavage dioxygenase 7 (AtCcd7) promoter of Arabidopsis thaliana showed vascular bundle-specific expression in all plant organs including leaves, stems, roots, flowers, and seeds. The carotenoid cleavage dioxygenase 4a-5 (CmCCD4a-5) promoter of Chrysanthemum morifolium exhibited high drug/pollin-specific expression patterns.

We recently isolated cDNA (CuCRTISO) encoding carotenoid isomerase from Wenzhou citrus. Using this, the CuCRTISO promoter region containing several important cis-acting elements responding to plant hormones and stress was cloned. A vector was prepared in which this promoter was fused with the GUS gene, and transformed Arabidopsis thaliana was generated. Our results show that the CuCRTISO promoter induces the expression of tissue-specific and developmental stage-specific GUS, and exhibits characteristics in response to plant hormones and environmental stress. In addition, we suggested that there is an unreported repressor element(s) in the CuCRTISO promoter.

1. Cazzonelli CI, Roberts AC, Carmody ME, Pogson BJ. 2010. Transcriptional control of SET DOMAIN GROUP8 and CAROTENOID ISOMERASE during Arabidopsis development. Molecular Plant 3, 174-191. 2. Kim IJ, Lee J, Han JA, Kim CS, Hur Y. 2011. Citrus Lea promoter confers fruit-preferential and stress-inducible gene expression in Arabidopsis. Canadian Journal of Plant Science 91, 459-466.

An object of the present invention is to provide a recombinant plant expression vector comprising a promoter whose expression is regulated by high temperature stress consisting of the nucleotide sequence of SEQ ID NO: 1.

Another object of the present invention is to provide a plant transformed with the recombinant plant expression vector and the seed of the plant accordingly.

Another object of the present invention is to provide a method for controlling the expression of a target gene by subjecting the transformed plant to high temperature stress by recombining the target gene in the recombinant plant expression vector.

Another object of the present pathogenesis is to provide a recombinant plant expression vector comprising a plant hormone consisting of the nucleotide sequence of SEQ ID NO: 3 and a promoter whose expression is regulated by cold stress.

Another object of the present invention is to provide a plant transformed with the recombinant plant expression vector and the seed of the plant accordingly.

Another object of the present invention is to provide a method for controlling the expression of a target gene by treating plant hormones and low temperature stress in a transformed plant by recombining the target gene in the recombinant plant expression vector.

In order to solve the above object, the present invention provides a recombinant plant expression vector comprising a promoter whose expression is regulated by high temperature stress consisting of the nucleotide sequence of SEQ ID NO: 1.

In addition, the present invention provides a plant transformed with the recombinant plant expression vector and a seed of the plant accordingly.

In addition, the present invention

1) recombining the target gene into the recombinant plant expression vector;

2) transforming the recombinant plant expression vector into a plant;

3) It provides a method of controlling the expression of a target gene by treating the transformed plant with high temperature stress.

In addition, the present invention provides a recombinant plant expression vector comprising a plant hormone consisting of the nucleotide sequence of SEQ ID NO: 3 and a promoter whose expression is regulated by low temperature stress.

In addition, the present invention provides a plant transformed with the recombinant plant expression vector and a seed of the plant accordingly.

In addition, the present invention

1) recombining the target gene in the recombinant plant expression vector according to the above;

2) transforming the recombinant plant expression vector into a plant;

3) It provides a method of controlling the expression of a target gene by treating the transformed plant with plant hormones and low temperature stress.

Since the expression of the target gene can be regulated by the treatment of hormones and abiotic stress using the citrus-derived CuCRTISO promoter of the present invention, it will be useful to control the expression of the target gene.

1 is a diagram showing a map of the CuCRTISO promoter region inferred by the PlantCARE program: (A) Common cis-acting regulatory elements: Circadian, biological cycle regulatory element; MBS, MYB binding site acting on induction of drying; HSE, heat stress response element; ABRE, abcisic acid reaction solution; LTR, low temperature reaction element; Box-W1, fungal inducer response factor; ERE, ethylene reaction element; ARE, anaerobic reaction element. The TATA box is located at -27 bp; The CAAT box is located at -66 bp. Position +1 represents the first nucleotide of the longest sequence separated by 5'RACE. (B) Recombinant construct used in the present invention. All recombinants were constructed based on pCambia2300. pCiso-Prom1 contains the CuCRTISO2 5'UTR promoter region fused to the full length GUS. The pCiso-Prom2 and pCiso-Prom3 constructs contain 5'promoter deletions in the -1427 bp and -861 bp upper regions, respectively, fused with GUS.
2 is a diagram showing the sequence of the CuCRTISO promoter region and the sequence of the deduced cis-acting regulatory element: Circadian, a biological cycle control element; MBS, MYB binding site acting on induction of drying; HSE, heat stress response element; ABRE, abcisic acid reaction element; LTR, low temperature reaction element t; Box-W1, fungal inducer response element; ERE, ethylene reaction element; ARE, anaerobic reaction element. The TATA box is located at -27 bp; The CAAT box is located at -66 bp. Position +1 represents the first nucleotide of the furthest sequence separated by 5'RACE.
3 is a diagram showing a transgenic Arabidopsis plant determined to have a single copy of CuCRTISO-promoter-GUS by QD-PCR. The ratio of GUS to control (DNA polymerase lambda subunit; Pol λ) genes was obtained using a gel image (n=3, mean ± standard deviation). The following transgenic lines were homozygous and had a single copy of CuCRTISO-promoter-GUS: pCiso-Prom1, lines 1-5; pCiso-Prom2, line 1-4; pCiso-Prom3, line 1-4. The upper band represents the DNA polymerase lambda subunit.
4 is a diagram showing GUS staining and GUS expression in transformed CuCRTISO-promoter-GUS lines and wild-type plants (Col-O) in different stages of development: (AG) germinated seeds, seedlings 5 days after germination , 10 days after germination and seedlings, 15 days after germination seedlings, young leaves, mature leaves and flowers GUS staining. (H) RT-PCR analysis of GUS gene expression in cotyledons, hypocotyl, stem, root, young leaves, mature leaves, and flowers. AtACT1 was used as a control. The GUS staining patterns of three additional transgenic lines are shown in Appendix Figure S2.
5 is a diagram showing the results of confirming GUS staining of individual transformed lines expressing the CuCRTISO-promoter-GUS construct: (A) seeds. (B) Seedlings 5 days after germination. (C) Seedlings 10 days after germination. (D) Seedlings 15 days after germination. (E) Young leaves. (F) Mature leaves. (G) Flowers. Each tissue expressing different promoter constructs was incubated in a staining solution at 37°C for 24 hours. Individual transformation lines are indicated by numbers.
6 is a diagram showing the results of confirming GUS staining and GUS expression in response to hormones and environmental stress in the transformed CuCRTISO-promoter-GUS line: (A) Samples were treated with ethylene, ABA, dry, heat, low temperature Afterwards, it was stained for GUS. Control means a sample before environmental stress is treated. Wfp represents samples on filter paper moistened with hormone-free MS medium. (B) RT-PCR was performed using the same sample as the sample used for GUS expression. AtACT1 was used as a control.
7 is a diagram showing the results of a time-dependent reaction of CuCRTISO promoter activity in transformed Arabidopsis seedlings by high temperature and low temperature treatment: (A) Transformant seedlings with each promoter recombinant were treated at 37°C Conditions were exposed for 2, 4, 8, 16, and 32 hours, and GUS gene expression was investigated by RT-PCR analysis. AtACT1 gene was used as a control. (B) Transformant seedlings containing each recombinant construct were exposed for 2, 4, 6, 12, 24, 48 hours in a dark condition at 4°C, and GUS expression was investigated by RT-PCR analysis.

Hereinafter, the present invention will be described in detail.

The present invention provides a recombinant plant expression vector comprising a promoter whose expression is regulated by high temperature stress consisting of the nucleotide sequence of SEQ ID NO: 1.

The promoter is preferably derived from citrus fruits (Citrus unshiu), and specifically, is isolated from the Wenzhou citrus fruits in the CuCRTISO promoter region, which is a carotenoid isomerase gene.

The vector may be, for example, the pCiso-Prom1 vector illustrated in FIG. 1, but is not limited thereto.

It is preferable that it is prepared by operably linking a target gene encoding a target protein to a downstream of the promoter, and in a specific embodiment of the present invention, a reporter gene (GUS) is connected to the promoter of the present invention, but is limited thereto. It doesn't work.

The term “recombinant” refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a peptide, a heterologous peptide, or a protein encoded by a heterologous nucleic acid. Recombinant cells may express genes or gene segments that are not found in the natural form of the cell in either a sense or antisense form.

The term "vector" is used to refer to a DNA fragment(s), a nucleic acid molecule, which is delivered into a cell. Vectors replicate DNA and can be reproduced independently in host cells. The term “carrier” is often used interchangeably with “vector”. The term "expression vector" refers to a recombinant DNA molecule comprising a coding sequence of interest and an appropriate nucleic acid sequence essential for expressing the coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals usable in eukaryotic cells are known.

A preferred example of a plant expression vector is a Ti-plasmid vector capable of transferring a part of itself, the so-called T-region, to plant cells when present in a suitable host such as Agrobacterium tumerfaciens. Other types of Ti-plasmid vectors (see EP 0 116 718 B1) are currently used to transfer hybrid DNA sequences into plant cells, or protoplasts from which new plants can be produced that properly insert hybrid DNA into the plant's genome. have. A particularly preferred form of Ti-plasmid vector is a so-called binary vector as claimed in EP 0 120 516 B1 and in US Pat. No. 4,940,838. Other suitable vectors that can be used to introduce the DNA according to the invention into a plant host are double-stranded plant viruses (e.g., CaMV) and viral vectors such as those that can be derived from single-stranded viruses, gemini viruses, etc. For example, it can be selected from incomplete plant viral vectors. The use of such vectors can be advantageous especially when it is difficult to properly transform the plant host.

The expression vector will preferably contain one or more selectable markers. The marker is typically a nucleic acid sequence having properties that can be selected by a chemical method, and all genes capable of distinguishing a transformed cell from a non-transgenic cell correspond to this. Examples include herbicide resistance genes such as glyphosate or phosphinotricin, and antibiotics such as Kanamycin, G418, Bleomycin, hygromycin, and chloramphenicol. There is a resistance gene, but is not limited thereto.

In the plant expression vector according to an embodiment of the present invention, the promoter may be CaMV 35S, actin, ubiquitin, pEMU, MAS, or histone promoter, but is not limited thereto. The term "promoter" refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A “plant promoter” is a promoter capable of initiating transcription in a plant cell. A “constitutive promoter” is a promoter that is active under most environmental conditions and developmental states or cell differentiation. Since the selection of transformants can be made by various tissues at various stages, constitutive promoters may be preferred in the present invention. Thus, constitutive promoters do not limit the possibility of selection.

The terminator may be a conventional terminator, examples of which include nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens (agrobacterium tumefaciens) octopine (Octopine) There is a gene terminator, etc., but is not limited thereto. Regarding the need for terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of a terminator is highly desirable in the context of the present invention.

In the recombinant plant expression vector according to an embodiment of the present invention, the plant expression vector may be prepared by operably linking a target gene encoding a target protein to a downstream of a promoter of the present invention. In the present invention, "operably linked" refers to a component of an expression cassette that functions as a unit for expressing a heterologous protein. For example, a promoter operably linked to a heterologous DNA encoding a protein promotes the production of a functional mRNA corresponding to the heterologous DNA.

The target protein may be any type of protein, for example, a protein capable of accumulating a large amount of nutrients capable of improving the health of animals including humans or having medical utility such as enzymes, hormones, antibodies, cytokines, etc. However, it is not limited thereto. Examples of the protein of interest include interleukin, interferon, platelet-derived growth factor, hemoglobin, elastin, collagen, insulin, fibroblast growth factor, human growth factor, human serum albumin, erythropoietin, and the like.

In addition, the present invention provides a method for producing a target protein in a constitutive expression by transforming a plant with the recombinant plant expression vector. In addition, it provides a target protein produced by the above production method. The produced protein of interest is as described above.

Plant transformation refers to any method of transferring DNA into a plant. Such transformation methods do not necessarily have periods of regeneration and/or tissue culture. Transformation of plant species is now common for plant species including both monocotyledons as well as dicotyledons. In principle, any transformation method can be used to introduce hybrid DNA according to the present invention into suitable progenitor cells. The method is the calcium/polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373), protoplasts. Of electroporation (Shillito RD et al., 1985 Bio/Technol. 3, 1099-1102), microinjection with plant urea (Crossway A. et al., 1986, Mol. Gen. Genet. 202, 179-185) ), (DNA or RNA-coated) particle bombardment method of various plant elements (Klein TM et al., 1987, Nature 327, 70), Agrobacterium tumerfasi by transformation of plant infiltration or mature pollen or vesicle In Ens-mediated gene transfer, it can be appropriately selected from (incomplete) virus-induced infection (EP 0 301 316) and the like. A preferred method according to the invention comprises Agrobacterium mediated DNA delivery. Particularly preferred is the use of so-called binary vector technology as described in EP A 120 516 and U.S. Patent No. 4,940,838.

The "plant cell" used for plant transformation may be any plant cell. Plant cells may be cultured cells, cultured tissues, cultured organs or whole plants, preferably cultured cells, cultured tissues or cultured organs and more preferably any form of cultured cells.

"Plant tissue" refers to tissues of differentiated or undifferentiated plants, such as, but not limited to, roots, stems, leaves, pollen, seeds, cancer tissues, and various types of cells used in culture, ie single cells, protoplasts. (protoplast), shoots and callus tissues. The plant tissue may be in planta, organ culture, tissue culture, or cell culture.

In addition, the present invention provides a plant transformed with the recombinant plant expression vector.

In addition, the present invention provides the seed of the plant according to the above.

In addition, the present invention

1) recombining the target gene into the recombinant plant expression vector;

2) transforming the recombinant plant expression vector into a plant;

3) It provides a method of controlling the expression of a target gene by treating the transformed plant with high temperature stress.

In a specific embodiment of the present invention, it was confirmed that the GUS gene sweats as a result of processing high temperature stress by linking a marker gene GUS (b-glucuronidase), which is a marker gene, to the pCiso-Prom1 promoter consisting of SEQ ID NO: 1. This confirmed the presence of a heat-stress responsive element (HSE) in the pCiso-Prom1 promoter region.

In addition, the present invention provides a recombinant plant expression vector comprising a plant hormone consisting of the nucleotide sequence of SEQ ID NO: 3 and a promoter whose expression is regulated by low temperature stress.

The promoter is preferably derived from citrus fruits (Citrus unshiu), and specifically, is isolated from the Wenzhou citrus fruits in the CuCRTISO promoter region, which is a carotenoid isomerase gene.

The vector may be, for example, the pCiso-Prom3 vector described in FIG. 1, but is not limited thereto.

The plant hormone is preferably ethylene, but is not limited thereto.

It is preferable that it is prepared by operably linking a target gene encoding a target protein to a downstream of the promoter, and in a specific embodiment of the present invention, a reporter gene (GUS) is connected to the promoter of the present invention, but is limited thereto. It doesn't work.

In addition, the present invention provides a plant transformed with a recombinant plant expression vector.

In addition, the present invention provides the seed of the plant according to the above.

In addition, the present invention

1) recombining the target gene in the recombinant plant expression vector according to the above;

2) transforming the recombinant plant expression vector into a plant;

3) It provides a method of controlling the expression of a target gene by treating the transformed plant with plant hormones and low temperature stress.

The plant hormone is preferably ethylene, but is not limited thereto.

In a specific embodiment of the present invention, by linking a marker gene GUS (β-glucuronidase) to the pCiso-Prom3 promoter consisting of SEQ ID NO: 1 and transforming it into Arabidopsis thaliana to treat plant hormones and low temperature stress, the GUS gene sweating. It was confirmed that even though the pCiso-Prom3 promoter region contains an ethylene reaction element and a low temperature reaction element, the expression of the GUS gene is induced only in the pCiso-Prom3 line. Presented what exists.

Hereinafter, examples will be described in detail to aid understanding of the present invention. However, the following examples are merely illustrative of the contents of the present invention, and the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to more completely describe the present invention to those of ordinary skill in the art.

< Example 1> From Wenzhou Citrus CuCRTISO Cloning of the 5'upstream region of the gene

Wenzhou tangerines, which were used as experimental materials, were provided by the Institute of Subtropical Agriculture and Life Sciences at Jeju National University. Genomic DNA was extracted from the Wenzhou citrus leaves using the CTAB method (Cheng et al. (2003)). CuCRTISO cDNA of the entire nucleotide sequence including the 5'untranslated site and the 3'untranslated site was isolated from Onju citrus, and the base sequence was determined and registered in GenBank (GenBank accession no. KJ751508). Then, 5'untranslated fragments from the nucleotide sequence information were obtained using DNA Walking SpeedUp Kit (Seegene) and LA PCR in vitro cloning kit (Takara) according to the manufacturer's instructions. The 5'fragment was ligated to Promega's pGEM-T easy vector, and then the base sequence was successively determined.

As a result, the upper region of the CuCRTISO gene (from the start codon to the upper region of 2501 base pair was obtained. The 5'fragment was a CRT-2Protgg-F primer (SEQ ID NO: 4) containing the 5'end of CuCRTISO-Prom1) and the CuCRTISO gene. It was possible to obtain by PCR using a 2proORFttg-R primer (SEQ ID NO: 5) containing from -17 to -1 upper region from the start codon, and specific primers are shown in Table 1 below.

Primer name Sequence number Primer sequence (5'-3') CRT-2Protgg-F 4 TGGTCGAGTGTATTATCCAGA 2proORFttg-R 5 TTTTGGCTTTGGCTTTG

<Example 2> Cloning and nucleotide sequence analysis of the CuCRTISO promoter region

In Example 1, CuCRTISO cDNA (GenBank accession no. KJ751508) was cleaned from Onju citrus and the base sequence was determined. The transcription initiation site performed 5'RACE, and through this, it was found that it is located 176 bp above the translation initiation codon, ATG. The 2,325-bp promoter region (Fig. 1A and Fig. 2; GenBank accession no. KJ751507) was isolated using the information of the CuCRTISO sequence. The analysis was performed to estimate cis-acting regulatory elements from the 2,325-bp promoter region of the CuCRTISO gene and the 5'UTR (untranslated region) of 176-bp using the PlantCARE program. Circadian-circadian (Rawat et al. 2005), dry-inducing MYB-binding site (MBS) in the CuCRTISO promoter region (Baranowskij et al. 1994; Gubler et al. 1999; Sablowski et al. 1994) ), ABA response cis-acting factor (ABRE) (Nakashima et al. 2006; Simpson et al. 2003; Skriver and Mundy 1990), anaerobic induction cis-acting regulator (ARE), fungal inducer response factor (Box-W1 ), ethylene response cis-acting factor (ERE) (Itzhaki et al. 1994; Rawat et al. 2005), heat stress response cis-acting control factor (HSE), low temperature response cis-acting factor (LTR) (Dunn et al. 1998), and several environmental stress response and plant hormone response cis-acting regulators were estimated, and the estimated TATA and CAAT boxes were located at -27 bp and -66 bp from the transcription initiation site, respectively.

<Example 3> Preparation of Transgenic Arabidopsis thaliana of GUS-labeled gene fusion recombinant DNA

<3-1> CuCRTISO Promoter-GUS fusion recombinant DNA production

In Example 2, it was confirmed that the 2,501-bp 5'upper region (Prom1) (SEQ ID NO: 1) of CuCRTISO was a full-length promoter of the present invention, and in order to measure the promoter activity of the upper region, three types of promoters -GUS fusion recombinant DNA was prepared.

Specifically, a full-length 2,501-bp promoter Prom 1 (SEQ ID NO: 1), a fragment of 1,603-bp in length, Prom2 (SEQ ID NO: 2), and a 1,037-bp fragment in length, Prom 3 (SEQ ID NO: Number 3) was amplified through PCR using the primer combinations shown in Table 2 below. Prom1 (SEQ ID NO: 1) used Pst12Protgg-L (SEQ ID NO: 6) and BamHF2proORFttg-R (SEQ ID NO: 7), and Prom2 (SEQ ID NO: 2) used Pst12Protta-L (SEQ ID NO: 8) and BamHF2proORFttg-R (SEQ ID NO: 7) was used, and Pst12Protta-ML (SEQ ID NO: 9) and BamHF2proORFttg-R (SEQ ID NO: 7) were used as Prom3 (SEQ ID NO: 3). The PCR product was cloned using pGEM-T easy vector (promega), and then linked to the BamHI and PstI restriction sites of the pCAMBIA2300-GUS vector, and a promoter was linked to the GUS 5'end. These three types of recombinant DNA were named pCiso-Prom1, pCiso-Prom2, and pCiso-Prom3, and each of CuCRTISO-promoter-GUS contained the upper region of the relative position as follows, and is shown in FIG. 1B.

Primer name Sequence number Primer sequence (5'-3') PstI2Prottg-L 6 CATCTGCAGTGGTCGAGTGTATTATCCAGA BamHF2proORFttg-R 7 AACGGATCCTTTTGGCTTTGGCTTTG PstI2Protta-L 8 CATCTGCAGTTATTATTAAGGCTGTTGAATTAAC PstI2Protta-ML 9 CATCTGCAGGAATTCCACACCAAAGAGTG

<3-2> Production and selection of transformed Arabidopsis thaliana of GUS-labeled gene fusion recombinant DNA

The recombinant vector prepared in Example 3-1 was transformed into Agrobacterium tumefaciens strain LBA4404 using a freeze-thaw method (Hofgen and Willmitzer 1988). The transformed Arabidopsis thaliana was used to transform the Arabidopsis (Col-0) by means of fire acupuncture. Transformed Arabidopsis thaliana was selected for 2-4 weeks in Murashige-Skoog (MS) plate medium supplemented with 1.5% sugar, 0.8% micropropagation-grade plant agar (Maxim Bio), and 50 μg/mL kanamycin. The selected plants were grown in an incubator at 21° C., light conditions for 16 hours, and dark conditions for 8 hours. Then, the quantitative dual-target PCR (Qd-PCR) method proposed by Kihara et al. (2006) targeting each recombinant T2 plant in order to obtain a homozygous transformation line with a single copy of CuCRTISO-promoter-GUS. Was performed.

Specifically, a genomic DNA sample (20 ng) was used as a template in a 20 μl PCR reaction in individual PCR tubes. The PCR reaction mixture consisted of 1 unit of Taq DNA polymerase (BIONEER), 250 μM dNTPs, 10 mM Tris-HCl (pH 9.0), 30 mM KCl, 1.5 mM MgCl2, 0.5 μM GUS gene amplification 2 kinds of primers (Gus144-F;TGCTGTCGGCTTTAACCTCTC sequence). No. 10) and Gus144-R; TTTTGTCACGCGCTATCAGC SEQ ID No. 11), a known single copy gene [DNA polymerase lambda subunit; Pol λ NM_100926) of two primers (Poll-F;GGTGTACAAACCACCCGATTT SEQ ID NO: 12 and Poll-R; GTGTGCGATGTCCTTTCTCAT SEQ ID NO: 13] PCR was performed at 94°C for 2 minutes, followed by 30 seconds at 94°C and 30 seconds. For 30 seconds at 60°C for 20 seconds, 68°C for 20 seconds was repeated 22 times, and the last elongation was performed at 68°C for 1 minute. The reaction product was analyzed by electrophoresis, and the intensity of each band was determined by NIH Image software (ImageJ ) Was used.

As a result, a total of 13 homozygous T2 lines such as a single copy of pCiso-Prom1 (5 lines), pCiso-Prom2 (4 lines) and pCiso-Prom3 (4 lines) were obtained (Fig. 3).

<Experimental Example 1> Development-specific and tissue-specific activity analysis of CuCRTISO promoter

<1-1> CuCRTISO Analysis of expression specificity of promoters by developmental stage

The expression specificity of each developmental stage controlled by each promoter in the transformed plant in which the respective promoters of pCiso-Prom1, pCiso-Prom2, and pCiso-Prom3 obtained in Example 3-2 were expressed was confirmed through the expression of GUS.

Specifically, the Arabidopsis transformants expressing pCiso-Prom1, pCiso-Prom2 and pCiso-Prom3 at different stages of development were used for histological staining to investigate GUS activity.

As a result, no GUS staining was observed in all transformed and germinating seeds of wild-type crabs (Fig. 4A). On the other hand, GUS staining was observed in cotyledons and roots 5 days after germination (DAG) of all transgenic seedling plants. GUS staining of the roots was weaker than that of cotyledons (Fig. 4B). In seedling plants 10 days after germination, GUS staining was observed only in cotyledons, and staining was slightly weaker than 5 days after germination. 15 days after germination, GUS staining was not observed (Figs. 4C and 4D). In the case of young and mature leaves, GUS staining was observed on the leaves at the maturation of all transgenic lines. It was not observed in young leaves (Figs. 4E and 4F). In the case of flower tissue, GUS staining was observed in the medicine and pistil hair (Fig. 4G). These results indicate that the CuCRTISO promoter exhibits development-specific activity, and suggests that the shortest promoter (pCiso-Prom3) is sufficient to activate the expression of genes for each developmental stage. It was confirmed that the three additional transforming lines for each recombinant showed similar GUS staining patterns (FIG. 5).

<1-2> CuCRTISO Tissue-specific activity analysis of promoter

In order to investigate the tissue specificity of the CuCRTISO promoter, RT-PCR for the GUS gene was performed on different tissues of the transformed Arabidopsis thaliana obtained in Example 3-2 expressing three different CuCRTISO-promoter-GUS fusion recombinants. Fusions were performed. AtACT1 gene was used as a control.

As a result, GUS expression was detected in cotyledons, mature leaves, and flowers of seedlings 10 days after germination of the three transgenic lines. However, it was not detected in the hypocotyl, stem, and root, and showed tissue-specific expression of the CuCRTISO promoter (Fig. 4H).

<Experimental Example 2> Functional analysis of the cis-acting element of the CuCRTISO promoter

<2-1> Hormones Department Abiotic How to deal with stress

Transformant Arabidopsis young plants (seedlings) in a sealed plastic plant container were treated with ethylene (Phytohealth; SPL Life Science; Cat. No. 310120) (Zarei et al., 2011). Ethylene was injected into the culture vessel and the final concentration was diluted to 10 ppm. After 2 weeks, the seedlings were exposed to 10 ppm ethylene for 48 hours. After germination in a test tube for abcisic acid (ABA) treatment, two-week-old seedlings were transferred to a filter paper saturated with MS medium containing MS medium containing 100 μM ABA, and cultured for 24 hours under dark conditions at 22°C (Cao et al., 2007; Kim et al., 2011).

In the low-temperature stress treatment, two-week-old seedlings were transferred onto a filter paper saturated with MS medium and incubated at 4° C. for 24 hours under dark conditions.

In the high temperature stress treatment, the two-week-old seedlings were transferred onto a filter paper saturated with MS medium and incubated for 6 hours at 37°C. Dry stress treatment was performed by placing the seedlings on the surface of dry filter paper after 2 weeks, and incubating in an incubator at 22° C. for 6 hours. Seedlings grown on filter paper moistened with MS medium without adding plant hormone were used as a control.

<2-2> Histological staining to investigate GUS activity

Histological staining for GUS activity analysis in the transgenic Arabidopsis lineage was performed by slightly modifying the method by Cho and Cosgrove (2000). Transgenic plants expressing other promoter recombinants were stained with a staining solution [1 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronide, 50 mM NaPO4, 0.5 mM K4Fe(CN)6, 0.5 mM K3Fe. (CN)6, and 0.1% Triton X-100] for 16-24 hours at 37°C. Thereafter, the sample was immersed in 70% ethanol to remove chlorophyll and carotenoids.

<2-3> RT-PCR of GUS gene expression ( Reverse transcriptase - PCR ) analysis

Total RNA of the transgenic Arabidopsis was isolated from AccuZol Total RNA Extraction Solution (BIONEER) according to the manufacturer's instructions. RNA extract was treated with 5 units of DNase I (TaKaRa, Japan) at 37°C for 1 hour and then mixed with the same volume of phenol:chloroform:isoamylalcohol (25:24:1, v/v/v), Centrifugation was performed at 12,000×g at 4° C. for 20 minutes. The supernatant was transferred to a new tube without RNase, and an equal volume of isopropyl alcohol was added. After that, the solution was inverted several times to mix. The sample was centrifuged at 12,000×g at 4° C. for 10 minutes. The precipitate was washed with 80% ethanol and dried. The dry precipitate was dissolved in water treated with DEPC.

Reverse transcriptase-PCR (RT-PCR) using AccuPower RT-PCR PreMix (BIONEER) in a single tube containing all components necessary for cDNA synthesis and RT-PCR to confirm the expression of the GUS gene in transgenic Arabidopsis PCR) was performed. To these reactions, 15 ml of the diluted primer hybridization nucleus and 5 ml of an RNA template (about 1.0 mg) were added to each reaction. The reverse transcription reaction was performed at 42° C. for 60 minutes, followed by treatment at 94° C. for 5 minutes to terminate the reaction. The remaining gene amplification reaction for RT-PCR was carried out through the following circuit. That is, for Taq polymerase activation, treatment at 94℃ for 5 minutes, denaturation at 94℃ for 30 seconds, hybridization at 57℃ for 30 seconds, and extension (polymerization reaction) at 72℃ for 1 minute were repeated 35 times. The last stretching step was performed at 72° C. for 5 minutes. GUS-F (TGTTACGTCCTGTAGAAACCCCAACC; SEQ ID NO: 14) and GUS-R (TCATTGTTTGCCTCCCTGCTGC; SEQ ID NO: 15) primers were used to amplify the GUS specific product. The AtACT1-specific product was amplified using the AtACT1-F (GTATTGTGGGTCGTCCTCGT; SEQ ID NO: 16) and AtACT1-R (TGAACAATCGATGGACCTGA; SEQ ID NO: 17) primers described in Table 1 above as an internal control.

<2-4> CuCRTISO Functional analysis of the cis-acting element of the promoter

The CuCRTISO promoter region had two hormonal response cis-acting elements, ABRE and ERE, three environmental stress response elements, MBS, HSE, and LTR (Fig. 1A). In order to evaluate whether these cis-acting elements function, using two-week-old seedlings of the transformed CuCRTISO-promoter-GUS line were treated with hormones and environmental stress as in Experimental Example 2-1, and Experimental Examples 2-2 and 2 Histological GUS staining and RT-PCR analysis were performed as in -3.

As a result, only pCiso-Prom1 had the ABRE cis-acting element, and this element was deleted in the pCiso-Prom2 and pCiso-Prom3 recombinants (Fig. 1A). However, in any transformed line, GUS staining or expression was not induced by ABA treatment. All promoter recombinants contained ERE cis-acting elements. However, GUS staining and expression were detected only in pCiso-Prom3 recombinant plants (FIGS. 6A and 6B ).

In addition, as a result of examining the expression patterns of low and high temperature stress, only the pCiso-Prom1 line contained heat stress elements. GUS staining and expression were detected only on the leaf surface of transgenic plants expressing the pCiso-Prom1 recombinant cultured at 37°C for 6 hours in dark conditions. However, the staining and expression levels were low. All promoter recombinants contained cold elements. However, GUS staining and expression were induced only when the transformed line expressing the pCiso-Prom3 promoter was cultured in the dark at 4° C. for 24 hours. Only the pCiso-Prom1 recombinant contained the MBS cis-acting element. However, dry stress treatment (treated on dry filter paper at 22° C. for 6 hours) did not induce GUS expression in any transformed line. Also, no GUS staining was observed.

In addition, as a result of investigating the reaction to high temperature and low temperature treatment with time for GUS expression in the transgenic line, the transcription level gradually increased up to 8 hours after heat treatment in the pCiso-Prom1 line. After that, it decreased to 18 hours after treatment. However, heat treatment did not affect the GUS transcript level in pCiso-Prom2 and pCiso-Prom3 lines. In the pCiso-Prom3 line, the level of GUS transcripts increased up to 48 hours after cold stress treatment (Fig. 7).

Through the above results, it was confirmed that the transgenic plant expressing the pCiso-Prom1 fusion recombinant was regulated in response to high temperature stress, and the transgenic plant expressing the pCiso-Prom3 fusion recombinant was regulated in response to ethylene and low temperature stress. I did.

<110> Jeju National University Industry-Academic Cooperation Foundation <120> CuCRTISO promoter from Citrus unshiu and uses thereof <130> P16U19D0773 <160> 17 <170> KopatentIn 2.0 <210> 1 <211> 2501 <212> DNA <213> Citrus unshiu CuCRTISO <400> 1 tggtcgagtg tattatccag attgattttc ttttaaatat ctgccttgtt attaaagaaa 60 cttaaaattg aggttctagt attatttcta tggtaaaaat atagatcaat taacattgca 120 tatatggttg cttgagagtg gttcaggatg tgtttgtgat tgaggttgaa tagccgtagt 180 ttaaaatata caacattaaa gtgtttggta aacactaatt attgtagttt gtaaggtatg 240 ttgatatgat ttttcactta tataataaaa aatctattat attcttaata attttgtcaa 300 aataattatt taaaatttat atttactata tataatcaat ttatatttca tagttacagt 360 ttttttttcc aacaactgta tcttaaaagt tatagtacct caatctcaaa tacaccctca 420 atagttgttg ttgtttgtat atttaatttt aaaaaattcc agcaatgatc tcgatcggag 480 aaattattta agtcgatttg gagcaactcc gatcttagat gctctcgtag ttttagagat 540 attaattcta ttatagatta tcttgcgagt atggatttag agttgagata gttacattat 600 atgagattat ttgcctaata atattttata agtgcatata ttatgataga aaagtcttag 660 gtgctcttca agcacagctc ctttttcact tattatttac tatgcatacg cttcaactaa 720 ttattataat ttgcatatat acgtgtcaaa taatgaatgg ttaaaaagta atattcttga 780 aaactcttgg gatttactaa gtatcatttt atttagttga atctcgttct ctctttattt 840 ttaattcttt tctaataaaa cttatcctac caaattcatt catatattga aatctcagtt 900 attattaagg ctgttgaatt aaccttaacc aaaggttagt tgtatatttg atttggttag 960 gaagtgacaa actgacaatg cagtgactga tttgtgcctc ttttgattac tactcccaca 1020 tatatataaa ggtaggtaat ttagtgatta aactctcatg ctaacctgat acttttgggt 1080 taaatggtgc gcatctctta tttagtaaaa tagttgctat taaacaatac tgcacaatga 1140 cggatggggt atgtttaaat gttgatctac attttgatat ttctgtgtat caacaaggtc 1200 ttgcctgatt tagggtactc ctttttatgt taatagcaaa gttttccttt caaataagaa 1260 gaacaaaagc ttgaaacatg gctgaaacgt agtacaagtg acaaaagtaa attagaatat 1320 attaaggtga tatttggttg ggaggagaga atgggagaga ggaaagtaat tcaaattcta 1380 cttttatttc cattgtttgg ttgtacgaga tatataaaaa tttaagttat attaaaattt 1440 aatattccct ataatgtaga atttgaattc cacaccaaag agtgaaaaat tcaaattcct 1500 cttatgttga aactttcaaa tttgttctcc aatattttaa cttgtttaat gctattaaga 1560 attattattt tattaattta atattataaa taattttata ttaattaaat ttaatgcatg 1620 atttaagaaa tttaataaaa taaataaact tatttattta tttaatatga aaatatataa 1680 atataaatta acttcgccag acccttagac atcaccggaa gctgccgaaa ttttgccgga 1740 aagtcatcgg gcaccgttga ccggtgttga cttatgttga ccgctactgt tgacaggctt 1800 ttatttatat taaattgtat ttaatataaa attatattaa atagtttagt atattaagtt 1860 attttatatt ttatgttaaa tataaatcat gaattatttt agaacttttt gaaattaaaa 1920 agaattggta ttaatattaa attatatttg attacaaata tagaaattta atatttaaga 1980 taaaggataa atttatccaa aaaaaattat aattcctttc cttatcaaat tttatatcaa 2040 accaaacaat gaaatttaat ttcaatattc tcatccactt atttcttctc tttttccctt 2100 cattccactc tttttctttt ctcccctttc ttcaaaccaa gcaccacctt aagacttgca 2160 taatattttc aactcagtat tctgaaaatt ataaaatgaa atatcagttc gagttcactt 2220 tttaaaataa taattaaccg aagccaggta gatacgtccc aatcccatta gcaatgcatt 2280 tggcatggcc cattatttta tagccactga gacaaattcc accgagacct cgaatgaacc 2340 aatgatcata aaatacatcc acttcccctt gaatttgtct ttgtcccaac aaccatggct 2400 tggaatcacc aacggtatgt atcaatgtct gtataaacaa ttcatggact ccataaccga 2460 taaactgtcc atcaaataca tagccaaagc caaagccaaa a 2501 <210> 2 <211> 1603 <212> DNA <213> Citrus unshiu CuCRTISO <400> 2 ttattattaa ggctgttgaa ttaaccttaa ccaaaggtta gttgtatatt tgatttggtt 60 aggaagtgac aaactgacaa tgcagtgact gatttgtgcc tcttttgatt actactccca 120 catatatata aaggtaggta atttagtgat taaactctca tgctaacctg atacttttgg 180 gttaaatggt gcgcatctct tatttagtaa aatagttgct attaaacaat actgcacaat 240 gacggatggg gtatgtttaa atgttgatct acattttgat atttctgtgt atcaacaagg 300 tcttgcctga tttagggtac tcctttttat gttaatagca aagttttcct ttcaaataag 360 aagaacaaaa gcttgaaaca tggctgaaac gtagtacaag tgacaaaagt aaattagaat 420 atattaaggt gatatttggt tgggaggaga gaatgggaga gaggaaagta attcaaattc 480 tacttttatt tccattgttt ggttgtacga gatatataaa aatttaagtt atattaaaat 540 ttaatattcc ctataatgta gaatttgaat tccacaccaa agagtgaaaa attcaaattc 600 ctcttatgtt gaaactttca aatttgttct ccaatatttt aacttgttta atgctattaa 660 gaattattat tttattaatt taatattata aataatttta tattaattaa atttaatgca 720 tgatttaaga aatttaataa aataaataaa cttatttatt tatttaatat gaaaatatat 780 aaatataaat taacttcgcc agacccttag acatcaccgg aagctgccga aattttgccg 840 gaaagtcatc gggcaccgtt gaccggtgtt gacttatgtt gaccgctact gttgacaggc 900 ttttatttat attaaattgt atttaatata aaattatatt aaatagttta gtatattaag 960 ttattttata ttttatgtta aatataaatc atgaattatt ttagaacttt ttgaaattaa 1020 aaagaattgg tattaatatt aaattatatt tgattacaaa tatagaaatt taatatttaa 1080 gataaaggat aaatttatcc aaaaaaaatt ataattcctt tccttatcaa attttatatc 1140 aaaccaaaca atgaaattta atttcaatat tctcatccac ttatttcttc tctttttccc 1200 ttcattccac tctttttctt ttctcccctt tcttcaaacc aagcaccacc ttaagacttg 1260 cataatattt tcaactcagt attctgaaaa ttataaaatg aaatatcagt tcgagttcac 1320 tttttaaaat aataattaac cgaagccagg tagatacgtc ccaatcccat tagcaatgca 1380 tttggcatgg cccattattt tatagccact gagacaaatt ccaccgagac ctcgaatgaa 1440 ccaatgatca taaaatacat ccacttcccc ttgaatttgt ctttgtccca acaaccatgg 1500 cttggaatca ccaacggtat gtatcaatgt ctgtataaac aattcatgga ctccataacc 1560 gataaactgt ccatcaaata catagccaaa gccaaagcca aaa 1603 <210> 3 <211> 1037 <212> DNA <213> Citrus unshiu CuCRTISO <400> 3 gaattccaca ccaaagagtg aaaaattcaa attcctctta tgttgaaact ttcaaatttg 60 ttctccaata ttttaacttg tttaatgcta ttaagaatta ttattttatt aatttaatat 120 tataaataat tttatattaa ttaaatttaa tgcatgattt aagaaattta ataaaataaa 180 taaacttatt tatttattta atatgaaaat atataaatat aaattaactt cgccagaccc 240 ttagacatca ccggaagctg ccgaaatttt gccggaaagt catcgggcac cgttgaccgg 300 tgttgactta tgttgaccgc tactgttgac aggcttttat ttatattaaa ttgtatttaa 360 tataaaatta tattaaatag tttagtatat taagttattt tatattttat gttaaatata 420 aatcatgaat tattttagaa ctttttgaaa ttaaaaagaa ttggtattaa tattaaatta 480 tatttgatta caaatataga aatttaatat ttaagataaa ggataaattt atccaaaaaa 540 aattataatt cctttcctta tcaaatttta tatcaaacca aacaatgaaa tttaatttca 600 atattctcat ccacttattt cttctctttt tcccttcatt ccactctttt tcttttctcc 660 cctttcttca aaccaagcac caccttaaga cttgcataat attttcaact cagtattctg 720 aaaattataa aatgaaatat cagttcgagt tcacttttta aaataataat taaccgaagc 780 caggtagata cgtcccaatc ccattagcaa tgcatttggc atggcccatt attttatagc 840 cactgagaca aattccaccg agacctcgaa tgaaccaatg atcataaaat acatccactt 900 ccccttgaat ttgtctttgt cccaacaacc atggcttgga atcaccaacg gtatgtatca 960 atgtctgtat aaacaattca tggactccat aaccgataaa ctgtccatca aatacatagc 1020 caaagccaaa gccaaaa 1037 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CRT-2Protgg-F <400> 4 tggtcgagtg tattatccag a 21 <210> 5 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> 2proORFttg-R <400> 5 ttttggcttt ggctttg 17 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> PstI2Prottg-L <400> 6 catctgcagt ggtcgagtgt attatccaga 30 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> BamHF2proORFttg-R <400> 7 aacggatcct tttggctttg gctttg 26 <210> 8 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> PstI2Protta-L <400> 8 catctgcagt tattattaag gctgttgaat taac 34 <210> 9 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> PstI2Protta-ML <400> 9 catctgcagg aattccacac caaagagtg 29 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Gus144-F <400> 10 tgctgtcggc tttaacctct c 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Gus144-R <400> 11 ttttgtcacg cgctatcagc 20 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Poll-F <400> 12 ggtgtacaaa ccacccgatt t 21 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Poll-R <400> 13 gtgtgcgatg tcctttctca t 21 <210> 14 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> GUS-F <400> 14 tgttacgtcc tgtagaaacc ccaacc 26 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GUS-R <400> 15 tcattgtttg cctccctgct gc 22 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AtACT1-F <400> 16 gtattgtggg tcgtcctcgt 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AtACT1-R <400> 17 tgaacaatcg atggacctga 20

Claims (9)

A plant hormone comprising the nucleotide sequence of SEQ ID NO: 3, and a promoter whose expression is regulated by cold stress. The recombinant plant expression vector according to claim 1, wherein the promoter is derived from Citrus unshiu. 2. The recombinant plant expression vector according to claim 1, wherein said vector is pCiso-Prom3 shown in Fig. The recombinant plant expression vector according to claim 1, wherein the plant hormone is ethylene. 2. The recombinant plant expression vector according to claim 1, which is operably linked to a gene encoding a target protein downstream of the promoter. A plant transformed with the recombinant plant expression vector of claim 1. A seed of a plant according to claim 6. 1) recombining the target gene into the recombinant plant expression vector according to claim 1;
2) transforming the recombinant plant expression vector into a plant;
3) A method for regulating expression of a target gene by treating plant transformants with plant hormones and cold stress. 9. The method according to claim 8, wherein the plant hormone is ethylene.

Images