KR101119224B1 - Pepper CaPIG14 promotor specifically induced by disease resistance and defence-associated plant hormone response and uses thereof - Google Patents

Abstract

The present invention relates to CaPIG14 ( Capsicum) derived from pepper, which is specifically expressed in response to resistance against non-pathogens or pathogens or treatment of plant defense-related signaling substances. annum pathogen-induced gene 14) A promoter, a recombinant plant expression vector comprising the promoter, a method for producing a target protein using the recombinant plant expression vector, a method for producing a transformed plant using the recombinant plant expression vector, and the method It relates to a transgenic plant produced by.

Pepper, plant defense related signal, CaPIG14 promoter, recombinant plant expression vector, target protein

Description

Pepper CaPIG14 promotor specifically induced by disease resistance and defence-associated plant hormone response and uses of the pepper, specifically induced by disease resistance and defense-related plant hormone responses

The present invention relates to CaPIG14 derived from red pepper specifically induced by disease resistance and defense-related plant hormone responses. The present invention relates to a promoter and its use, and more specifically, a pepper-derived gene CaPIG14 ( Capsicum) that is specifically expressed in resistance to non-pathogens or pathogens or in the treatment of plant defense-related signaling substances. annum pathogen-induced gene 14) A promoter, a recombinant plant expression vector comprising the promoter, a method for producing a target protein using the recombinant plant expression vector, a method for producing a transformed plant using the recombinant plant expression vector, and the method It relates to a transgenic plant produced by.

A promoter is a genome region that is linked to the upper side of a gene, and controls a structural gene linked thereto to be transcribed into mRNA. The promoter is activated by combining various general transcription factors, and generally has base sequences such as TATA box and CAT box that regulate gene expression. Proteins necessary for the basic metabolism of the living body must maintain a constant concentration in the cell, so the promoters linked to these genes are always activated by the action of the general transcription factor. In contrast, proteins that do not play a role in normal life and require function only under special circumstances are linked with an inducible promoter that induces expression of the structural gene. Inducible promoters are activated by the binding of specific transcription factors activated by external stimuli from the development of the organism or from environmental factors from the surroundings.

Promote constant and strong expression in the development of transgenic plants through transformation, for example Cauliflower mosaic virus 35S (CaMV35S) promoter (Odell et al. al ., Nature 313: 810-812, 1985). However, the constant and over-expression of specific genes linked to such promoters often causes side effects such as transgenic plants not germinating or dwarfing due to the toxic effects of a large amount of protein unnecessary for metabolism. . As a representative example, the Arabidopsis overexpressing the environmental stress transcription factor gene DREB1A using the CaMV35S promoter was observed to enhance resistance to low temperature and low moisture conditions, but the growth was inhibited to show dwarfed phenotype, resulting in amino acid proline and It was confirmed that the production of water-soluble sugars increased together (Lie et al., Plant Cell 10: 1391-1406, 1998; Gilmour et al., Plant Physiol. 124: 1854-1865, 2000). These side effects can be minimized by using an inducible promoter of environmental stress related gene rd29A instead of the CaMV35S promoter (Kasuga et al, Nat . Biotechnol . 17: 287-291, 1999).

Therefore, research has been actively conducted to develop an inducible promoter capable of inducing expression of a target gene at a specific condition or at a specific time instead of a promoter that induces expression at all times in a plant tissue. Academicly, many inducible promoter systems have been developed in which promoters isolated from microorganisms or animals are introduced into plants and chemicals are used as derivatives to trigger biosynthesis of the protein of interest. As an example of a chemical expression induction system applied to plants, a method of treating chemicals such as steroid dexamethasone, antibiotic tetratracycline, copper ions, and IPTG as an inducer has been introduced (Gatz). et al., Plant J. 2: 397-404, 1992; Weimann et al. , Plant J. 5: 559-569, 1994; Aoyama T. and Chua NH, Plant J. 11: 605-612, 1997). However, there is a problem that the inducer compounds used in these systems are extremely expensive, cause the toxic effects of the chemicals themselves, and do not apply to all plants.

Plants have a mechanism of resistance that protects them from biological and abiotic stresses, such as pathogen attack. In particular, active plant resistance reactions that occur at the site of infection of pathogens not only activate local defense mechanisms but also induce systemic acquisition resistance. In general, mechanisms and signaling agents related to nonhost resistance have not been extensively studied, and mechanisms based on hypersensitivity apoptosis (HR) have been investigated. Recognition of molecules derived from pathogens allows oxidative bursts, DNA fragmentation, protein kinase activation, antimicrobial activity, salicylic acid (SA), ethylene, and methyl jasmonic acid to protect in plants during hypersensitivity apoptosis. Synthesis and accumulation of various signaling agents, such as methyl jasmonic acid (MeJA) and epsaic acid ( ABA ), act as part of plant defense. Promoters of genes encoding pepper PR-proteins were isolated, and the promoters of each gene were identified as cis-acting elements related to disease resistance and abiotic stress and hormone metabolism, and their activities have been analyzed.

When an overactive apoptosis occurs, the expression of genes in plants is driven by the activity of promoters located at the top of each gene. In order to analyze the promoter region of the hypersensitive apoptosis gene isolated from the pepper plants, the top 1-2kb can be isolated from the gDNA of the pepper and fused with the GUS reporter gene to observe the promoter activity occurring during the resistance mechanism.

Korean Patent No. 458153 discloses a promoter of Jasmonic acid methylation enzyme gene derived from Chinese cabbage and a method for producing a target protein in a plant using the promoter. Korean Patent No. 509565 discloses a SCAM-4DELA promoter and There is disclosed a method for producing a target protein in a plant using the same, but is different from the promoter of the present invention.

The present invention is derived from the above requirements, the present invention is not expressed at all in the other tissues (leaves, roots, flowers, stems, etc.) of the pepper plant from the RNA sample treated with pepper tissue RNA and non-pathogenic bacteria and pathogens Only CaPIG14 gene with increased expression was isolated from these treated pepper plants, followed by the promoter of CaPIG14 gene. CaPIG14 gene is similar in amino acid sequence to animal cyclo-oxygenase (COX) 21.7-23.7% and tobacco pathogenoxygenase (PIOX) 85.8%. CaPIG14 gene showed an induction-resistance response that was markedly increased in 4-12 hours by pathogens, and was also treated by saxlic acid, ethylene, and methyl jasmonate, which were plant resistance-related plant hormones. Expression increased. Thus, the promoter of the CaPIG14 gene was isolated in order to isolate cis-element related to the disease-specific expression of the gene and to utilize it. In the present invention, a novel disease specific expression gene CaPIG14 and a promoter of the gene are used to provide a technique for specifically expressing a gene in response to disease resistance and defense plant hormones.

In order to solve the above problems, the present invention is CaPIG14 ( Capsicum) derived from pepper, which is specifically expressed in the resistance response to non-pathogens or pathogens or when processing plant-related signal substances annum pathogen-induced gene 14) provides a promoter.

The present invention also provides a recombinant plant expression vector comprising the promoter.

The present invention also provides a method for producing a target protein using the recombinant plant expression vector.

The present invention also provides a method for producing a transformed plant using the recombinant plant expression vector.

The present invention also provides a transgenic plant produced by the above method.

According to the present invention, a new CaPIG14 gene promoter, which is specifically expressed in the resistance of plants caused by bacterial pathogen infection, was isolated from the pepper of the present invention. It is possible to provide methods for improvement and breeding.

In order to achieve the object of the present invention, the present invention comprises a CaPIG14 ( Capsicum) derived from pepper, which is specifically expressed in the resistance response to non-pathogens or pathogens or the treatment of plant defense-related signaling materials consisting of the nucleotide sequence of SEQ ID NO: 1 annum pathogen-induced gene 14) provides a promoter.

The present invention relates to a specific promoter derived from red pepper, wherein the promoter is specifically induced or expressed in a resistance reaction against non-pathogenic microorganisms that are non-pathogenic microorganisms or pathogenic microorganisms to plants, or when processing plant-related signal substances. Is induced or expressed. The plant defense signal may be salicylic acid or methyl jasmonic acid, but is not limited thereto.

Specifically, the promoter has a nucleotide sequence of SEQ ID NO: 1. In addition, variants of such promoter sequences are included within the scope of the present invention. A variant is a nucleotide sequence that changes in base sequence but has similar functional properties to that of SEQ ID NO: 1. Specifically, the promoter has a base sequence having at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% homology with the base sequence of SEQ ID NO. It may include.

The "% sequence homology" for a polynucleotide is identified by comparing two optimally arranged sequences with a comparison region, wherein part of the polynucleotide sequence in the comparison region is the reference sequence (addition or deletion) for the optimal alignment of the two sequences. It may include the addition or deletion (ie, gap) compared to).

In order to achieve another object of the present invention, the present invention provides a recombinant plant expression vector comprising the promoter according to the present invention.

The term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. Recombinant cells can also express genes found in natural cells, but the genes have been modified and reintroduced into cells by artificial means.

The term "vector" is used to refer to a DNA fragment (s), nucleic acid molecule, which is transferred into a cell. The vector replicates the DNA and can be independently regenerated in the host cell. The term "carrier" is often used interchangeably with "vector". The term “expression vector” refers to a recombinant DNA molecule comprising a coding sequence of interest and a suitable nucleic acid sequence necessary to express a coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.

Preferred examples of plant expression vectors are Ti-plasmid vectors which, when present in a suitable host such as Agrobacterium tumerfaciens, can transfer part of themselves, the so-called T-region, into plant cells. Another type of Ti-plasmid vector (see EP 0 116 718 B1) is used to transfer hybrid DNA sequences to protoplasts from which current plant cells or new plants can be produced that properly insert hybrid DNA into the plant's genome. have. A particularly preferred form of the Ti-plasmid vector is a so-called binary vector as claimed in EP 0 120 516 B1 and U.S. Patent No. 4,940,838. Other suitable vectors that can be used to introduce the DNA according to the invention into the plant host include viral vectors such as those that can be derived from double-stranded plant viruses (e. G., CaMV) and single- For example, from non -complete plant virus vectors. The use of such vectors may be particularly advantageous when it is difficult to transform the plant host properly.

The expression vector will preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having properties that can be selected by chemical methods, and all genes that can distinguish transformed cells from non-transformed cells. Examples include herbicide resistance genes such as glyphosate or phosphinotricin, antibiotics such as kanamycin, G418, bleomycin, hygromycin, and chloramphenicol Resistance genes include, but are not limited to.

In the plant expression vector according to an embodiment of the present invention, the terminator may use a conventional terminator, such as nopalin synthase (NOS), pepper α-amylase RAmy1 A terminator, phaseoline terminator, agro Terminators of the octopine gene of bacterium tumefaciens, but are not limited thereto. With regard to the need for terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of a terminator is highly desirable in the context of the present invention.

In a recombinant plant expression vector according to an embodiment of the present invention, the plant expression vector may be prepared by operably linking a target gene encoding a protein of interest downstream of the promoter of the present invention. In the present invention, "operably linked" refers to a component of an expression cassette that functions as a unit for expressing a heterologous protein. For example, a promoter operably linked to heterologous DNA encoding a protein promotes the production of functional mRNA corresponding to the heterologous DNA.

The target protein may be any kind of protein, and may have a medical utility such as enzymes, hormones, antibodies, cytokines, or the like, and may accumulate a large amount of nutrients that may enhance the health of animals including humans. Enzymes that can degrade proteins and cellulose, but are not limited thereto. Examples of the protein of interest include interleukin, interferon, platelet-induced growth factor, hemoglobin, elastin, collagen, insulin, fibroblast growth factor, human growth factor, human serum albumin, erythropoietin, cellobiohydrolase, endocellulase, betaglucose Cedarase, xylase, and the like.

In addition, the present invention is characterized in that after transforming a plant with the recombinant plant expression vector, the target protein is produced in the plant by treating the transformed plant with non-pathogens, pathogens or plant defense-related signal material. Provided are methods for producing a desired protein in a plant. The desired protein produced is as described above. The plant defense signal may be salicylic acid or methyl jasmonic acid, but is not limited thereto.

Transformation of a plant means any method of transferring DNA to a plant. Such transformation methods do not necessarily have a regeneration and / or tissue culture period. Transformation of plant species is now common for plant species, including both terminal plants as well as dicotyledonous plants. In principle, any transformation method can be used to introduce hybrid DNA according to the invention into suitable progenitor cells. Method is calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373), protoplasts Electroporation (Shillito RD et al., 1985 Bio / Technol. 3, 1099-1102), microscopic injection into plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202, 179-185 ), (DNA or RNA-coated) particle bombardment of various plant elements (Klein TM et al., 1987, Nature 327, 70), Agrobacterium tumulopasis by plant infiltration or transformation of mature pollen or vesicles And infection with (incomplete) virus (EP 0 301 316) in en mediated gene transfer. A preferred method according to the present invention comprises Agrobacterium mediated DNA delivery. Especially preferred is the use of the so-called binary vector technology as described in EP A 120 516 and US Pat. No. 4,940,838.

"Plant cell" used for transformation of a plant may be any plant cell. The plant cell may be any of a cultured cell, a cultured tissue, a culture or whole plant, preferably a cultured cell, a cultured tissue or culture medium, and more preferably a cultured cell.

"Plant tissue" refers to a tissue of differentiated or undifferentiated plant, including but not limited to roots, stems, leaves, pollen, seeds, cancer tissues, and various types of cells used for culture, protoplasts, shoots and callus tissue. The plant tissue may be in planta or in an organ culture, tissue culture or cell culture.

In addition, the present invention comprises the steps of transforming plant cells with a recombinant plant expression vector according to the present invention; And

It provides a method for producing a transformed plant comprising the step of regenerating the transformed plant from the transformed plant cells.

The method of the present invention comprises transforming plant cells with a recombinant plant expression vector according to the present invention, which transformation can be mediated by, for example, Agrobacterium tumefiaciens . In addition, the method of the present invention comprises regenerating a transgenic plant from the transformed plant cell. Any of the methods known in the art can be used for regeneration of transgenic plants from transgenic plant cells.

The present invention also provides a transgenic plant produced by the method for producing a transgenic plant according to the present invention. The plants are Arabidopsis, potato, eggplant, tobacco, pepper, tomato, burdock, garland chrysanthemum, lettuce, bellflower, spinach, chard, sweet potato, celery, carrot, buttercup, parsley, cabbage, cabbage, gatchi, watermelon, melon, cucumber, And dicotyledonous plants such as pumpkins, gourds, strawberries, soybeans, green beans, kidney beans, peas, or monocotyledonous plants such as rice, barley, wheat, rye, corn, sugar cane, oats, and onions.

The present invention also relates to CaPIG14 ( Capsicum) derived from red pepper annum pathogen-induced gene 14) protein.

The range of CaPIG14 protein according to the present invention includes proteins having an amino acid sequence represented by SEQ ID NO: 3 isolated from red pepper and functional equivalents of the proteins. "Functional equivalent" means at least 70%, preferably at least 80%, more preferably at least 90%, even more preferably at least 70% of the amino acid sequence represented by SEQ ID NO: 3 as a result of the addition, substitution, or deletion of the amino acid; Refers to a protein having 95% or more of sequence homology and exhibiting substantially homogeneous physiological activity with the protein represented by SEQ ID NO: 2. "Substantially homogeneous physiological activity" means activity specifically expressed by infection of a pathogen in a plant.

The present invention also provides a gene encoding the CaPIG14 protein. Genes of the invention include both genomic DNA and cDNA encoding CaPIG14 protein. Preferably, the gene of the present invention may include a nucleotide sequence represented by SEQ ID NO: 2. Variants of the above base sequences are also included within the scope of the present invention. Specifically, the gene has a nucleotide sequence having at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% homology with the nucleotide sequence of SEQ ID NO: 2, respectively. It may include.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Example  1. Pathogens Xag 8 ra Specifically expressed for CaPIG14  gene

Analyzing EST isolated from cDNA library made by extracting pepper total RNA induced by hypersensitivity reaction by inoculation of soybean blight bacteria, non-pathogenic bacteria of red pepper, primers of CaPIG14 gene (5'AATCCAGAGGATTACCCTTACAGA3 '(SEQ ID NO: 4) ) And 5'GTTCAATCTGGTGAGTATCTTCCAAGT3 '(SEQ ID NO: 5)). In order to know that CaPIG14 gene expression is disease-specific, the pepper plant is divided into root, stem, leaf, flower, and fruit (immature and mature) to isolate RNA, and RNA isolated from pepper plants treated with buffer and soybean pathogens. After synthesizing cDNA, RT-PCR was performed using CaPIG14 primer. As a result, it was found that the expression of CaPIG14 gene was not expressed at all in other tissues of the plant, and the expression was significantly increased only in pepper plants inoculated with soybean fire blight bacteria (FIG. 1).

RT-PCR confirmed that the expression of CaPIG14 gene, which is a non-pathogenic bacterium, was identified by RT-PCR. As a result, CaPIG14 expression began at 3 hours after inoculation and 9 hours after expression. Confirmed to be the best. After 12 hours, the expression gradually decreased, but the expression was maintained higher than that of the control treated with buffer until 24 hours. Expression of PR4B genes (5'-TGTTAACAAGTTGTGTGTAGCATTTT-3 '(SEQ ID NO: 6) and 5'-CCAAGGTACATATAGAGCTTCCAGA-3' (SEQ ID NO: 7)), already known as disease-specific genes, was confirmed for accuracy It was found that after 6 hours in the soybean blight bacterial treatment, high expression was maintained from 9 hours to 24 hours (FIG. 1). In addition, in order to confirm the expression of CaPIG14 in the disease-resistance response by the resistance (R) gene, ECW30 peppers showed resistance to two bacterial bacillus bacteria (race1 inoculated), and race3 was inoculated. CaPIG14 after inoculation) RT-PCR analysis was performed using primers of the CaPIG14 gene (5'-ATGTCTTTTATTATGTACTCCCTCAGGA-3 '(SEQ ID NO: 8) and 5'-TGAGAGGGCACTCACTTGC-3' (SEQ ID NO: 9)). CaPIG14 was expressed first at 1.5 hours in susceptibility reaction and then decreased at 6 hours and then high at 72 hours. After 48 hours, the expression was decreased (FIG. 2). CaPR- 1 gene expression in red pepper used as positive control was expressed from 72 hours in susceptibility reaction and from 12 hours to 72 hours in resistance reaction. CaPR- 1 gene primer 5'-ACTTGCAATTATGATCCACC-3 '(SEQ ID NO: 10) and 5'-ACTCCAGTTACTGCACCATT-3 '(SEQ ID NO: 11) was confirmed by RT-PCR. CaActin expression was confirmed by 5'-AGTGATCATTCTTTGCTTTATTCTTAC-3 '(SEQ ID NO: 12) and 5'-AACATTCATTCCCATGCTATC-3' (SEQ ID NO: 13). These results show that CaPIG14 gene expresses rapidly during the susceptibility response to bacterial pathogens in pepper plants in the early stage, but expresses specifically during the resistance response from 12 hours (FIGS. 1 and 2).

Example  2. expressed in response to treatment of plant defense-related signaling substances CaPIG14  gene

Expression of the CaPIG14 gene for hormones of plants known to be involved in disease resistance was analyzed. Salicylic acid (SA), etepon and methyl jasmonate (MeJA) were treated on pepper leaves and the expression of CaPIG14 gene was confirmed by RT-PCR method. The expression of CaPIG14 gene for SA began to express at 1 hour, the highest expression at 12 hours, and expression was maintained for 48 hours. In both the etepon and MeJA treatment, expression began at 1 hour and maintained for 48 hours. Positive markers for SA and etepon hormone treatment were the pepper PR-1 genes (5'-ACTTGCAATTATGATCCACC-3 '(SEQ ID NO: 14) and 5'-ACTCCAGTTACTGCACCATT-3' (SEQ ID NO: 15)). For the MeJA treatment, the PINII genes (5'-CTCGGAATTGTGATACAAGAATTGC-3 '(SEQ ID NO: 16) and 5'-AAGGTACGTACGGCTGCTTCTTTAC-3' (SEQ ID NO: 17) were used (Figure 3). It can be seen that the gene increases expression for both disease resistant hormones.

Example  3. 5 'including promoter Flanking  domain( flanking region Nucleotide sequence of CaPIG14  of cis - acting elements

For the development of bottle-specific promoters, Seegene's DNA Walking SpeedUp ™ Premix Kit was used to isolate the promoter of CaPIG14, which is pepper-resistant. First, genomic DNA was extracted from the leaves of cabbage pepper and 250 ng of the extracted DNA was used as a template. PCR of 5'CTTATGCCATGATCTTGAGTGATAAGAGT3 '(SEQ ID NO: 20)) yielded a DNA fragment of about 1.7 kb, and the sequencing thereof confirmed that the DNA fragment was the promoter portion of the CaPIG14 gene. The sequencing results were analyzed by 5 'flanking region using PLACE (http://www.dna.affrc.go.jp/PLACE/), and the GT-1 motif was used as a known cis-acting element. T / G box, GT-1 full sign coupling site, ABA response element coupling site; TRAB1, cor15, drought-responsive cis-element, etc. could be confirmed (FIG. 4).

Example  4. CaPIG14  Expression of promoter

In order to analyze the promoter region of the gene, the top 1.7kb was isolated from the gDNA of red pepper and cloned into the Topo vector to obtain a GUS fused CaPIG14 promoter clone by LR clonase reaction with the gateway vector containing the GUS reporter gene. Agrobacterium was used to transform the Arabidopsis strain to obtain a Arabidopsis seed transformed with a promoter of CaPIG14 . In order to observe the promoter expression pattern of CaPIG14 in transgenic Arabidopsis seeds, pathogen avirulence and virulence resistance expression was determined by Pseudomoans. syringae pv Pss61 HR + and Pss61 HR- and defensive plant hormones were treated with salicylic acid (SA), etepon, methyl jasmonate (MeJA) and epsaic acid ( ABA ) to observe promoter activity during resistance mechanisms. Could.

Resistance expression was strongly expressed in the leaf vein tip, whole, and meristem axis during avirulence treatment, in contrast to the expression patterns that were partially seen in leaf edges and hypocotyls in control and virulence. In addition, in the roots, the expression was not expressed in the control, whereas in virulence and avirulence, they were expressed throughout the root except the growth point (FIG. 6).

Promoter expression form of CaPIG14 was only expressed on the tip of seedling leaf vein during DW treatment, but when treated with defense-related plant hormones, methyl jasmonic acid and SA showed strong expression toward hypocotyl in whole leaves and meristems (Fig. 5).

As a result, the promoter of CaPIG14 is a new gene promoter that is specifically expressed in disease resistance and defense plant hormones.

1 is pathogen Xag This is the result of confirming the expression pattern of CaPIG14 gene specifically expressing for 8ra. Xag RT-PCR was performed with all RNAs extracted from tissues and leaves inoculated with 8ra (IM (Immature); immature, Nature green (MG); mature green fruit; MR (mature red ripe); mature red ripe fruit). ).

The bottom panel is a Xag fire blight pathogen on chili pepper leaves (cv. Bukang) 8ra was infected or treated with MgCl ₂ as a control.

Figure 2 shows the results of confirming the change in the expression level of CaPIG14 transcript after inoculation of pathogens. Resistant pepper ECW30R (R1) and the sensitivity pepper ECW30R after inoculation of the Xcv (R3) is the result confirming the change in the transfer CaPIG14 cheyang.

Figure 3 is a result showing the expression pattern of the CaPIG14 gene expressed in response to the treatment of plant defense-related signaling material. All RNAs were extracted at constant time from the red pepper leaves treated with buffer or treated with 5 mM SA, 5 mM ethephon and 0.1 mM MeJA, respectively. The onset genes CaPR1 and CaPINII were treated with ethephon , SA and MeJA respectively as positive markers.

Figure 4 is a cis -acting elements of the nucleotide sequence and CaPIG14 of the 5 'flanking region including the promoter of the gene CaPIG14. GT-1 motif and T / G box, GT-1 transcription factor coupling site, ABA response element coupling site; TRAB1, cor15, and drought-responsive cis-element.

FIG. 5 was treated with 50 μM ABA, 100 μM etepon, 100 μM MeJA and 5 mM SA for 1 day in Arabidopsis seedling grown in Agar medium containing MS for 1 week. After immersion in GUS substrate solution (100 mM sodium phosphate pH 7.0, 0.5 mM potassium ferricyanide, 0.5 mM potassium ferrocyanide, 0.1% Triton X-100, 1 mM EDTA, X-GlcA 5 mg / 10ml) Observed.

Figure 6 shows the expression of resistance to pathogen avirulence and virulence Pseudomoans syringae pv Pss61HR + and Pss61 HR- were grown in King's B medium for 2 days, suspended in 10 mM MgCl ₂ , diluted to 10 ¹² cfu / ml, and grown for 1 week in CaPIG14 promoter :: GUS transformed Arabidopsis seedling GUS expression was observed by the same method as in FIG. 5.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Pepper CaPIG 14 promotor specifically induced by disease          resistance and defence-associated plant hormone response and uses          the <130> PN09239 <160> 20 <170> KopatentIn 1.71 <210> 1 <211> 1725 <212> DNA <213> Capsicum annuum <400> 1 cgaattccaa gcttactata gggcacgcgt ggtcgacggc ccgggctggt aaacctctgg 60 aactgattag ttgcacctac atttttggaa tacatggcaa catctccgcc ttgtgaatgt 120 atcattggat tagcccccag aattcctgca gtattaaaca ctgatttgtg actcttatca 180 ctcaagatca tggcataagc ctgattaact gtaggcatag aactcataag caggatctga 240 cttcttgttt aatataaaca tcgcttagac ccattaagaa ctaaaacaac ttcaactagg 300 cccaacttgt ttcttcccag taatgcaaat ctcatggaac aaaaccaaac agaatagttt 360 tccatacttg ctaactggaa cgaaacaatt tgaatgccac tctgatctgc agggccaaga 420 aacaaggggt gattatagtc gattgttgtg ttctggatcc catttaagcc atcattctca 480 acatttgaca tttctgatct tagttattag caaacaaggg acaaagcctt ccacattttt 540 gcagattacc agaaaactat ccacaaatct tgactcaaga tcagtcaaga acataaccaa 600 cagcttgata tctcaagcag atgatcacca cttagctatt gattcttcta gctttgtggc 660 tttgttacca tgtgattatt cttagagtag atcactatgt ttaagtttaa tgcaagagaa 720 gaagcagtag ggaagcagga agaagagaaa cagatgaaga agatgaagaa gagaagagtt 780 cacggagaaa gagaattaaa ttctacttcc attagttgat tacaatctct catgtagcaa 840 gtatttatag actactacaa tgatcaagta tcataactaa ctaacaaact ttactatcca 900 ctagttagtt ataactaaca acttgttcat aactgactta gtgaataagt aaggctacta 960 gtaacatttt ttattgaatt ttgctcacaa agaattttta ttttaatcca aacttatata 1020 aagtcaaaca ctatccattt taaccattat attaacccat ttcacttgtc ccggcgcgct 1080 agcaccaaac tctccttatc agtaatttct tcatttacaa gggttaagac ttcacaattt 1140 ttgattaaga ataagaaaat ctattcatcc tatcacttca ctcttttggt gattcgttat 1200 tcagtcacac gtatagaatt aaagaaatac gtaaataaat aagaagattc cgacgcaaga 1260 caaagtgaat ttgaactgca actacatcat aggatcacaa cgtttcaaaa gtaataaatt 1320 tcttctagtc gtatttgatg ttgtcattta tactgatata tattgtacca tgaaaaaata 1380 tttttccacc atagaatttt ctttgtggtc ctattgctca acgtgcaagg tataatttcc 1440 caccttccaa attttacgtg gaacagtata tcctttgccg ggccaatagt attagagttg 1500 tcaaacctat gaaatttctg cattttttcc atttttataa acgtgtttta tatttttttt 1560 aatttattat taggattgtg tcttctgctt atgttactta tctctatata tagaaaggat 1620 atttgtagtc catatgtaca aattaaacat agagggtaga accactccga tccatattac 1680 aattgtgata tttctaacta ctattaggga aataatcaag attat 1725 <210> 2 <211> 1932 <212> DNA <213> Capsicum annum <400> 2 atgtctttta ttatgtcatc cctcaggaat ctctttctat ctcctcttcg tagtttcatt 60 caaaaagatt ttcatgatgc ctttgacagc atgactctcc tcgacaaact tttgtttatg 120 atggttcatt tcgttgataa attgatcctt tggcaccggc taccggtgtt cttggggcta 180 gcttatctcg cagcgcgccg gcatcttcat caggaatata atttgatcaa cgttggtaga 240 acacctaccg gggttcgatc aaatccagag gattaccctt acagaactgc tgatggaaaa 300 tacaatgacc ctttcaatga aggagcaggc agtcaatttt ctttctttgg tagaaatgtg 360 atgcctgttg atcaacatga caagttaaag aagccagatc caatggtagt ggcaacaaag 420 ctgctagcac gtaaaaactt tatggacaca ggaaaacaat tcaacatgat agcagcctct 480 tggatacaat ttatgattca tgattggatc gatcacttgg aagatactca ccagattgaa 540 ctaagggcac ctgaagaagt tgcaagtgag tgccctctca agtcctttaa gttttacaag 600 tccaagaaaa ctcctacagg cttttatgag atcaaaactg gttacttaaa caggcgtacc 660 ccttggtggg atggaagcgc tatttatggt agcaacacag aggctttgaa gaaagtaaga 720 acatttgaag acgggaagct gaagctatca gcagatgggc tcctcgaaca agatgaaaat 780 ggaaatatta tctctggtga tgttcgcaac ccttgggctg gacttttggc actgcaggct 840 ctctttattc aagagcacaa tctcgtttgt gacaccttga agaaagaata tccgaaattg 900 gaggatgagg acttgtatcg tcatgcaaga cttgtcactt ctgctgtcat tgcaaaagtt 960 cataccattg attggacagt cgagcttctc aaaactgaca ctcttctatc aggaatgcgc 1020 gccaattggt atggattgct agggaagaaa ttcaaggata catttgggca cgttggaggt 1080 tccagtttag gtggttttgt gggaatgaag aaacctgaaa atcatggagt gccctattcc 1140 ttgacagagg aatttgtgag tgtttatcgt atgcatcaac tcctacctga cacacttcaa 1200 ttgaggaata tcgacgccac acctgggcca aataaatctc tccctctcac caatgagatc 1260 cctatggaag atctaattgg gggcaaagga gaggagaatc tatcaagaat aggatatact 1320 aaacaaatgg tttcaatggg acaccaagcc tgtggcgctc ttgagcttat gaattatcca 1380 atatggatga gggatcttat tccccaagat gtcgatggaa atgataggcc agatcatatt 1440 gatcttgcag ctctagaaat ttacagggac agagaaagga gtgttgccag atacaatgaa 1500 tttcgtagga gaatgttgca aattcccatc tccaaatggg aagatttgac tgatgatgaa 1560 gaagccatta aaatgcttcg agaagtatat ggtgatgatg tagaagaatt ggaatttgtt 1620 agtgggaatg tctgcggaga aaaagataag ggttttgcca tctcggagac tgcctttttc 1680 atattcctaa tcatggcatc aaggaggcta gaggcagaca aatttttcac cagtaattat 1740 aacgaggaga catacacaaa aaaaggactt gaatgggtga atacaacaga aagcttgaaa 1800 gatgtacttg atcgacatta tccagaaatg actggaaaat ggatgaattc caatagcgcc 1860 ttctctgtgt gggactcttc tccagaacct cacaatccta ttccaatcta ctttcgtgtt 1920 cctcaacagt ag 1932 <210> 3 <211> 643 <212> PRT <213> Capsicum annum <400> 3 Met Ser Phe Ile Met Ser Ser Leu Arg Asn Leu Phe Leu Ser Pro Leu   1 5 10 15 Arg Ser Phe Ile Gln Lys Asp Phe His Asp Ala Phe Asp Ser Met Thr              20 25 30 Leu Leu Asp Lys Leu Leu Phe Met Met Val His Phe Val Asp Lys Leu          35 40 45 Ile Leu Trp His Arg Leu Pro Val Phe Leu Gly Leu Ala Tyr Leu Ala      50 55 60 Ala Arg Arg His Leu His Gln Glu Tyr Asn Leu Ile Asn Val Gly Arg  65 70 75 80 Thr Pro Thr Gly Val Arg Ser Asn Pro Glu Asp Tyr Pro Tyr Arg Thr                  85 90 95 Ala Asp Gly Lys Tyr Asn Asp Pro Phe Asn Glu Gly Ala Gly Ser Gln             100 105 110 Phe Ser Phe Phe Gly Arg Asn Val Met Pro Val Asp Gln His Asp Lys         115 120 125 Leu Lys Lys Pro Asp Pro Met Val Val Ala Thr Lys Leu Leu Ala Arg     130 135 140 Lys Asn Phe Met Asp Thr Gly Lys Gln Phe Asn Met Ile Ala Ala Ser 145 150 155 160 Trp Ile Gln Phe Met Ile His Asp Trp Ile Asp His Leu Glu Asp Thr                 165 170 175 His Gln Ile Glu Leu Arg Ala Pro Glu Glu Val Ala Ser Glu Cys Pro             180 185 190 Leu Lys Ser Phe Lys Phe Tyr Lys Ser Lys Lys Thr Pro Thr Gly Phe         195 200 205 Tyr Glu Ile Lys Thr Gly Tyr Leu Asn Arg Arg Thr Pro Trp Trp Asp     210 215 220 Gly Ser Ala Ile Tyr Gly Ser Asn Thr Glu Ala Leu Lys Lys Val Arg 225 230 235 240 Thr Phe Glu Asp Gly Lys Leu Lys Leu Ser Ala Asp Gly Leu Leu Glu                 245 250 255 Gln Asp Glu Asn Gly Asn Ile Ile Ser Gly Asp Val Arg Asn Pro Trp             260 265 270 Ala Gly Leu Leu Ala Leu Gln Ala Leu Phe Ile Gln Glu His Asn Leu         275 280 285 Val Cys Asp Thr Leu Lys Lys Glu Tyr Pro Lys Leu Glu Asp Glu Asp     290 295 300 Leu Tyr Arg His Ala Arg Leu Val Thr Ser Ala Val Ile Ala Lys Val 305 310 315 320 His Thr Ile Asp Trp Thr Val Glu Leu Les Lys Thr Asp Thr Leu Leu                 325 330 335 Ser Gly Met Arg Ala Asn Trp Tyr Gly Leu Leu Gly Lys Lys Phe Lys             340 345 350 Asp Thr Phe Gly His Val Gly Gly Ser Ser Leu Gly Gly Phe Val Gly         355 360 365 Met Lys Lys Pro Glu Asn His Gly Val Pro Tyr Ser Leu Thr Glu Glu     370 375 380 Phe Val Ser Val Tyr Arg Met His Gln Leu Leu Pro Asp Thr Leu Gln 385 390 395 400 Leu Arg Asn Ile Asp Ala Thr Pro Gly Pro Asn Lys Ser Leu Pro Leu                 405 410 415 Thr Asn Glu Ile Pro Met Glu Asp Leu Ile Gly Gly Lys Gly Glu Glu             420 425 430 Asn Leu Ser Arg Ile Gly Tyr Thr Lys Gln Met Val Ser Met Gly His         435 440 445 Gln Ala Cys Gly Ala Leu Glu Leu Met Asn Tyr Pro Ile Trp Met Arg     450 455 460 Asp Leu Ile Pro Gln Asp Val Asp Gly Asn Asp Arg Pro Asp His Ile 465 470 475 480 Asp Leu Ala Ala Leu Glu Ile Tyr Arg Asp Arg Glu Arg Ser Val Ala                 485 490 495 Arg Tyr Asn Glu Phe Arg Arg Arg Met Leu Gln Ile Pro Ile Ser Lys             500 505 510 Trp Glu Asp Leu Thr Asp Asp Glu Glu Ala Ile Lys Met Leu Arg Glu         515 520 525 Val Tyr Gly Asp Asp Val Glu Glu Leu Glu Phe Val Ser Gly Asn Val     530 535 540 Cys Gly Glu Lys Asp Lys Gly Phe Ala Ile Ser Glu Thr Ala Phe Phe 545 550 555 560 Ile Phe Leu Ile Met Ala Ser Arg Arg Leu Glu Ala Asp Lys Phe Phe                 565 570 575 Thr Ser Asn Tyr Asn Glu Glu Thr Tyr Thr Lys Lys Gly Leu Glu Trp             580 585 590 Val Asn Thr Thr Glu Ser Leu Lys Asp Val Leu Asp Arg His Tyr Pro         595 600 605 Glu Met Thr Gly Lys Trp Met Asn Ser Asn Ser Ala Phe Ser Val Trp     610 615 620 Asp Ser Ser Pro Glu Pro His Asn Pro Ile Pro Ile Tyr Phe Arg Val 625 630 635 640 Pro Gln Gln             <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 aatccagagg attaccctta caga 24 <210> 5 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 gttcaatctg gtgagtatct tccaagt 27 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 tgttaacaag ttgtgtgtag catttt 26 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 ccaaggtaca tatagagctt ccaga 25 <210> 8 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 atgtctttta ttatgtactc cctcagga 28 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 tgagagggca ctcacttgc 19 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 acttgcaatt atgatccacc 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 actccagtta ctgcaccatt 20 <210> 12 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 agtgatcatt ctttgcttta ttcttac 27 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 aacattcatt cccatgctat c 21 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 acttgcaatt atgatccacc 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 actccagtta ctgcaccatt 20 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 ctcggaattg tgatacaaga attgc 25 <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 aaggtacgta cggctgcttc tttac 25 <210> 18 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 caaaagtttg tcgaggagag tcatgctgtc 30 <210> 19 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 ttactagtag ccttacttat tcactaagt 29 <210> 20 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 cttatgccat gatcttgagt gataagagt 29  

Claims (10)

CaPIG14 ( Capsicum) derived from pepper, which is expressed specifically in the resistance response to non-pathogens or pathogens or in the treatment of plant defense-related signaling materials consisting of the nucleotide sequence of SEQ ID NO: 1 annum pathogen-induced gene 14) promoter. The promoter according to claim 1, wherein the plant defense-related signaling material is salicylic acid or methyl jasmonic acid. A recombinant plant expression vector comprising the promoter according to claim 1. The recombinant plant expression vector of claim 3, wherein the recombinant plant expression vector is prepared by operably linking a gene of interest encoding a protein of interest downstream of the promoter. After transforming the plant with the recombinant plant expression vector according to claim 4, the plant is characterized in that the target protein is produced in the plant by treating the transformed plant with non-pathogens, pathogens or plant defense-related signaling substances. How to produce the protein of interest within. 6. The method of claim 5, wherein said plant defense related signal is salicylic acid or methyl jasmonic acid. The method of claim 5, wherein the target protein is interleukin, interferon, platelet-induced growth factor, hemoglobin, elastin, collagen, insulin, fibroblast growth factor, human growth factor, human serum albumin, erythropoietin, cellobiohydrolase, endocellularase , Betaglucosidase and xylase. Transforming the plant cell with the vector according to claim 3; And Regenerating a transformed plant from the transformed plant cells. delete delete

Images