CN107267509B

CN107267509B - Plant dual-characteristic expression promoter and application thereof

Info

Publication number: CN107267509B
Application number: CN201710450947.6A
Authority: CN
Inventors: 李娟�; 杨剑波; 李�浩; 李莉; 杨亚春; 秦瑞英; 许蓉芳
Original assignee: Rice Research Institute of Anhui Academy of Agricultural Sciences
Current assignee: Rice Research Institute of Anhui Academy of Agricultural Sciences
Priority date: 2017-06-15
Filing date: 2017-06-15
Publication date: 2020-12-04
Anticipated expiration: 2037-06-15
Also published as: CN107267509A

Abstract

The invention provides a plant dual-characteristic expression promoter which not only can drive a target gene to be specifically expressed in seeds, but also can regulate and control the concentrated expression of the target gene under a drought induction condition. The drought-inducible tissue-specific expression promoter of the present invention comprises: as shown in a sequence table SEQ ID No:1 or a derivative thereof. The invention also provides a recombinant expression vector constructed by using the promoter, an expression cassette and application of the recombinant expression vector in plant cultivation. By connecting the promoter to the gene to be expressed and transferring the promoter into a plant by using a vector, the seed development can be induced in the non-drought state, and the exogenous gene can be driven to be expressed in each part of the plant under the drought condition.

Description

Plant dual-characteristic expression promoter and application thereof

Technical Field

The invention relates to a promoter separated from a plant, in particular to a plant dual-characteristic expression promoter separated from rice, and also relates to a recombinant expression vector containing the dual-characteristic expression promoter and application of the recombinant expression vector in aspects of improving plant characters, breeding new plant varieties and the like.

Background

Water is the material basis of plant life activities and participates in the processes of metabolism, absorption, transformation, transportation and the like of plants. The water maintains the normal growth and development of the plants, and plays an important role in the adaptation of the plants to the external environment. When water can not maintain normal life activities of the plants, the plants can show drought stress symptoms of reducing water absorption, closing stomata, slowing transpiration, abnormal metabolism and the like. Drought affects plants extensively and profoundly, and the stages from seed germination, vegetative growth, reproductive growth to flowering and fruiting are affected. In addition, physiological and biochemical metabolic processes such as photosynthesis, respiration, absorption and transportation of water and nutrient elements, activities of various enzymes, and conversion of organic substances are affected by drought. The drought of the plant causes water shortage of plant cells, thereby generating a drought signal and inducing the plant to generate a drought-resistant reaction. Understanding the molecular mechanism of plants adapting to drought stress is beneficial to developing plant drought-resistant genetic engineering, and has very important significance in improving plant drought-resistant capability and promoting the development of agricultural production. At present, the drought trend becomes one of the focuses of global attention and also becomes an important factor which puzzles sustainable development of agriculture in China, so that how to efficiently utilize limited freshwater resources to carry out large-scale agricultural production becomes one of the major problems which need to be solved urgently by biological science and technology in China and China. The cultivation of new varieties of drought-resistant crops is an economic and effective way to solve the problem.

The research of drought resistance of rice is receiving increasing attention, and the modern gene engineering technology opens up a new way for the directional improvement and variety breeding of crops. An important strategy for improving early resistance of rice is to directly transform the drought-resistant related genes of rice or other plants (corn, wheat, rye, arabidopsis thaliana and the like) under the control of constitutive expression or inducible promoters. The inducible expression promoter can be used for specifically expressing the drought-resistant related gene in a specific tissue at a specific time (such as when a plant is stressed by adversity), and can also avoid possible adverse effects caused by constitutive expression, so that the separation and identification of the drought-specific inducible promoter are particularly important for drought-resistant genetic improvement.

Furthermore, the promoters currently studied by researchers often have only a single expression specificity, and there are few promoters with multiple expression specificities known from the literature. Therefore, if a promoter with dual expression specificity can be provided, it would be of great significance to improve the traits of transgenic plants, especially transgenic rice.

Disclosure of Invention

In view of the above problems, it is an object of the present invention to provide a promoter having dual expression specificity and use of the promoter. The dual-characteristic expression promoter Posdo 5 is separated and cloned from rice, and not only has drought induction activity, but also can drive a target gene to be specifically expressed in seeds. The promoter is used for breeding transgenic rice, can protect seed development under drought conditions, is beneficial to improving the safety of transgenic crops, and is a reserve resource for long-term promoter transformation and design.

Specifically, the invention provides a plant dual characteristic expression promoter, which is characterized in that the plant drought induced expression promoter is separated from a rice plant, the DNA sequence of the plant dual characteristic expression promoter comprises the DNA sequence shown in SEQ ID No. 1,

the DNA sequence shown in SEQ ID No. 1 is:

ACCGCAAACATGGACGGAATAGTTCATTTGGATTTGTCCATTCGTGGAAACTGATTTTTTTTTAAAAAAAATTAAAGCTTTCAGTCTTTGCAATAACTAATAAAACATGAGAAATTTTATAATATTTGAGATGTACCAAAATCTTTAATCTAAATTTTTATTTATCGGAGGTACCAAAATTTACAGTATATTTTTTGTACCGCCTTAAAAATTATAAAATCATTCGTAATACATACTATTATGTAACCATAATTATTTTTGTCACTAAGATTCAAACCCTGACGAATGAAGCTGTACGTGCCCGATTCCACGCCGCATGAATGGTGCTTCACATAAACTGATAAATTCAAGTTGCGTTTTGTTTGTTTCCAGAGAAAAGAAATAATCAAATGCCACTGTCAGCCACGTATTGTTTTGTTCTTAATTAGCAAAGCGTGTAAAACACATCCCCCGCTAACTAAATGCCATCGAAATTTCTGTTCATGTGTTTGACTGCCGTATAGTCCATGAGCTTTAATCTAGTTATTCGATTTATCAGATAGGCAAGTGGTTTAAAAGACATAGTTATTCAATGGTGAGTCGACCGAAACTAAACTCGATTTATCATGACATAATAGACACGGTTGCCACTTGCCACAGAAAGAATAAGAGCGCTGCTACACGTACTTAAAAGTGAAATACTTGCAAAATCCTTACAAACAATAATCTGAACTGTTTGATTTAACTAGACGAGAGTTACAGAAAATCTATATATACTCACAGTTTGATAAGAGTTTAGTAGAAAGAATTTCATATTTATAGCCTTTTTCCAGAAGAAATGATCAAATCAAGAAGTGAAACCGGCCGGAGAAAGTCTACACCGGCAGGCCCGGCTCATGCAGCCCACGTTAGGAAGCCTGGCTGCACTGGGTGGCCCAACGGTGGGGTGGGCCACCTCGGGCCAGCCGCAGCAGAATGCATGGGCCGGCCCATAAATGGGCCACTCCAAAGCAGACCGGCGCTCAGAGGTCCATCCTGATGAATGAACATTCATGCAGGTGACCGGCCCAAAATAATTACAGAAACCCAAAAATTACAGAAAAACTACGGGTTGTTCATGTTATACCATTTCAGAACATACCATTTTTTTAAAGTTGATAAATATACGTATCCATTAAGTTTTTTACTAATAAATACGTAAGAAATCCTGTCAAAACTTGGCAATATTGCTAAATTGTTGCCAAAACTTTATAAGGTTTATTTTAGCTACAATCTAAACAGACCTTATGTATTTGCTAAAAACTTAAAAAAAAGTGCAGAAAATTAGGAATTTGCTCAAAAATATGGTAACAGTTTGGACCATTAGATAAGCTTAATGATTTATTCTAGCGAGAGATTCTTGCTGGATGTATGCATGTAAATATATTGTAATTACACCGTAATTATGCTATAGTTATATTTGAAATATTTTTATCTTAAAGAACTGATATGTTATATAGCTACTTCCGAAAACTAGCACGGAAATGCTTTTTTGAAAAAAGAAACATATGTTCTCCTTTCTGTGTGAATAAAGCACGAGCAGTTCCAGTTGTATATATATGCGTCCAAATATACTGTCCCGTGGTTTATTCATCCAAACGACAAATCCTTTTTTCTAAAAAAAAATTCCAACGCATTACTTTCTTCCCTTTTCTCTAGCGAAAAAAAGAAAGCACCGACCAAAGTGGCTCAAAAATGGACGCGTCCAAAGATCGCGCTGCCACATGACAACGGACTTCGATGAAATTATCGTCAATTTTTATCAAATTCCGATCAAATCATTCCTCGTCGGCGTCCATCCCGGATACTATAGGTGGACACCTTCGAGTCGCTTCTCTCTTCTCCGGCGACACTGCCACTGCCACGCGTCCCTCCCTTCCTCCCCGCCCAACCCCCACGTGTGCGTCCACGTGGCACCCGCCCATCTCACCTCCTCCTCCTATATCCTCCTCTCCTCCGCCATTGCCGCACCTCATCACCTCCTCGTCTTCTTCTTCCACCTCGCAAATCCGATCAACACATCAGCTTGAGAAACA。

preferably, the promoter comprises:

(a) a nucleotide sequence obtained after adding one or more nucleotides to the nucleotide sequence shown in SEQ ID No. 1; or

(b) A nucleotide sequence having at least 90% homology with the nucleotide sequence shown in SEQ ID No. 1; or

(c) A nucleotide sequence obtained by substituting one or more nucleotides in the nucleotide sequence shown in SEQ ID No. 1; or

(d) The nucleotide sequence obtained after one or more nucleotides are deleted from the nucleotide sequence shown in SEQ ID No. 1; or

(e) The corresponding nucleotide sequence of the corresponding product obtained after crossing with a plant having the nucleotide sequence shown in SEQ ID No. 1.

Preferably, the promoter is from Nipponbare rice, and the amplification primers used for the separation comprise a first primer and a second primer.

In another aspect, the present invention provides an expression cassette, wherein said expression cassette comprises said plant dual trait expression promoter.

In another aspect, the present invention provides a recombinant expression vector, wherein the recombinant expression vector comprises the drought-inducible tissue-specific expression promoter, and in the recombinant expression vector, the drought-inducible tissue-specific expression promoter is linked to the upstream of a gene sequence to be expressed in the vector.

Preferably, the gene to be expressed is a GUS gene, the recombinant expression vector is pCAMBIA1381-Posdro5, and pCAMBIA1381 is a plant binary expression vector.

In another aspect, the present invention provides a method for enhancing the development and drought resistance of plant seeds, comprising: the plant water-flooding inducible tissue specific promoter Posdo 5 is connected with a seed development gene and a drought-tolerant gene to form a recombinant vector, the recombinant vector is introduced into a target plant to promote the plant seed development, and when the target plant is subjected to a drought environment, the rice drought-inducible tissue specific promoter Posdo 5 induces a large amount of expression of the drought-tolerant gene to promote the drought-resistant capability of the plant.

The GUS chemical staining detection of the obtained transgenic rice shows that the roots, stems and leaves of the plant are not blue, but the plant has obvious blue coloration in the seeds. When the plants are subjected to drought induction, the roots, stems, leaves and seed tissues show obvious coloring. Particularly, after drought treatment for 12 hours, the GUS gene expression amount driven by the promoter is 12 times that of the GUS gene which is not treated, so that the 2054bp sequence has seed specificity and has drought induction activity.

Technical effects

The cloned promoter Posdo 5 can regulate and control the specific expression of genes in rice seeds and can promote the expression in plants under drought induction. Therefore, the gene can be connected with a required target gene, and is used for regulating and controlling the expression of exogenous genes in plants of various monocotyledons, carrying out gene modification on crop or energy plant varieties, and also can be used for regulating and controlling the expression of drought-induced related genes in plants, particularly protecting seed germination under drought conditions, providing reference for screening and safe production of drought-tolerant plant varieties, and having important significance for cultivating the drought-tolerant plant varieties.

Drawings

Embodiments of the invention are described in detail below with reference to the attached drawing figures, wherein:

FIG. 1 is a schematic diagram of the construction of the Posdro5 promoter in the pCAMBIA1381 vector plasmid, wherein A is a schematic diagram of pCAMBIA1381 and B is a schematic diagram of pCAMBIA1381-Posdro5, wherein the expression of the GUS gene located downstream thereof using the Posdro5 promoter is shown;

FIG. 2 is a diagram showing the results of enzyme digestion verification of the pCAMBIA1381-Posdro5 expression vector constructed in the present invention.

Fig. 3 shows the results obtained for Posdro 5: : GUS transgenic rice plants were subjected to GUS staining before and after drought treatment, wherein A, B, C, D in the figure shows the staining results of the tissues of roots, leaves and seeds before drought induction, E, F, G and H in the figure show the staining results of the tissues after drought induction, and the tissues of roots, stems, leaves and seeds are shown from left to right (scale: 0.5 cm).

Fig. 4 shows the results obtained for Posdro 5: : and (3) carrying out qRT-PCR detection results on GUS gene expression quantity of GUS transgenic rice plants before and after drought treatment. In the figure, the GUS gene expression quantity in a gene plant before drought treatment is 1, and the GUS gene expression quantity driven by a Posdro5 promoter after the drought treatment is 12 times that before the drought treatment.

Detailed Description

The invention is illustrated below with reference to specific examples. It will be understood by those skilled in the art that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention in any way.

The invention uses mature seeds of Nipponbare (preserved by the technical room of rice institute of agricultural institute of Anhui province) of rice to separate promoter fragments.

The following will briefly explain the main materials and reagents used in the examples, and all the materials and reagents are commercially available products unless otherwise specified.

Sodium hypochlorite (NaClO, 4% available chlorine), Tween20 was purchased from Sigma. Hygromycin B was purchased from Roche; PEASY-Tsmiple and DNA marker-Trans2K were purchased from Transgen; restriction enzymes were purchased from NEB; KOD high-fidelity polymerase and quantitative PCR kit are purchased from TaKaRa Biotechnology GmbH; t4DNA ligase was purchased from Promega; the DNA fragment recovery kit is purchased from TIANGEN company; the Axygen plasmid miniprep kit is used for extracting plasmid DNA. Primer synthesis and sequencing were performed by Beijing Liu He Hua Dageney science and technology Co. Buffers, reagents, bacterial culture formulations, and E.coli competence preparations are described in molecular cloning, A laboratory Manual (third edition).

The escherichia coli strain adopted by the invention is XL-blue; the agrobacterium tumefaciens is EHA105, and is stored in a biotechnology laboratory of the rice institute of agricultural institute of Anhui province; plant expression vector pCAMBIA1381 was purchased from CAMBIA, Australia.

Specific example 1 obtaining of promoter Posdro5

The inventor of the present application uses a nucleotide sequence 2054bp upstream of the transcription start site of LOC _ Os10g36180 gene as a promoter of the whole genome sequence of Nipponbare (Oryza sativa L cv. Nipponbare) of a rice variety provided in NCBI, and named the gene as Posdro 5. An amplification primer is designed according to the promoter sequence of the rice LOC _ Os10g36180 gene, and the restriction enzyme sites of the primer are designed according to the characteristics of the selected vector and the target gene, wherein the primer is synthesized by Shenzhen Huada Gene company. The specifically designed primers are: the forward primer has the sequence of CTGCAGACCGCAAACATGGACGGAATAG (SEQ ID No:2), the 5 'end has PstI cleavage site, the reverse primer has the sequence of GGATCCTGTTTCTCAAGCTGATGTGTTG (SEQ ID No:3), and the 5' end has BamHI cleavage site.

DNA of Nipponbare of rice variety is extracted by conventional method. Taking DNA of Nipponbare as a template, amplifying a promoter Posdo 5 by using a forward primer and a reverse primer, and adopting the following amplification program according to a conventional PCR system:

pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 2min30s, 35 cycles from pre-denaturation at 95 ℃ to extension at 72 ℃; finally, extension is carried out for 10min at 72 ℃. The target fragment amplified by PCR was recovered and found to be 2054bp in length, and ligated to PGEM-T-Easy vector (purchased from Promega, mixed in the proportions indicated in the vector instructions) to transform E.coli by heat shock. After the competent cells are activated, the target fragment is transferred into the activated competent cells, then positive clones are obtained by colony PCR screening, and monoclonal shake bacteria liquid is selected to extract plasmids, wherein the plasmid extraction method comprises the following steps:

extracting corresponding plasmids by using an AXYGEN plasmid DNA minikit, wherein the specific operation method comprises the following steps: when the kit is used for the first time, RNaseA carried by the kit is completely added into Buffer S1, mixed uniformly and stored at 4 ℃.

(1) About 4mL of overnight-cultured broth (the volume should be reduced by half or less when the broth is over-concentrated) was taken, centrifuged at 12,000 Xg for 30s, and the supernatant was discarded.

(2) 250 μ l of Buffer S1 was added to suspend the bacterial pellet evenly without leaving small clumps.

(3) Adding 250 μ l Buffer S2, slowly turning over 4-6 times, mixing well to crack the thallus fully until a clear solution is formed. This step should not be carried out for more than 5 min.

(4) Add 350. mu.l Buffer S3, mix gently and thoroughly by tumbling 6-8 times, centrifuge at 12,000 Xg for 10 min.

(5) The supernatant from step 4 was aspirated and transferred to an adsorption column (placed in a 2mL centrifuge tube), allowed to stand at room temperature for 2min, centrifuged at 12,000 Xg for 1min, and the filtrate was discarded.

(6) The column was returned to the centrifuge tube, 500. mu.l of Buffer W1 was added, and the mixture was centrifuged at 12,000 Xg for 30 seconds, and the filtrate was discarded.

(7) The adsorption column was put back into the centrifuge tube, 700. mu.l Buffer W2 was added, centrifugation was carried out at 12,000 Xg for 30s, and the filtrate was discarded; in the same manner, the mixture was washed once more with 500. mu.l of Buffer W2. The filtrate was discarded.

(8) The column was placed back in a 2mL centrifuge tube and centrifuged at 12,000 Xg for 2 min.

(9) The column was transferred to a new 1.5mL centrifuge tube (provided in the kit), 60. mu.l deionized water (preheated at 65 ℃) was added to the center of the column membrane, and the column was allowed to stand at room temperature for 2 min. Centrifuge at 12,000 Xg for 1 min. Adding the eluted solution to the center of the adsorption membrane again, and washing once again.

After extracting the plasmid, carrying out double enzyme digestion verification by using PstI and BamHI. The identified positive clones were sent to Invitrogen for sequencing. The correct clone is verified to be the promoter Posdo 5 to be obtained, and the nucleic acid sequence of the clone is shown as SEQ ID No. 1.

Specific example 2 construction of plant expression vectors

A plasmid was extracted from the positive clone obtained in the above "obtaining of promoter Posdro 5", and digested with PstI and BamHI, whereby a promoter Posdro5 fragment was recovered. Meanwhile, pCAMBIA1381 was recovered by linearizing pCAMBIA1381 with PstI and BamHI, the above-mentioned Posdo 5 fragment and pCAMBIA1381 fragment were ligated with T4 ligase (available from TaKaRa) to obtain a plant expression vector pCAMBIA 1381-Posdo 5 (FIG. 1B) in which a promoter Posdo 5 was fused with GUS gene, and the plasmid was extracted and then subjected to double digestion with PstI and BamHI, as shown in FIG. 2. The plant expression vector was transferred to Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 by freeze-thawing, positive clones were selected and stored in a-80 ℃ refrigerator with glycerol.

Specific example 3 Agrobacterium-mediated genetic transformation of Rice

(1) The rice seeds after callus induction sterilization are soaked in sterile water at 30 ℃ in the dark overnight, and the embryos are peeled off by a scalpel and placed on an induction culture medium. 12 embryos are evenly placed in each dish (a disposable plastic culture dish with the specification of 100 multiplied by 25mm and containing 50mL of induction culture medium), and are placed in the dark at the temperature of 30 ℃ for 2-3 weeks to induce callus until light yellow granular callus grows out.

(2) Pre-culturing, selecting granular callus without disease spots from an induction culture medium, placing the callus on a new induction culture medium, and culturing for 3-5 days at 30 ℃ in the dark.

(3) Infection and Co-culture the pre-cultured callus was transferred to a 50mL sterile tube, the Agrobacterium solution containing the expression vector obtained in "example 2" was added and soaked for 20min, the solution was decanted and the residual solution was blotted with sterile filter paper. And uniformly scattering the callus on a co-culture medium, and culturing for 2-3 d at 23 ℃ in the dark.

(4) Recovery Co-cultured calli were transferred to recovery medium (overlap between calli was avoided as much as possible). Culturing in dark at 23 ℃ for 3-5 days.

(5) Screening resistant embryogenic callus which is bright and light in light yellow granular color without bacterial plaque is selected from a screening culture medium, 30 granules in each dish are inoculated in the screening culture medium, and dark culture is carried out at 30 ℃ for 2-3 weeks until new resistant granular callus grows out.

(6) Differentiating each transformation event (all calluses generated by breeding one callus during screening), selecting three independent embryogenic calluses to a certain area of a differentiation culture medium, and culturing for 3-4 weeks in a light culture room (16h light/8 h dark) at 30 ℃ until seedlings grow out.

(7) Selecting two strong seedlings in each rooting area, transplanting the seedlings to a rooting culture medium, culturing the seedlings in a tissue culture room at the temperature of 30 ℃ for about three weeks in a photoperiod (16h of light/8 h of dark), identifying and transplanting the seedlings to a field.

Specific example 4 identification of GUS staining results

GUS can react with a chromogenic substrate X-gluc to show blue color, so that the expression level and the expression pattern of GUS can be qualitatively researched by histochemical staining.

The reagents and procedures used for GUS staining were as follows, with reference to Jefferson (Jefferson RA et al. GUS fusion: β -Glucuronite as a sensitive and versatic gene fusion marker in highher plant [ J ]. EMBO J., 1987, 6: 3901-:

firstly, dyeing: and (3) immersing a sample to be detected into GUS dye solution, and placing the sample in an incubator at 37 ℃ for 24-36 h.

② decoloring: adding 100% ethanol for soaking until complete decolorization. Can be preserved with a solution containing 30% glycerol and 70% ethanol.

Shooting and recording under a microscope.

GUS staining was performed as described above, and the results are shown in FIG. 3, in which FIG. 3A, B, C and D show the results of staining each tissue before drought induction. It can be seen that in the transgenic plants, there was no blue color in root, stem and leaf tissues, but there was a distinct blue color in the seeds, indicating that the promoter is a seed-specific promoter and that the background activity in root, stem and leaf tissues is low (scale ═ 0.5 cm).

Meanwhile, seedlings and seeds growing for 10 days are used for GUS staining after drought induction. The results are shown in fig. 3E, F, G and H, where there was significant coloration in roots, stems, leaves and seeds after 12 hours of drought treatment, indicating that the promoter is a drought-inducible promoter (0.5 cm on scale).

Specific example 5 identification of GUS Gene expression level

Selecting Posdo 5 which has no lesion spots and good embryo development: : glume shells of GUS transgenic rice seeds are removed, the GUS transgenic rice seeds are soaked in 70% ethanol and vigorously shaken for 1min, then the ethanol is poured out, and 50% sodium hypochlorite (4% of available chlorine) and a few drops of Tween20 are added to be soaked for 20min (150r/min, 30 ℃) for surface disinfection. The seeds were inoculated in 1/2MS medium containing 25mg/l hygromycin and cultured at 30 ℃ for 7-10 days under 16h light/8 h dark conditions. During the stress treatment, the root culture medium is washed and the water is absorbed by absorbent paper, and the seedlings are soaked in 1/2MS solution containing 300mM mannose for simulated drought treatment and sampled for 12 h. Untreated seedlings served as controls. The seedlings were frozen quickly with liquid nitrogen and stored in a-80 ℃ ultra-low temperature freezer for RNA extraction.

RT-PCR was performed using the SuperReal fluorescent quantitation premix kit (TIANGEN, SYBR Green, FP205) from Tiangen (Beijing). The amount of the RNA template used was quantified using the rice ACTIN gene as an internal reference gene. By using 2^–ΔΔCT(Δ CT ═ CT target gene-CT reference gene; Δ Δ CT ═ Δ CT treatment followed by Δ CT control) the obtained signals and data were processed. 3 replicates of each gene were made. The quantitative primers for the genes used in this experiment were:

Actin-FP 5’-CCTGACGGAGCGTGGTTAC-3’；

Actin-RP，5’-CCAGGGCGATGTAGGAAAGC-3’

used for amplifying an internal reference gene ACTIN;

GUS-FP，5’-TACGGCAAAGTGTGGGTCAATAATCA-3’

GUS-RP，5’-CAGGTGTTCGGCGTGGTGTAGAG-3’

used for the amplification of GUS gene.

The quantitative RT-PCR result is shown in FIG. 4, the GUS gene expression quantity of the whole transgenic plant with the Posdro5 promoter 10 days before drought treatment is 1, and after the drought treatment is 12 hours, the GUS gene expression quantity driven by the Posdro5 promoter is 12 times that before the drought treatment, which further indicates that the promoter is a drought-induced promoter which can drive the GUS gene expression under the drought condition.

The above description of the specific embodiments of the present invention is not intended to limit the present invention, and those skilled in the art may make various changes and modifications according to the present invention without departing from the spirit of the present invention, which is defined by the scope of the appended claims.

Sequence listing

<110> institute of Paddy Rice of agricultural science institute of Anhui province

<120> plant dual characteristic expression promoter and application thereof

<130> HCI20170108

<160> 7

<170> PatentIn version 3.3

<210> 1

<211> 2054

<212> DNA

<213> Dual Property expression promoter

<400> 1:

accgcaaaca tggacggaat agttcatttg gatttgtcca ttcgtggaaa ctgatttttt 60

tttaaaaaaa attaaagctt tcagtctttg caataactaa taaaacatga gaaattttat 120

aatatttgag atgtaccaaa atctttaatc taaattttta tttatcggag gtaccaaaat 180

ttacagtata ttttttgtac cgccttaaaa attataaaat cattcgtaat acatactatt 240

atgtaaccat aattattttt gtcactaaga ttcaaaccct gacgaatgaa gctgtacgtg 300

cccgattcca cgccgcatga atggtgcttc acataaactg ataaattcaa gttgcgtttt 360

gtttgtttcc agagaaaaga aataatcaaa tgccactgtc agccacgtat tgttttgttc 420

ttaattagca aagcgtgtaa aacacatccc ccgctaacta aatgccatcg aaatttctgt 480

tcatgtgttt gactgccgta tagtccatga gctttaatct agttattcga tttatcagat 540

aggcaagtgg tttaaaagac atagttattc aatggtgagt cgaccgaaac taaactcgat 600

ttatcatgac ataatagaca cggttgccac ttgccacaga aagaataaga gcgctgctac 660

acgtacttaa aagtgaaata cttgcaaaat ccttacaaac aataatctga actgtttgat 720

ttaactagac gagagttaca gaaaatctat atatactcac agtttgataa gagtttagta 780

gaaagaattt catatttata gcctttttcc agaagaaatg atcaaatcaa gaagtgaaac 840

cggccggaga aagtctacac cggcaggccc ggctcatgca gcccacgtta ggaagcctgg 900

ctgcactggg tggcccaacg gtggggtggg ccacctcggg ccagccgcag cagaatgcat 960

gggccggccc ataaatgggc cactccaaag cagaccggcg ctcagaggtc catcctgatg 1020

aatgaacatt catgcaggtg accggcccaa aataattaca gaaacccaaa aattacagaa 1080

aaactacggg ttgttcatgt tataccattt cagaacatac cattttttta aagttgataa 1140

atatacgtat ccattaagtt ttttactaat aaatacgtaa gaaatcctgt caaaacttgg 1200

caatattgct aaattgttgc caaaacttta taaggtttat tttagctaca atctaaacag 1260

accttatgta tttgctaaaa acttaaaaaa aagtgcagaa aattaggaat ttgctcaaaa 1320

atatggtaac agtttggacc attagataag cttaatgatt tattctagcg agagattctt 1380

gctggatgta tgcatgtaaa tatattgtaa ttacaccgta attatgctat agttatattt 1440

gaaatatttt tatcttaaag aactgatatg ttatatagct acttccgaaa actagcacgg 1500

aaatgctttt ttgaaaaaag aaacatatgt tctcctttct gtgtgaataa agcacgagca 1560

gttccagttg tatatatatg cgtccaaata tactgtcccg tggtttattc atccaaacga 1620

caaatccttt tttctaaaaa aaaattccaa cgcattactt tcttcccttt tctctagcga 1680

aaaaaagaaa gcaccgacca aagtggctca aaaatggacg cgtccaaaga tcgcgctgcc 1740

acatgacaac ggacttcgat gaaattatcg tcaattttta tcaaattccg atcaaatcat 1800

tcctcgtcgg cgtccatccc ggatactata ggtggacacc ttcgagtcgc ttctctcttc 1860

tccggcgaca ctgccactgc cacgcgtccc tcccttcctc cccgcccaac ccccacgtgt 1920

gcgtccacgt ggcacccgcc catctcacct cctcctccta tatcctcctc tcctccgcca 1980

ttgccgcacc tcatcacctc ctcgtcttct tcttccacct cgcaaatccg atcaacacat 2040

cagcttgaga aaca 2054

<210> 2

<211> 28

<212> DNA

<213> Forward primer

<400> 2:

ctgcagaccg caaacatgga cggaatag 28

<210> 3

<211> 28

<212> DNA

<213> reverse primer

<400> 3:

ggatcctgtt tctcaagctg atgtgttg 28

<210> 4

<211> 19

<212> DNA

<213> primer

<400> 4:

cctgacggag cgtggttac 19

<210> 5

<211> 20

<212> DNA

<213> primer

<400> 5:

ccagggcgat gtaggaaagc 20

<210> 6

<211> 26

<212> DNA

<213> primer

<400> 6:

tacggcaaag tgtgggtcaa taatca 26

<210> 7

<211> 23

<212> DNA

<213> primer

<400> 7:

caggtgttcg gcgtggtgta gag 23

Claims

1. A plant dual-characteristic expression promoter is characterized in that the plant drought induced expression promoter is separated from a rice plant, the DNA sequence of the plant dual-characteristic expression promoter is composed of the DNA sequence shown in SEQ ID No. 1,

the DNA sequence shown in SEQ ID No. 1 is:

2. the plant dual characteristic expression promoter of claim 1, wherein the promoter is from Nipponbare rice, and the amplification primers used for isolation comprise a first primer and a second primer.

3. An expression cassette comprising the plant dual trait expression promoter of claim 1.

4. A recombinant expression vector comprising the plant dual trait expression promoter of claim 1 or 2 linked upstream of a gene sequence to be expressed in the vector.

5. The recombinant expression vector of claim 4, wherein the gene to be expressed is GUS gene, and the recombinant expression vector is pCAMBIA1381-Posdro5, wherein pCAMBIA1381 is a plant binary expression vector.

6. A method of enhancing seed development and drought resistance in a plant, comprising: the plant dual trait expression promoter as claimed in claim 1 is linked to a seed development gene and a drought-tolerant gene to constitute a recombinant vector, the recombinant vector is introduced into a target plant to promote the development of plant seeds, and when the target plant is subjected to a drought environment, the plant dual trait expression promoter induces the substantial expression of the drought-tolerant gene to promote the drought-resistant capability of the plant, which is rice.