CN111808864A

CN111808864A - Novel application of GmMYB48 gene in improving plant phosphorus starvation stress tolerance

Info

Publication number: CN111808864A
Application number: CN202010360954.9A
Authority: CN
Inventors: 张璟曜
Original assignee: North University of China
Current assignee: North University of China
Priority date: 2020-04-30
Filing date: 2020-04-30
Publication date: 2020-10-23

Abstract

The invention relates to the field of plant breeding, in particular to a novel application of a GmMYB48 gene in improving plant phosphorus starvation stress tolerance. According to the invention, a transgenic plant with remarkably improved low-phosphorus stress resistance is obtained by introducing a GmMYB48 gene into a plant cell; the GmMYB48 gene has positive regulation and control effects on phosphorus metabolism in soybeans and has important significance in breeding of high-phosphorus-absorption soybean varieties.

Description

Novel application of GmMYB48 gene in improving plant phosphorus starvation stress tolerance

Technical Field

The invention relates to the field of plant breeding, in particular to a novel application of a GmMYB48 gene in improving plant phosphorus starvation stress tolerance.

Background

Cultivated soybeans originate from temperate regions in China and are domesticated by wild soybeans (G.soja), and the history of the cultivated soybeans is nearly 5000 years to date. According to the statistical data of China customs, soybeans have become agricultural products with the largest import quantity and the largest use and collection amount in China. Because of trade friction in China and America, the number of imported soybeans of 8803.1 ten thousand tons in 2018 in China is reduced for the first time in nearly 7 years, so that the yield of the soybeans is increased extremely! The lack of phosphorus in soil is one of the important factors for restricting the yield of soybeans in China. The content of phosphorus in soil is not low, however, the phosphorus is easy to leach out because the soil has negative charges, and a large amount of phosphorus is converted into organic compounds by microorganisms or fixed by cations, so that a large amount of phosphorus (Pi) is fixed in the soil and becomes one of the major elements which are most difficult to be absorbed by plant roots. According to statistics, the phosphorus-deficient farmland (available phosphorus is less than or equal to 10mg/kg) in China occupies 81.5 percent of the total farmland area, wherein the serious phosphorus-deficient farmland (available phosphorus is less than or equal to 5mg/kg) occupies 50.5 percent. Therefore, phosphate fertilizers are used in agricultural production in large quantities to ensure the yield of crops. The method not only increases the economic cost in production, but also causes inevitable pollution to the environment and waste of non-renewable resources, so that the method is under increasing doubt in recent years, and the problem can be well solved by researching and exploiting the potential of high-efficiency utilization of the phosphorus of the soybeans by combining means such as molecular biology, bioinformatics and the like. Therefore, the research on the sensing and responding of soybean to the change of phosphorus content in soil, low phosphorus signal transmission, phosphorus element absorption and the like on the aspect of molecular biology is a very important research direction.

The MYB family is a very large transcription factor family (430 MYB transcription factors in soybean), and most of R2R3 MYB proteins (which comprise two MYB domains and have DNA binding activity) are widely involved in regulating and controlling relevant regulation and control of plant growth and development, such as primary and secondary metabolism, abiotic stress including phosphorus starvation and the like. Recent studies on the function of the arabidopsis thaliana and rice SPX gene families in plant phosphorus starvation response indicate that the SPX family is a sensitive indicator protein in response to phosphorus starvation stress specifically. And the protein complex can specifically interact with AtPHR1 in arabidopsis thaliana or OsPHR2 in rice, and the AtPHR1/OsPHR2 cannot be combined with the P1BS site, so that the transcriptional activation activity is inhibited, and the expression of a series of phosphorus starvation induction genes is further hindered.

CN 1681931a discloses a specific MYB family Y11414 gene or functional homologue thereof to produce plants tolerant to biotic stress, salt-induced stress, dehydration-induced stress, oxidative stress, osmotic stress, and to use products containing said gene sequence. However, the gene in the patent also has the same effect on other stresses, has no specificity, and does not give technical suggestion whether other genes in MYB family have the function. However, no relevant report is found on the effect of the GmMYB48 gene.

Disclosure of Invention

Aiming at the defects and practical requirements of the prior art, the invention provides a novel application of a GmMYB48 gene in improving the phosphorus starvation stress tolerance of plants. The invention provides a new way and selection for plant growth under the condition of phosphorus starvation stress.

In order to achieve the purpose, the invention adopts the following technical scheme:

in one aspect, the invention provides application of a GmMYB48 gene, a protein coded by the GmMYB48 gene, a recombinant expression vector containing the GmMYB48 gene, an expression cassette containing the GmMYB48 gene, a transgenic cell line containing the GmMYB48 gene or a recombinant bacterium containing the GmMYB48 gene in production of transgenic plants with tolerance to stress caused by phosphorus starvation.

In the invention, the inventor finds that the expression level of the phosphorus stress tolerance gene GmMYB48 in soybean is remarkably up-regulated under the condition of phosphorus stress, and the inventor finds that GmSPX1 can be specifically combined with GmMYB48 and GmSPX1 can inhibit the expression of GmMYB48 and cause the expression of downstream root development related genes, such as ACP5, PHT1, RNS, AT4, UBP14 and PIP5K, by utilizing a yeast two-hybrid sieve library and a bimolecular fluorescence complementation experiment on soybean SPX gene. Therefore, the GmMYB48 gene plays a very important role in the stress environment of plants for coping with phosphorus starvation.

According to the invention, the GmMYB48 gene, the protein coded by the GmMYB48 gene, a recombinant expression vector containing the GmMYB48 gene, an expression cassette containing the GmMYB48 gene, a transgenic cell line containing the GmMYB48 gene or a recombinant bacterium containing the GmMYB48 gene are used for preventing and/or treating stress caused by phosphorus starvation.

According to the present invention, the inventors found that the transgenic plant is a dicotyledonous plant, preferably a plant of the genus glycine, and further preferably a soybean.

In the present invention, the stress caused by phosphorus starvation is a phosphorus starvation stress environment that can tolerate a normal phosphorus concentration of 1%.

According to the invention, the GmMYB48 gene is a DNA molecule as described in any one of the following (1), (2) or (3): (1) a nucleotide sequence shown as SEQ ID NO. 1; (2) a nucleotide sequence which is hybridized with the nucleotide sequence defined in (1) under strict conditions and encodes a protein related to the capability of the plant to resist phosphorus hunger stress; (3) a nucleotide sequence having at least 80%, preferably 90% identity to the variable region of the nucleotide sequence defined in (1) and encoding a protein associated with the plant's ability to tolerate phosphorus starvation stress.

In particular embodiments, the identity may be, for example, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

In the invention, the GmMYB48 gene is located on chromosome 6, the length of a reading frame is 708bp, the length of a coded protein is 235, and a nucleotide sequence shown as SEQ ID NO.1 of the GmMYB48 gene is as follows: ATGGGAAGGTCCCCTTGCTGTGAGAAAGCACACACAAACAAAGGTGCATGGACCAAAGAAGAAGATCATCGCCTCATTTCTTACATTAGAGCTCACGGTGAAGGCTGCTGGCGCTCTCTCCCCAAAGCCGCCGGCCTTCTCCGTTGCGGCAAGAGCTGTCGTCTCCGCTGGATCAACTATCTCCGCCCTGACCTCAAGCGCGGCAATTTCTCCCTCGAAGAAGACCAACTCATCATCAAACTCCACAGCCTCCTTGGCAACAAGTGGTCTCTAATTGCTGGTAGATTGCCCGGTAGAACTGACAATGAGATCAAGAATTACTGGAATACTCACATACGCAGGAAGCTTCTGAGCAGAGGTATTGACCCTGCCACTCACAGGCCTCTCAACGATTCTTCTCATCAAGAACCTGCTGCTGTCTCTGCCCCTCCTAAACATCAAGAGTCCTTTCACCATGAACGCTGCCCTGACTTGAACCTTGAGCTAACCATTAGTCCTCCCCATCATCCTCAACCTGATCATCCGCACTTGAAGACCCTTGTGACAAACTCAAACCTTTGCTTTCCCTGCAGTCTGGGTTTGCATAATAGCAAAGATTGTAGCTGTGCCCTCCACACTAGTACTGCCAACGCTACTGCTACTGGCTATGATTTCTTGGCCTTGAAAACCACCGTCGTTTTGGATTACAGAACCTTGCACATGAAATGA are provided.

According to the invention, the GmMYB48 gene encodes a protein as described in (a) or (b) below: (a) an amino acid sequence shown as SEQID NO. 2; (b) and (b) a protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence defined in the step (a) and is related to the phosphorus starvation stress resistance of the plant and is derived from the sequence (a).

In a specific embodiment, the amino acid sequence shown in SEQ ID NO.2 is as follows:

MGRSPCCEKAHTNKGAWTKEEDHRLISYIRAHGEGCWRSLPKAAGLLRCGKSCRLRWINYLRPDLKRGNFSLEEDQLIIKLHSLLGNKWSLIAGRLPGRTDNEIKNYWNTHIRRKLLSRGIDPATHRPLNDSSHQEPAAVSAPPKHQESFHHERCPDLNLELTISPPHHPQPDHPHLKTLVTNSNLCFPCSLGLHNSKDCSCALHTSTANATATGYDFLALKTTVVLDYRTLHMK.

in a second aspect, the present invention provides a DNA molecule having tolerance to stress caused by phosphorus starvation, comprising the DNA molecule according to any one of the following (1), (2) or (3): (1) a nucleotide sequence shown as SEQ ID NO. 1; (2) a nucleotide sequence which is hybridized with the nucleotide sequence defined in (1) under strict conditions and encodes a protein related to the capability of the plant to resist phosphorus hunger stress; (3) a nucleotide sequence having at least 80%, preferably 90% identity to the variable region of the nucleotide sequence defined in (1) and encoding a protein associated with the plant's ability to tolerate phosphorus starvation stress.

In a third aspect, the present invention provides an expression cassette having tolerance to stress caused by phosphorus starvation comprising a DNA molecule operably linked to the second aspect.

In a fourth aspect, the present invention provides a biological vector having tolerance to stress caused by phosphorus starvation, comprising the DNA molecule of the second aspect or the expression cassette of the third aspect.

In the present invention, when constructing a plant expression vector, any one of an enhancer promoter and an inducible promoter may be added before the transcription initiation nucleotide, and may be used alone or in combination with other plant promoters; any enhancer, including translational enhancers or transcriptional enhancers, may be added to the transcription initiation nucleotide, but must be in the same reading frame as the coding sequence to ensure proper translation of the entire sequence.

In the present invention, in order to facilitate the identification and screening of transgenic plant cells or plants, the used vector may be processed, for example, plant selectable markers (GUS gene, luciferase gene, etc.) or antibiotic markers with resistance (gentamicin, kanamycin, etc.) may be added, and the biological vector is pCAMBIA3301-26 plant overexpression vector, specifically, GmMYB48 gene is inserted into the multiple cloning site of pCAMBIA3301-26 vector.

In a fifth aspect, the present invention provides a plant host cell having tolerance to stress caused by phosphorus starvation transformed with the biological vector of the fourth aspect.

In specific examples, the expression vector can be used to transform plant cells or tissues by using a conventional biological method such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, conductance, agrobacterium, etc., and culturing the transformed plant tissues into plants.

In a specific embodiment, the host cell to be transformed is preferably a dicotyledonous plant, preferably a plant of the family Sojae, more preferably Soy.

In a sixth aspect, the present invention provides a transgenic plant having tolerance to stress caused by phosphorus starvation comprising the plant host cell of the fifth aspect.

In a seventh aspect, the present invention provides a method for treating and/or preventing damage caused by plant phosphorus starvation stress in a plant, said method comprising transforming a plant of interest with a host cell comprising a DNA molecule according to the third aspect, resulting in a transgenic plant with higher tolerance to phosphorus starvation stress than said plant of interest.

In an eighth aspect, the present invention provides a method for treating and/or preventing damage caused by plant phosphorus starvation stress in a plant, the method comprising transforming a plant of interest with a host cell comprising the fifth aspect, resulting in a transgenic plant with higher tolerance to phosphorus starvation stress than the plant of interest.

In a ninth aspect, the present invention provides the use of a method as described in the eighth aspect in plant breeding;

in the present invention, the plant is a dicotyledonous plant, preferably a plant of the genus glycine, and more preferably a soybean.

Compared with the prior art, the invention has the following beneficial effects:

(1) the expression level of the phosphorus stress tolerance gene GmMYB48 in a soybean material is remarkably increased under the condition of low phosphorus stress, the plant expression vector carrying the GmMYB48 is converted into the soybean hairy root by using an agrobacterium rhizogenes-mediated conversion system, and compared with a control, the number of root hairs of the soybean hairy root over-expressing GmMYB48 is increased, and the phosphorus absorption amount is also remarkably increased, so that the GmMYB48 gene can participate in regulating and controlling the adaptability of the soybean root system to the low phosphorus stress;

(2) according to the invention, a transgenic plant with remarkably improved low-phosphorus stress resistance is obtained by introducing a GmMYB48 gene into a plant cell; the GmMYB48 gene has positive regulation and control effects on phosphorus metabolism in soybeans and has important significance in breeding of high-phosphorus-absorption soybean varieties.

Drawings

FIG. 1 is an expression analysis diagram of soybean GmMYB48 gene; wherein soybean seedlings are treated with low phosphorus at 0d, 1d, 5d and 10d respectively, and then phosphorus supply is recovered for 1 day (R-11d) to explore the change of gene expression level; values are expressed as mean ± standard deviation of 3 replicates;

FIG. 2 is a plasmid map of a plant expression vector pCAMBIA3301-GmMYB48 constructed in the invention;

FIG. 3(A) is a comparison of water culture of transgenic soybean seedlings versus non-transgenic soybean seedlings; FIG. 3(B) is a comparison of transgenic soybean roots with non-transgenic soybean roots; wherein ck is a non-load-transferred soybean seedling, and OX is a transgenic soybean seedling;

FIG. 4 is a PCR identification electrophoresis chart of transformed soybean hairy roots;

FIG. 5(A) is a comparison of the dry weight of transgenic and non-transgenic soybean root systems; FIG. 5(B) is a comparison of phosphorus content in transgenic and non-transgenic soybean root systems; FIG. 5(C) is a comparison of transgenic root system versus non-transgenic soybean root system length; wherein ck is a non-load-transferred soybean seedling, and OXYB 48 is a transgenic soybean seedling;

FIG. 6 is a comparison of the expression level of a phosphorus starvation-associated gene in transgenic soybean under normal and low phosphorus conditions with that of the wild type;

FIG. 7(A) is the result of the interaction between GmMYB48 and GmSPX1 verified by the yeast two-hybrid experiment; FIG. 7(B) shows the result of the interaction between GmMYB48 and GmSPX1 verified by bimolecular fluorescence complementation experiment;

FIG. 8 shows the relative expression changes of GmMYB48 in soybeans under the conditions of cold treatment, heat treatment, salt treatment and drought treatment.

Detailed Description

To further illustrate the technical means and effects of the present invention, the following further describes the technical solutions of the present invention by way of specific embodiments with reference to the drawings, but the present invention is not limited to the scope of the embodiments.

The procedures, conditions, reagents, experimental methods and the like for carrying out the present invention are general knowledge and common general knowledge in the art except for the contents specifically mentioned below, and the present invention is not particularly limited. Various procedures and methods not described in detail are conventional methods well known in the art. The primers used are indicated for the first time and the same primers used thereafter are indicated for the first time.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present specification, including definitions, will control.

Example 1 cloning of Soybean Low phosphorus resistance-related Gene GmMYB48

(1) Designing primers, extracting RNA, inverting cDNA:

total RNA from leaves of the soybean variety Williams 82 was extracted using a plant Total RNA extraction kit (DP432, Tiangen), and the integrity of the RNA was checked by 1% agarose gel electrophoresis. cDNA Synthesis was performed according to the instructions of SYBR PrimeScript RT-PCR Kit II (TaKaRa Co., Ltd.), and primers were designed as follows:

Seq ID NO.3：GmMYB48-F 5’-ATGGGAAGGTCCCCTTGCT-3’；

Seq ID NO.4：GmMYB48-R 5’-TCATTTCATGTGCAAGGTTCTGT-3’。

(2) PCR amplification comprises the following specific steps:

A) the method comprises the following steps PCR reaction solution (50. mu.l system) was prepared according to the following component sequence: 5 XSSF buffer (10. mu.l), ddH₂O (33. mu.l), dNTP (1. mu.l), GmMYB48-F (2. mu.l), GmMYB48-R (2. mu.l), cDNA (2. mu.l), KOD FX enzyme (1. mu.l);

B) the method comprises the following steps The PCR was set to the reaction program: denaturation at 95 deg.C for 5 min; then, the temperature is increased to 95 ℃ for 10s, the temperature is increased to 58 ℃ for 30s, the temperature is increased to 72 ℃ for 1min, and 33 cycles are carried out; then extending for 7min at 72 ℃; storing at4 deg.C;

C) the method comprises the following steps After the PCR product is recovered, the PCR product is connected with a PMD19-T vector (TaKaRa), transformed escherichia coli DH5 alpha, screened with blue white spot, shaken and sequenced, and the sequence is shown as SEQ ID NO. 1.

Example 2 fluorescent quantitative analysis of Soybean Low phosphorus resistance related Gene GmMYB48

(1) Selecting cDNA samples of soybean roots and leaves with treatment time of 0d, 1d, 5d, 10d and R-11d (recovery treatment for 1 day) respectively as materials, and selecting IQSYBR Green (Bio-Rad, Hercules, CA, USA) as a fluorescence quantitative PCR (qRT-PCR) kit;

(2) design of primers

Designing a fluorescent quantitative specific primer aiming at a GmMYB48 gene sequence as follows:

seq ID No. 5: an upstream primer 5'-CTTTCACCATGAACGCTGCC-3';

seq ID No. 6: the downstream primer 5'-GTGGAGGGCACAGCTACAAT-3'.

The internal reference gene adopts Tubulin, and the primer sequence is as follows:

seq ID No. 7: an upstream primer 5'-GGAGTTCACAGAGGCAGAG-3';

seq ID No. 8: the downstream primer 5'-CACTTACGCATCACATAGCA-3'.

(3) Performing fluorescent quantitative PCR amplification, and specifically comprising the following steps:

A) the method comprises the following steps A PCR reaction system (20 mu L system) is prepared according to the following component sequence: 2 XSuperReal PreMix (SYBRGreen) (10. mu.L), primers (0.5. mu.L each), cDNA (2. mu.L), ddH2O (7. mu.L);

B) the method comprises the following steps The PCR reaction was carried out using ABI 7500system type fluorescent quantitative PCR instrument according to the following procedure: 5min at 95 ℃; then, 40 cycles of 95 ℃ for 15s and 60 ℃ for 30s are carried out;

C) the method comprises the following steps The results obtained by fluorescent quantitative PCR were all 2^-ΔΔCtCalculating the relative expression quantity of the gene by a method, wherein the Ct values of soybean root and leaf tissue cDNAs (complementary deoxyribonucleic acids) growing 0d, 1d, 5d, 10d and R-11d in a normal phosphorus environment are taken as a control group, and the Ct values of soybean root and leaf tissue cDNAs growing 0d, 1d, 5d, 10d and R-11d in a low phosphorus environment are taken as a treatment group; setting the delta value of 0d as 1, and calculating the expression multiples of the

treatment

1d, 5d, 10d and R-11d when compared with 0 d; the formula is as follows: 2^-ΔΔCt＝[(Cttreated-Ct control)sampleA-(Ct treated-Ct control)sampleB](ii) a Performing Student's t-test on the data calculated by the three biological replicates and the control group data in Excel 2007 software to obtain standard deviation of the three biological replicates with the change of the relative expression quantity of the treatment group, wherein P is 0.05; p ═ 0.01; the standard of 0.001 is plotted. As shown in figure 1, under the induction of low-phosphorus environment, the expression of GmMYB48 in soybean leaves and roots is continuously accumulated along with the prolonging of phosphorus starvation stress time, the relative expression quantity is remarkably increased and reaches the maximum value on the 10 th day; and after one day of phosphorus concentration recovery treatment, the expression level of GmMYB48 is significantly reduced compared with that of the tenth day, which indicates that the low-phosphorus environment can induce the expression of the GmMYB48 gene.

Example 3 preparation of Soybean hairy root transformed with GmMYB48 Gene

(1) By using a homologous recombination method, the full-length sequence of GmMYB48 cloned in example 1 is inserted into the CaMV35S promoter of pCAMBIA3301 in the forward direction to construct a recombinant plant expression vector pCAMBIA3301-GmMYB48, and the construction diagram of the expression vector is shown in FIG. 2.

(2) pCAMBIA3301-26-GmMYB48 and the empty plasmid pCAMBIA3301-26 were transferred into Agrobacterium rhizogenes strain K599(Biovector NTCC Inc.) by freeze-thawing method, and pCAMBIA3301-GmMYB48 and pCAMBIA3301 were transformed into soybean by Agrobacterium rhizogenes K599 mediated genetic transformation system, as follows:

A) the method comprises the following steps Seedling culture: selecting uniform soybean seeds, sterilizing for 15 hours by using chlorine, and placing the soybean seeds in a 25 ℃ illumination incubator under the illumination condition of 12h/d for vermiculite seedling culture;

B) the method comprises the following steps Induction of hairy roots: streaking strains preserved at-80 ℃ on a YEP solid culture medium and kanamycin (50mg/L), carrying out overnight culture at 28 ℃, then selecting a single colony in a YEP and kanamycin liquid culture medium, carrying out shake culture at 220r/min at 28 ℃ overnight, and selecting a bacterial liquid with vigorous colony growth for an infection test; in order to avoid the influence of seed quality and sowing depth, 60 soybean seedlings with consistent growth vigor and 5d seedling age are selected, and the agrobacterium rhizogenes liquid is injected into the soybean hypocotyl for 3 times by using a syringe needle; after inoculation, placing the seedlings in a seedling raising pot with a vent hole and a transparent cover for moisture preservation, and inducing hairy roots under the conditions of constant temperature of 28 ℃ and 16h/d illumination; after 12 days, hairy roots grow on the inoculated part; removing primary root, and transferring into 1/2 Hogland nutrient solution for 5 days;

C) the method comprises the following steps Low phosphorus stress treatment: transgenic shoots and unloaded shoots were transferred to low phosphorus treatment (Hogland nutrient solution in 1/2, where KH was replaced with KCl₂PO₄At 25 ℃ and 12h/d illumination); changing the nutrient solution every three days; after 7 days of low phosphorus stress, the relative phenotypes such as phosphorus content were determined as shown in FIG. 3: under normal and low phosphorus conditions, transgenic soybeans develop longer roots and more lateral roots than wild type, which facilitates phosphorus uptake by roots.

D) The method comprises the following steps And (3) positive identification: specific primers are designed by taking a 35S promoter and a GmMYB48 gene as target sequences, positive transformation strains are identified by PCR, the identification result is shown in figure 4, and a GmMYB48 clone gene is obtained, wherein the primer sequences are as follows:

seq ID No. 9: an upstream primer 5'-GAAAAAGAAGACGTTCCAACCACGT-3';

seq ID No. 10: the downstream primer 5'-TCATTTCATGTGCAAGGTTCTGT-3'.

Example 4 functional verification of GmMYB48 Gene

(1) Dividing the plant into an overground part and an underground part, putting the overground part and the underground part in an oven, deactivating enzymes for one hour at 105 ℃, drying the plant to constant weight at 60 ℃, and weighing the dry weight by using an electronic balance; as shown in fig. 5(a), the results indicate that the dry weight of the soybean hairy root overexpressing GmMYB48 is significantly increased.

The phosphorus content was determined by Perkinelmer Optima 2100DV ICP-OES system as follows:

A) the method comprises the following steps About 0.02g of the dry weight of the sample was weighed and 8mL of ddH was added₂O and 2mL HNO3, digestion with a microwave System (Milestone E)THOS) decocting at 200 deg.C for 10min, cooling to room temperature, and adding ddH₂O is added to a constant volume of 10 mL;

B) the method comprises the following steps The total phosphorus content of the sample is measured by a Perkinelmer Optima 2100DV ICP-OES system;

C) the method comprises the following steps The different concentrations were diluted with phosphorus standards (1000. mu.g/mL) and standard curves were generated.

The results are shown in fig. 5(B), and the assay results show that the phosphorus content of the soybean hairy root over-expressing GmMYB48 is significantly increased.

As shown in fig. 5(C), after 7 days of low phosphorus stress treatment, the length and root hair density of soybean hairy roots overexpressing GmMYB48 increased significantly, and the combination of significantly increased amount of aerial dry matter and phosphorus uptake, indicating that root hair density is affected by phosphorus availability, and that overexpression of GmMYB48 can significantly induce root hair increase and elongation.

(2) Expression of genes involved in phosphorus starvation induction

The expression quantity of the phosphorus hunger related gene after the transgenic seedling and the non-load transferred seedling are transplanted into the low phosphorus treatment is respectively detected, and the selected gene and the primer are as follows:

TABLE 1 primers used for qRT-PCR

Compared with WT, the expression quantities of other genes except the GmPHR1 of the phosphorus starvation related gene in the transgenic soybean under the low-phosphorus environment are greatly increased as shown in figure 6, and the result proves that the GmMYB48 can regulate and control a large amount of expression of the phosphorus starvation related gene on the soybean transcription level, so that the high-efficiency utilization of soybean phosphorus is improved.

Example 5 interaction of GmMYB48 with GmSPX1 protein

The interaction between GmMYB48 and GmSPX1 protein is verified by a yeast two-hybrid experiment and a bimolecular fluorescence complementation experiment.

1. Respectively constructing yeast two-hybrid vectors pGADT7-GmMYB48, pGBKT7-GmSPX1 and a bimolecular fluorescence complementary vector GmSPX1-pSAT1-nEYFP-C1, GmMYB48-pSAT 1-cEYFP-C1-B.

2. The constructed pGADT7-GmMYB48 plasmid and a bait pGBKT7-GmSPX1 plasmid are respectively transformed into yeast together, the yeast is cultured for 3 to 5 days, and the grown monoclonal is randomly selected and spotted on an X-alpha-Gal plate. The experimental results showed that randomly selected single clones of GmSPX1+ GmMYB48 on the four-deletion/X-alpha-Gal plates grew normally on the four-deletion medium and turned blue very quickly, demonstrating the interaction of GmMYB48 with the bait protein GmSPX1 in yeast cells (FIG. 7A).

3. The constructed GmSPX1-pSAT1-nEYFP-C1 plasmid and the GmMYB48-pSAT1-cEYFP-C1-B plasmid are jointly transformed into an arabidopsis protoplast, and fluorescence is observed under a laser confocal microscope. The results showed yellow fluorescence in protoplasts, demonstrating the interaction of GmMYB48 with GmSPX1 in Arabidopsis cells (FIG. 7B).

Example 6 response of GmMYB48 to other stress conditions

1) Selecting cDNA samples of soybean root tissues with the treatment time of 0h, 1h, 6h, 12h and 24h as materials, and selecting an IQSYBR Green (Bio-Rad, Hercules, Calif., USA) kit as a fluorescent quantitative PCR (qRT-PCR) kit;

(2) design of primers

seq ID No. 5: an upstream primer 5'-CTTTCACCATGAACGCTGCC-3';

seq ID No. 6: the downstream primer 5'-GTGGAGGGCACAGCTACAAT-3'.

seq ID No. 7: an upstream primer 5'-GGAGTTCACAGAGGCAGAG-3';

seq ID No. 8: the downstream primer 5'-CACTTACGCATCACATAGCA-3'.

C)：the results obtained by fluorescent quantitative PCR were all 2^-ΔΔCtCalculating the relative expression quantity of the gene by using the method, wherein Ct values of soybean root tissue cDNAs (complementary deoxyribonucleic acids) growing for 0h, 1h, 6h, 12h and 24h in a normal phosphorus environment are used as a control group, and Ct values of soybean root tissue cDNAs growing for 0h, 1h, 6h, 12h and 24h in a cold treatment, heat treatment, salt treatment and drought treatment environment are used as a treatment group; setting the delta value of 0h as 1, and calculating expression multiples of 1h, 6h, 12h and 24h in comparison with 0 h; the formula is as follows: 2^-ΔΔCt＝[(Ct treated-Ct control)sampleA-(Ct treated-Ct control)sampleB]Plotted as shown in fig. 8.

As can be seen from fig. 8, the expression of GmMYB48 in soybean roots did not change significantly with the increase of stress time under the induction of cold treatment, heat treatment, salt treatment and drought treatment environments, indicating that GmMYB48 specifically responds to phosphorus starvation environments.

In conclusion, the GmMYB48 gene is introduced into plant cells to obtain a transgenic plant with remarkably improved low-phosphorus stress resistance, and the GmMYB48 gene has an active regulation and control effect on phosphorus metabolism in soybeans and has important significance in breeding of high-phosphorus-absorption soybean varieties.

The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.

Sequence listing

<110> university of north and middle

Novel application of <120> GmMYB48 gene in improving plant phosphorus starvation stress tolerance

<130>2020

<141>2020-04-30

<160>10

<170>SIPOSequenceListing 1.0

<210>1

<211>708

<212>DNA

<213> Artificial Synthesis sequence ()

<400>1

atgggaaggt ccccttgctg tgagaaagca cacacaaaca aaggtgcatg gaccaaagaa 60

gaagatcatc gcctcatttc ttacattaga gctcacggtg aaggctgctg gcgctctctc 120

cccaaagccg ccggccttct ccgttgcggc aagagctgtc gtctccgctg gatcaactat 180

ctccgccctg acctcaagcg cggcaatttc tccctcgaag aagaccaact catcatcaaa 240

ctccacagcc tccttggcaa caagtggtct ctaattgctg gtagattgcc cggtagaact 300

gacaatgaga tcaagaatta ctggaatact cacatacgca ggaagcttct gagcagaggt 360

attgaccctg ccactcacag gcctctcaac gattcttctc atcaagaacc tgctgctgtc 420

tctgcccctc ctaaacatca agagtccttt caccatgaac gctgccctga cttgaacctt 480

gagctaacca ttagtcctcc ccatcatcct caacctgatc atccgcactt gaagaccctt 540

gtgacaaact caaacctttg ctttccctgc agtctgggtt tgcataatag caaagattgt 600

agctgtgccc tccacactag tactgccaac gctactgcta ctggctatga tttcttggcc 660

ttgaaaacca ccgtcgtttt ggattacaga accttgcaca tgaaatga 708

<210>2

<211>235

<212>PRT

<213> Artificial Synthesis sequence ()

<400>2

Met Gly Arg Ser Pro Cys Cys Glu Lys Ala His Thr Asn Lys Gly Ala

1 5 10 15

Trp Thr Lys Glu Glu Asp His Arg Leu Ile Ser Tyr Ile Arg Ala His

20 25 30

Gly Glu Gly Cys Trp Arg Ser Leu Pro Lys Ala Ala Gly Leu Leu Arg

35 40 45

Cys Gly Lys Ser Cys Arg Leu Arg Trp Ile Asn Tyr Leu Arg Pro Asp

50 55 60

Leu Lys Arg Gly Asn Phe Ser Leu Glu Glu Asp Gln Leu Ile Ile Lys

65 70 75 80

Leu His Ser Leu Leu Gly Asn Lys Trp Ser Leu Ile Ala Gly Arg Leu

85 90 95

Pro Gly Arg Thr Asp Asn Glu Ile Lys Asn Tyr Trp Asn Thr His Ile

100 105 110

Arg Arg Lys Leu Leu Ser Arg Gly Ile Asp Pro Ala Thr His Arg Pro

115 120 125

Leu Asn Asp Ser Ser His Gln Glu Pro Ala Ala Val Ser Ala Pro Pro

130 135 140

Lys HisGln Glu Ser Phe His His Glu Arg Cys Pro Asp Leu Asn Leu

145 150 155 160

Glu Leu Thr Ile Ser Pro Pro His His Pro Gln Pro Asp His Pro His

165 170 175

Leu Lys Thr Leu Val Thr Asn Ser Asn Leu Cys Phe Pro Cys Ser Leu

180 185 190

Gly Leu His Asn Ser Lys Asp Cys Ser Cys Ala Leu His Thr Ser Thr

195 200 205

Ala Asn Ala Thr Ala Thr Gly Tyr Asp Phe Leu Ala Leu Lys Thr Thr

210 215 220

Val Val Leu Asp Tyr Arg Thr Leu His Met Lys

225 230 235

<210>3

<211>19

<212>DNA

<213> Artificial Synthesis sequence ()

<400>3

atgggaaggt ccccttgct 19

<210>4

<211>23

<212>DNA

<213> Artificial Synthesis sequence ()

<400>4

tcatttcatg tgcaaggttc tgt 23

<210>5

<211>20

<212>DNA

<213> Artificial Synthesis sequence ()

<400>5

ctttcaccat gaacgctgcc 20

<210>6

<211>20

<212>DNA

<213> Artificial Synthesis sequence ()

<400>6

gtggagggca cagctacaat 20

<210>7

<211>19

<212>DNA

<213> Artificial Synthesis sequence ()

<400>7

ggagttcaca gaggcagag 19

<210>8

<211>20

<212>DNA

<213> Artificial Synthesis sequence ()

<400>8

cacttacgca tcacatagca 20

<210>9

<211>25

<212>DNA

<213> Artificial Synthesis sequence ()

<400>9

gaaaaagaag acgttccaac cacgt25

<210>10

<211>23

<212>DNA

<213> Artificial Synthesis sequence ()

<400>10

tcatttcatg tgcaaggttc tgt 23

Claims

Application of a GmMYB48 gene, a protein coded by the GmMYB48 gene, a recombinant expression vector containing the GmMYB48 gene, an expression cassette containing the GmMYB48 gene, a transgenic cell line containing the GmMYB48 gene or a recombinant bacterium containing the GmMYB48 gene in production of transgenic plants with tolerance to stress caused by phosphorus starvation.
2. Use according to claim 1, for the prevention and/or treatment of stress caused by phosphorus starvation;

preferably, the transgenic plant is a dicotyledonous plant, preferably a plant of the genus glycine, and further preferably soybean.
3. The use of claim 1 or 2, wherein the GmMYB48 gene is a DNA molecule as described in any one of (1), (2) or (3) below: (1) a nucleotide sequence shown as SEQ ID NO. 1; (2) a nucleotide sequence which is hybridized with the nucleotide sequence defined in (1) under strict conditions and encodes a protein related to the capability of the plant to resist phosphorus hunger stress; (3) a nucleotide sequence having at least 80%, preferably 90% identity to the variable region of the nucleotide sequence defined in (1) and encoding a protein associated with the plant's ability to tolerate phosphorus starvation stress;

preferably, the GmMYB48 gene encodes a protein as described in (a) or (b) below: (a) an amino acid sequence shown as SEQ ID NO. 2; (b) and (b) a protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence defined in the step (a) and is related to the phosphorus starvation stress resistance of the plant and is derived from the sequence (a).
4. A DNA molecule having tolerance to stress caused by phosphorus starvation, comprising the DNA molecule according to any one of the following (1), (2) or (3): (1) a nucleotide sequence shown as SEQ ID NO. 1; (2) a nucleotide sequence which is hybridized with the nucleotide sequence defined in (1) under strict conditions and encodes a protein related to the capability of the plant to resist phosphorus hunger stress; (3) a nucleotide sequence having at least 80%, preferably 90% identity to the variable region of the nucleotide sequence defined in (1) and encoding a protein associated with the plant's ability to tolerate phosphorus starvation stress.
5. An expression cassette that is tolerant to stress caused by phosphorus starvation comprising a DNA molecule operably linked to the DNA molecule of claim 4.
6. A biological vector having tolerance to stress caused by phosphorus starvation, comprising the DNA molecule of claim 4 or the expression cassette of claim 5;

preferably, the biological vector is a pCAMBIA3301-26 plant overexpression vector.
7. A plant host cell having tolerance to stress caused by phosphorus starvation transformed with the biological vector of claim 6.
8. A transgenic plant having tolerance to stress caused by phosphorus starvation comprising the plant host cell of claim 7.
9. A method for treating and/or preventing damage caused by plant phosphorus starvation stress in a plant, comprising transforming a plant of interest with a host cell comprising the DNA molecule of claim 4, resulting in a transgenic plant with higher tolerance to phosphorus starvation stress than said plant of interest;

preferably, a method for treating and/or preventing damage caused by plant phosphorus starvation stress in a plant, comprising transforming a plant of interest with a host cell according to claim 7, resulting in a transgenic plant with higher tolerance to phosphorus starvation stress than said plant of interest.
10. A use of the method of claim 9 in plant breeding;

preferably, the plant is a dicotyledonous plant, preferably a plant of the genus glycine, further preferably soybean.