CN111893101B

CN111893101B - Bemisia tabaci MED cryptic acetyltransferase gene mof, application thereof and method for reducing low-temperature tolerance of Bemisia tabaci

Info

Publication number: CN111893101B
Application number: CN202010823673.2A
Authority: CN
Inventors: 吕志创; 梁林; 冀顺霞; 王晓迪; 申晓娜; 刘万学; 万方浩
Original assignee: Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Priority date: 2020-08-17
Filing date: 2020-08-17
Publication date: 2022-03-25
Anticipated expiration: 2040-08-17
Also published as: CN111893101A

Abstract

The invention relates to the technical field of agricultural biology, in particular to a bemisia tabaci MED cryptic acetyltransferase gene mof, application thereof and a method for reducing low-temperature tolerance of bemisia tabaci. The nucleotide sequence of the gene is shown as SEQ ID No:1, RNAi is carried out on the cryptophyte of tobacco whitefly MED, and the result shows that the low-temperature recovery time of the cryptophyte MED imagoes fed with dsBtmef is obviously prolonged, which shows that Btmef genes play a key role in the low-temperature tolerance of the cryptophyte MED imagoes of tobacco whitefly. The bemisia tabaci MED cryptohistone acetyltransferase gene mof can be used for destroying the low-temperature tolerance of bemisia tabaci, and further provides a theoretical basis for prevention and treatment of the bemisia tabaci.

Description

Bemisia tabaci MED cryptic acetyltransferase gene mof, application thereof and method for reducing low-temperature tolerance of Bemisia tabaci

Technical Field

The invention relates to the technical field of agricultural biology, in particular to a bemisia tabaci MED cryptic acetyltransferase gene mof, application thereof and a method for reducing low-temperature tolerance of bemisia tabaci.

Background

Bemisia tabaci Gennadius belongs to Hemiptera and Aleyrodidae, is a worldwide 'super pest', and causes great damage to agricultural systems all over the world due to the wide distribution and the diversity of feeding.

The mechanism of the invasion and successful expansion of the bemisia tabaci is multi-aspect and multi-level, and ecological adaptation is one of key links. Ecological factors influencing population expansion include illumination, temperature, humidity and the like, wherein the most obvious change is temperature. Insects belong to temperature-variable animals, and the external temperature influences all chemical reaction rates in the life activities of the insects and determines the spatial conception of proteins in the insects to a certain extent, and indirectly influences the vital characteristics of the insects such as reproduction rate, growth speed, development level and the like, so that the temperature becomes one of important factors for determining the geographical distribution and diffusion of the insects. The aleyrodids MED cryptic species can be successfully adapted to different geographical environments, and the strong temperature adaptability is one of key factors of the aleyrodids MED cryptic species. In the experiment of temperature selection of bemisia tabaci, the survival rate of bemisia tabaci is remarkably improved within 2 generations, and the fact that the rapid improvement of survival capability is an important strategy for survival in severe environment is shown. The mechanism of response of organisms to environmental variations within this short period of time is epigenetic related.

Epigenetic refers to the rapid and persistent effect on gene expression without altering the DNA sequence in response to environmental changes, and the phenotypic variation caused by epigenetic changes is a reversible change which mediates the rapid and plastic response of the organism to environmental disturbances and can improve the ability of the organism to adapt to environmental stress. Epigenetic regulation includes chromatin remodeling, histone modification, DNA methylation, non-coding RNA regulation, and the like. The extensive distribution of histone acetylation in eukaryotes is an important link in the process of gene expression regulation, and histone acetylation is generally considered to regulate gene transcription through the modification effect on chromatin and transcription related factors, and is closely related to the processes of gene expression regulation, genome stability maintenance and the like. Normally, histone acetylation leaves chromatin in a looser state, and genes on the chromatin are expressed, thereby activating transcription; whereas histone deacetylation makes chromatin structure compact and genes non-expressible, thereby inhibiting transcription. Histone modification plays a key role in expression regulation of genes related to biological defense, and the histone acetyl transferase gene mof participates in regulation of environmental stress to biological adversity and plays an important role in regulation of expression of genes related to abiotic stress. Its role in temperature stress of bemisia tabaci is unknown.

RNA interference (RNAi) is widely existed in biology, some genes in the insect body are silenced by RNAi technology, so that some abilities of the insect are enhanced or lost, and the functional gene expression can be inhibited at a certain time, so that the development of the insect stays at a certain stage, and the purpose of utilizing or preventing the damage of the insect is achieved. At present, target dsRNA is mainly fed, soaked or micro-injected into an insect to enter a body, and double-stranded RNA (dsRNA) with homologous complementary sequences with transcription product mRNA of a target gene can be specifically degraded after being introduced into a cell, so that corresponding functional phenotype deletion is generated. The dsRNA is fed to the bemisia tabaci, so that the dsRNA has the characteristics of simplicity, convenience, easiness in operation and the like, and can be applied to the research of the bemisia tabaci.

Disclosure of Invention

The invention aims to provide bemisia tabaci MED cryptohistone acetyltransferase.

Still another object of the present invention is to provide a bemisia tabaci MED cryptic acetyltransferase gene.

The invention further aims to provide application of the bemisia tabaci MED cryptic acetyltransferase gene.

It is a further object of the present invention to provide a method for reducing the low temperature tolerance of the aleyrodids MED crypt.

According to the specific embodiment of the invention, the Bemisia tabaci MED cryptic acetyltransferase gene mof is cloned for the first time, and the full-length nucleotide sequence of the cDNA is shown as SEQ ID No. 1:

ATGGCGGATGGTGTTTGCAAAATGCCCGAGAAAAAGTCAGACTTAGCTTGTAAAACGGACAAAAGTGACCGCAGTTCTAACGACAATGAAGATTCCGAATCATCCGAGGAACAGCCGCTCGATGTTGGAGAACATTATCTCGTCCGCAGGTCCAACGAATCTTGGCATCCAGCAGAAATAATCCAGACAAGGTACAATGATGCCGAAGGCCACTACGAATATTATGTCCATTATGAAGGTTTCAACAGGCGATTGGATGAGTGGGTTCCACGAGGAAGGATAATGAGTTCACGGTTCGACATGTCTGAGCAGAACTGGAAAAACAGCGATAAAAACTCAGTTGATCTGCTAGATCAATGCGACAGAAAAATAACAAGAAACCAAAAGCGAAGGCATGATGAAATTAACCATGTCCAAAAGACGTACGCTGAAATGGATCCTACAACTGCTGCCTTAGAAAAAGAGCATGAAGCTATTACGAAAGTGAAGTACATTGATAGGATCCAAATTGGTCGTTATGAAATAGACACCTGGTATTTTAGTCCCTACCCTGACGATTACGGCAAACAGTCCAAATTATGGATTTGTGAATTCTGCTTAAGATACATGCGCTTAGAGAAAACATATAGGTACCATATGAGTGAATGCATCTATCGACAGCCACCCGGAAAAGAAATCTATCGCAAAGGAACTTTGTCAATCTACGAAGTTGACGGCAGCGTAGAGAAAACATACTGTCAAAATCTATGTCTCCTGGCCAAATTGTTTCTAGATCATAAAACTCTTTACTTCGATGTAGAGCCATTTCTGTTCTACATCTTGTGTGTAGTCGATAAACATGGAGCACATCTTGTTGGTTATTTTTCAAAGGAAAAAGAGTCACCAGACTGCAATAACGTAGCATGTATTCTGACTTTGCCACCATTCCAACGTCAAGGCTACGGGAAGCTATTAATATCCTTTAGTTATGAACTTAGTAAGATGGAAGAATTAGTTGGAAGTCCAGAGAAGCCTCTGTCGGATCTTGGGAAGCTCTCCTACCGTTCGTATTGGTCATACGTCCTATTAGAAATTCTGCGACATTTCCGCGGTTCTTTATCCATCAAAGACTTAAGCGAATTGACAAGCATCGCCCAAACAGATATCATCTCAACATTGCAGTCAATGAACATGGTGAAATACTGGAAGGGTCAGCATGTCATCTGCGTCACATCCAAATTGGTAGAAGAGCATATCAAATCAGCGCAGTATAAAAGGCCAAAACTTATTGTAGACCCGACAGCTCTCAAGTGGATCCCGAGGAAACGAGAAAGTAAGACAGGAAAAAAGTAA

the amino acid sequence of the tobacco whitefly MED cryptic acetyltransferase gene mof is shown as the protein in SEQ ID NO. 2.

MADGVCKMPEKKSDLACKTDKSDRSSNDNEDSESSEEQPLDVGEHYLVRRSNESWHPAEIIQTRYNDAEGHYEYYVHYEGFNRRLDEWVPRGRIMSSRFDMSEQNWKNSDKNSVDLLDQCDRKITRNQKRRHDEINHVQKTYAEMDPTTAALEKEHEAITKVKYIDRIQIGRYEIDTWYFSPYPDDYGKQSKLWICEFCLRYMRLEKTYRYHMSECIYRQPPGKEIYRKGTLSIYEVDGSVEKTYCQNLCLLAKLFLDHKTLYFDVEPFLFYILCVVDKHGAHLVGYFSKEKESPDCNNVACILTLPPFQRQGYGKLLISFSYELSKMEELVGSPEKPLSDLGKLSYRSYWSYVLLEILRHFRGSLSIKDLSELTSIAQTDIISTLQSMNMVKYWKGQHVICVTSKLVEEHIKSAQYKRPKLIVDPTALKWIPRKRESKTGKK*

The invention provides application of the bemisia tabaci MED cryptic acetyltransferase gene mof.

The method for reducing the low-temperature tolerance of the aleyrodids MED cryptophyte comprises the step of feeding the dsRNA of the aleyrodids MED cryptophyte acetyltransferase gene mof.

The method for reducing the low-temperature tolerance of the meadow bug MED crypt species according to the invention, wherein the expression vector is obtained by using a nucleotide sequence shown as SEQ ID No: 3 and SEQ ID No: 4 to obtain the dsRNA.

According to the specific embodiment of the invention, the expression mode of the Btmod gene under temperature stress is analyzed, and the real-time fluorescence quantitative PCR result shows that the expression of the MED cryptomorphic Btmod gene is obviously increased compared with the control 26 ℃ after short-time temperature stress, and the expression is in an up-regulation trend. RNAi is carried out on the cryptophyte of the bemisia tabaci MED, and the result shows that the low-temperature recovery time of the cryptophyte MED imagoes fed with dsBtmofs is obviously prolonged, so that the Btmofs gene plays a key role in the low-temperature tolerance of the cryptophyte MED of bemisia tabaci. The bemisia tabaci MED cryptohistone acetyltransferase gene mof can be used for destroying the low-temperature tolerance of bemisia tabaci, and further provides a theoretical basis for prevention and treatment of the bemisia tabaci.

The histone acetyltransferase gene mof is cloned from the bemisia tabaci MED cryptic species for the first time, and the expression mode of the Btmof gene in the bemisia tabaci MED cryptic species under temperature stress is determined. In addition, reducing the expression of the gene directly reduces the low temperature tolerance of the hidden MED species. The obtained result lays a foundation for further researching the relationship between the temperature tolerance mechanism of the hidden species of the bemisia tabaci MED and the epigenetic histone and provides a basis for a method for controlling the harm of the bemisia tabaci by temperature adaptability in the future.

Drawings

FIG. 1 shows the analysis of expression patterns of Btmorf gene under different temperature stresses in Bemisia tabaci MED cryptic species;

FIG. 2 shows the change of Btmod expression under feeding target genes dsmof, dsEGFP, 10% sucrose solution and CK;

figure 3 shows the effect of dsRNA treatment of Btmof gene on cold tolerance of bemisia tabaci MED cryptophyte adults: and comparing the low-temperature recovery time of the tobacco whitefly MED cryptomorphic imagoes fed with Btmuf gene dsRNA, dsEGFP, a 10% sucrose solution and CK.

Detailed Description

Example 1: full-length cDNA sequence clone of Bemisia tabaci MED cryptomorphic Btmorf gene

200 heads of the bemisia tabaci adults are taken and put into a centrifugal tube with the volume of 1.5mL, the bemisia tabaci adults are frozen by liquid nitrogen and ground into powder by using a grinding rod, and then RNA is extracted and stored at the temperature of minus 80 ℃ for later use. The extracted RNA was reverse transcribed to synthesize cDNA according to the instructions of the full-scale gold reverse transcription kit (One-Step gDNA Removal and cDNA Synthesis SuperMix). PCR amplification was performed using the cDNA as template and primers MOF-F: CTTGCGTGCGGGATTCCAT and MOF-R: GCTCCAACCTGGCACCTACTGTT.

The open reading frame of the btmfo gene sequence is obtained to be 1332bp in length, the obtained gene has a nucleotide sequence shown as SEQ ID No. 1, the gene codes 443 amino acid sequences shown as SEQ ID No. 2, and the gene is histone acetyltransferase gene.

Example 2: analysis of expression characteristics of Btmuf Gene

(1) Extracting RNA and synthesizing cDNA of bemisia tabaci adults under different temperature stresses

Selecting the primarily eclosized MED cryptophyte adults, respectively carrying out stress treatment on the bemisia tabaci adults at the temperatures of 0, 12, 26, 35 and 40 ℃, immediately freezing in liquid nitrogen for 3 minutes after the stress is finished, and then preserving at the temperature of minus 80 ℃. RNA was extracted and reverse transcribed into cDNA according to the method of example 1. 4 biological replicates per treatment.

(2) Detecting Btmorf expression quantity at different temperatures by fluorescent quantitative PCR:

primers for Btbrm1 gene and two internal reference genes (EF 1-alpha, beta-tublin) of fluorescent quantitative PCR were designed:

Btmof-QF：TCTGACTTTGCCACCATTCCAACG

Btmof-QR：CGAACGGTAGGAGAGCTTCCCAAG

EF1-α-F：TAGCCTTGTGCCAATTTCCG

EF1-α-R：CCTTCAGCATTACCGTCC

β-tub-F：TGTCAGGAGTAACGACGTGTTTG

β-tub-R：TTCGGGAACGGTAAGTGCTC

the reaction system is 20 μ L: hieff qPCR SYBR Green Master Mix 10.0. mu. L, cDNA template 1.0. mu. L, Primer-F1.0. mu. L, Primer-R1.0. mu. L, ddH2O 7.0.0. mu.L.

Reaction conditions are as follows: 5min at 95 ℃; 10s at 95 ℃, 30s at 60 ℃ and 40 cycles; and drawing a melting curve.

(3) Data analysis

The relative expression quantity of the gene is calculated by a 2-delta-Ct method. Data were statistically analyzed using SAS9.4 software, differences between different temperature treatments were analyzed using one-way analysis of variance (ANOVA), and Duncan's test was performed. Data are expressed as mean ± standard error with significance test level P < 0.05.

As shown in figure 1, a real-time fluorescent quantitative PCR result shows that the expression level of the MED cryptomorphic Btmorf gene is remarkably increased after high-low temperature short-time stress treatment and is in an up-regulation trend.

Example 3: analyzing the influence of Btbrm1 gene on cold resistance of Bemisia tabaci MED cryptophyte

3.1 Synthesis of dsRNA

(1) Primer sequences were designed to synthesize plus the T7 promoter (sequence underlined):

T7+Btmof-F：5’-TAATACGACTCACTATAGGGCGCTGAAATGGATCCTACTACTGC-3’(SEQ ID No：3)；

T7+Btmof-R：5’-TAATACGACTCACTATAGGGGTTGGAATGGTGGCAAAGTCAG-3' (SEQ ID No: 4). Synthesized by Shanghai Biotechnology service, Inc.

(2) Total RNA extraction and cDNA synthesis: the same as in example 1.

(3) And (3) carrying out PCR amplification and product purification on the T7 primer, wherein the purified PCR product is the template for synthesizing dsRNA. dsRNA was synthesized and purified using the kit, following the kit instructions.

3.2dsRNA feeding

The Parafilm membrane was previously treated with DEPC water to remove RNase. Adding dsRNA into sucrose solution with the concentration of 10%, wherein the concentration is 0.3-0.5 mu g/mu L. According to the feeding characteristics of the bemisia tabaci, the method for clamping the nutrient solution by the Parafilm membrane is correspondingly improved: taking about 200 heads of the primary eclosion bemisia tabaci adults, putting the initial eclosion bemisia tabaci adults into a glass tube with two transparent ends, covering the upper end of the glass tube with a double-layer Parafilm, adding 200 mu L of 10% sucrose solution between the two films, adding dsRNA to enable the final concentration to be 0.3-0.5 mu g/mu L, covering the lower end of the glass tube with gauze, and keeping ventilation. The periphery and the lower end of the glass tube are wrapped by black plastic, so that the bemisia tabaci can gather to a parafilm at the top end to take dsRNA better, the device is placed into an artificial climate box (the temperature is 26 +/-0.5 ℃, the illumination is carried out for 24 hours, the relative humidity is 60-70 percent), and feeding is carried out for 3 hours. The fed Bemisia tabaci is divided into two groups, wherein one group is frozen quickly by liquid nitrogen and then stored to detect the silencing efficiency of target genes. And collecting the other group in a finger-shaped pipe, placing the finger-shaped pipe on a buoy, placing the finger-shaped pipe in a pre-cooled low-temperature water bath pot for stress treatment, namely recording the low-temperature knock-down of the direct low-temperature exposure of the mealybug MED at the temperature of-5 ℃ after feeding dsRNA, and observing the standing recovery time of the mealybug at room temperature. Bemisia tabaci without any treatment (CK), fed with a 10% sucrose solution and fed with a 10% sucrose mixed solution containing dsEGFP (final concentration of dsEGFP 0.3-0.5. mu.g/. mu.L) was used as a control, and 4 biological replicates were set for each treatment.

Through 2^-ΔΔCTThe relative expression quantity of the gene is calculated by the method, and the result is shown in figure 2, and the expression of the Btmuf gene can be obviously knocked down by feeding dsBtmuf. SAS9.4 statistical software is used for analyzing the low-temperature recovery time of the Bemisia tabaci MED hidden seeds fed with different solutions, the result is shown in figure 3, and the recovery time of the Bemisia tabaci MED hidden seeds fed with Btmuf gene dsRNA is obviously higher than the knock-down time (P) of a CK group, a dsEGFP group and a sucrose group<0.05); meanwhile, NCBI (http:// BLAST. NCBI. nlm. nih. gov /) BLAST shows that the fed target sequence has a sequence specific to the Btmoff gene, so that the interference effect is ensured to be generated by the Btmoff gene of the purpose of the Bemisia tabaci MED cryptic species, and therefore, the Btmoff gene plays a key role in the low-temperature cold resistance of the Bemisia tabaci MED cryptic species.

The full-length cDNA of the Btmorf gene is cloned from the hidden seed of Bemisia tabaci MED, and the difference of the expression quantity of the Btmorf gene at different temperatures is displayed by fluorescent quantitative PCR; and finally, the low-temperature recovery time of the bemisia tabaci MED saphenocarpic imagoes is prolonged by feeding Btmorf gene dsRNA. According to the specific embodiment of the invention, the test result confirms that the Btmorf gene plays a key role in the low-temperature tolerance of the Bemisia tabaci MED cryptic species. The method lays a foundation for further researching the relationship between the temperature tolerance mechanism of the hidden species of the bemisia tabaci MED and the histone acetylation of epigenetic inheritance, and provides a basis for a method for controlling the harm of the bemisia tabaci by temperature adaptability in the future.

Sequence listing

<110> institute of plant protection of Chinese academy of agricultural sciences

<120> bemisia tabaci MED cryptohistone acetyltransferase gene mof, application thereof and method for reducing low-temperature tolerance of bemisia tabaci

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1332

<212> DNA

<213> Bemisia tabaci (Bemis tabaci)

<400> 1

atggcggatg gtgtttgcaa aatgcccgag aaaaagtcag acttagcttg taaaacggac 60

aaaagtgacc gcagttctaa cgacaatgaa gattccgaat catccgagga acagccgctc 120

gatgttggag aacattatct cgtccgcagg tccaacgaat cttggcatcc agcagaaata 180

atccagacaa ggtacaatga tgccgaaggc cactacgaat attatgtcca ttatgaaggt 240

ttcaacaggc gattggatga gtgggttcca cgaggaagga taatgagttc acggttcgac 300

atgtctgagc agaactggaa aaacagcgat aaaaactcag ttgatctgct agatcaatgc 360

gacagaaaaa taacaagaaa ccaaaagcga aggcatgatg aaattaacca tgtccaaaag 420

acgtacgctg aaatggatcc tacaactgct gccttagaaa aagagcatga agctattacg 480

aaagtgaagt acattgatag gatccaaatt ggtcgttatg aaatagacac ctggtatttt 540

agtccctacc ctgacgatta cggcaaacag tccaaattat ggatttgtga attctgctta 600

agatacatgc gcttagagaa aacatatagg taccatatga gtgaatgcat ctatcgacag 660

ccacccggaa aagaaatcta tcgcaaagga actttgtcaa tctacgaagt tgacggcagc 720

gtagagaaaa catactgtca aaatctatgt ctcctggcca aattgtttct agatcataaa 780

actctttact tcgatgtaga gccatttctg ttctacatct tgtgtgtagt cgataaacat 840

ggagcacatc ttgttggtta tttttcaaag gaaaaagagt caccagactg caataacgta 900

gcatgtattc tgactttgcc accattccaa cgtcaaggct acgggaagct attaatatcc 960

tttagttatg aacttagtaa gatggaagaa ttagttggaa gtccagagaa gcctctgtcg 1020

gatcttggga agctctccta ccgttcgtat tggtcatacg tcctattaga aattctgcga 1080

catttccgcg gttctttatc catcaaagac ttaagcgaat tgacaagcat cgcccaaaca 1140

gatatcatct caacattgca gtcaatgaac atggtgaaat actggaaggg tcagcatgtc 1200

atctgcgtca catccaaatt ggtagaagag catatcaaat cagcgcagta taaaaggcca 1260

aaacttattg tagacccgac agctctcaag tggatcccga ggaaacgaga aagtaagaca 1320

ggaaaaaagt aa 1332

<210> 2

<211> 443

<212> PRT

<213> Bemisia tabaci (Bemis tabaci)

<400> 2

Met Ala Asp Gly Val Cys Lys Met Pro Glu Lys Lys Ser Asp Leu Ala

1 5 10 15

Cys Lys Thr Asp Lys Ser Asp Arg Ser Ser Asn Asp Asn Glu Asp Ser

20 25 30

Glu Ser Ser Glu Glu Gln Pro Leu Asp Val Gly Glu His Tyr Leu Val

35 40 45

Arg Arg Ser Asn Glu Ser Trp His Pro Ala Glu Ile Ile Gln Thr Arg

50 55 60

Tyr Asn Asp Ala Glu Gly His Tyr Glu Tyr Tyr Val His Tyr Glu Gly

65 70 75 80

Phe Asn Arg Arg Leu Asp Glu Trp Val Pro Arg Gly Arg Ile Met Ser

85 90 95

Ser Arg Phe Asp Met Ser Glu Gln Asn Trp Lys Asn Ser Asp Lys Asn

100 105 110

Ser Val Asp Leu Leu Asp Gln Cys Asp Arg Lys Ile Thr Arg Asn Gln

115 120 125

Lys Arg Arg His Asp Glu Ile Asn His Val Gln Lys Thr Tyr Ala Glu

130 135 140

Met Asp Pro Thr Thr Ala Ala Leu Glu Lys Glu His Glu Ala Ile Thr

145 150 155 160

Lys Val Lys Tyr Ile Asp Arg Ile Gln Ile Gly Arg Tyr Glu Ile Asp

165 170 175

Thr Trp Tyr Phe Ser Pro Tyr Pro Asp Asp Tyr Gly Lys Gln Ser Lys

180 185 190

Leu Trp Ile Cys Glu Phe Cys Leu Arg Tyr Met Arg Leu Glu Lys Thr

195 200 205

Tyr Arg Tyr His Met Ser Glu Cys Ile Tyr Arg Gln Pro Pro Gly Lys

210 215 220

Glu Ile Tyr Arg Lys Gly Thr Leu Ser Ile Tyr Glu Val Asp Gly Ser

225 230 235 240

Val Glu Lys Thr Tyr Cys Gln Asn Leu Cys Leu Leu Ala Lys Leu Phe

245 250 255

Leu Asp His Lys Thr Leu Tyr Phe Asp Val Glu Pro Phe Leu Phe Tyr

260 265 270

Ile Leu Cys Val Val Asp Lys His Gly Ala His Leu Val Gly Tyr Phe

275 280 285

Ser Lys Glu Lys Glu Ser Pro Asp Cys Asn Asn Val Ala Cys Ile Leu

290 295 300

Thr Leu Pro Pro Phe Gln Arg Gln Gly Tyr Gly Lys Leu Leu Ile Ser

305 310 315 320

Phe Ser Tyr Glu Leu Ser Lys Met Glu Glu Leu Val Gly Ser Pro Glu

325 330 335

Lys Pro Leu Ser Asp Leu Gly Lys Leu Ser Tyr Arg Ser Tyr Trp Ser

340 345 350

Tyr Val Leu Leu Glu Ile Leu Arg His Phe Arg Gly Ser Leu Ser Ile

355 360 365

Lys Asp Leu Ser Glu Leu Thr Ser Ile Ala Gln Thr Asp Ile Ile Ser

370 375 380

Thr Leu Gln Ser Met Asn Met Val Lys Tyr Trp Lys Gly Gln His Val

385 390 395 400

Ile Cys Val Thr Ser Lys Leu Val Glu Glu His Ile Lys Ser Ala Gln

405 410 415

Tyr Lys Arg Pro Lys Leu Ile Val Asp Pro Thr Ala Leu Lys Trp Ile

420 425 430

Pro Arg Lys Arg Glu Ser Lys Thr Gly Lys Lys

435 440

<210> 3

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

taatacgact cactataggg cgctgaaatg gatcctacta ctgc 44

<210> 4

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

taatacgact cactataggg gttggaatgg tggcaaagtc ag 42

Claims

1. A method for reducing the low temperature tolerance of Bemisia tabaci, comprising the step of feeding dsRNA of a Bemisia tabaci MED cryptic acetyltransferase gene to the Bemisia tabaci, wherein the nucleotide sequence of the Bemisia tabaci MED cryptic acetyltransferase gene is shown as SEQ ID No:1, by using a nucleotide sequence shown as SEQ ID No: 3 and SEQ ID No: 4 to obtain the dsRNA.