CN114437192B - Tomato leaf miner chromatin remodelling factor ISWI, and encoding gene and application thereof - Google Patents

Tomato leaf miner chromatin remodelling factor ISWI, and encoding gene and application thereof Download PDF

Info

Publication number
CN114437192B
CN114437192B CN202210050393.1A CN202210050393A CN114437192B CN 114437192 B CN114437192 B CN 114437192B CN 202210050393 A CN202210050393 A CN 202210050393A CN 114437192 B CN114437192 B CN 114437192B
Authority
CN
China
Prior art keywords
leaf miner
tomato leaf
glu
iswi
lys
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210050393.1A
Other languages
Chinese (zh)
Other versions
CN114437192A (en
Inventor
吕志创
冀顺霞
吴强文
王晓迪
唐艳红
毕思言
刘万学
张桂芬
万方浩
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Original Assignee
Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Plant Protection of Chinese Academy of Agricultural Sciences filed Critical Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Priority to CN202210050393.1A priority Critical patent/CN114437192B/en
Publication of CN114437192A publication Critical patent/CN114437192A/en
Application granted granted Critical
Publication of CN114437192B publication Critical patent/CN114437192B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N57/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
    • A01N57/10—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds
    • A01N57/16—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds containing heterocyclic radicals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Agronomy & Crop Science (AREA)
  • Physics & Mathematics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Dentistry (AREA)
  • Insects & Arthropods (AREA)
  • Environmental Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pest Control & Pesticides (AREA)
  • Toxicology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The application relates to the field of insect control, in particular to a tomato leaf miner chromatin remodelling factor ISWI, and a coding gene and application thereof. The amino acid sequence of the chromatin remodeling factor ISWI is shown in SEQ ID NO: 2. The application clones and obtains the chromatin remodelling factor ISWI gene from the new important invasive pest tomato leaf miner for the first time, and the invasive pest ovum injection of the gene dsRNA leads to the ovarian malformation, the remarkable reduction of spawning quantity and the remarkable shortening of the adult life. The obtained result provides a new way for preventing and controlling new invasion pests by utilizing RNAi.

Description

Tomato leaf miner chromatin remodelling factor ISWI, and encoding gene and application thereof
Technical Field
The application relates to the field of insect control, in particular to a tomato leaf miner chromatin remodelling factor ISWI, and a coding gene and application thereof.
Background
The tomato leaf miner Tuta absorber is native to the secret of south America, is a world quarantine pest and causes destructive disasters to crops such as tomatoes. The tomato leaf miner is mainly endangered by larvae, female adults lay eggs on the leaves which are just unfolded, and once the larvae are hatched, the larvae submerge into tissues of host plants and dive into the leaves. If no control measures are taken, the pest may lead to a 80-100% reduction in tomato yield. Meanwhile, with the continuous use of chemical pesticides, the drug resistance of the chemical pesticides is promoted to be continuously enhanced, and the chemical pesticides can quickly generate resistance to various drug targets.
RNA interference (RNAinterference, RNAi) phenomenon is an evolutionarily conserved defense mechanism against the invasion of transgenes or foreign viruses. RNAi is widely used in the biological world and is a technique of silencing some genes in insects so that some abilities of the insects are enhanced or lost, and inhibiting the expression of functional genes at a specific time can also enable the development of the insects to stay at a certain stage. Since RNA interference technology has insect selectivity and gene specificity, it is not only an important means of gene function research, but also a bioengineering technology most likely to be applied to pest control so far. The RNAi technology is used for biological pest control, and one of the key steps is screening target genes.
Chromatin remodeling (chromatin remodeling) is one of the epigenetic important components. Within eukaryotic cells there are a range of specific chromatin remodeling factors that promote the dynamic binding of DNA to proteins in chromatin. These factors are multi-subunit complexes, and utilize the energy generated by ATP hydrolysis to alter chromatin states by means of sliding nucleosomes or the like, thereby regulating the expression of specific genes. Chromatin remodeling plays a key role in the expression regulation of genes related to biological development and reproduction, and a chromatin remodeling factor ISWI (imitation SWI) can participate in the regulation of biological development and reproduction and plays an important role in regulating the expression of genes related to development and reproduction. ISWI silencing results in reduced longevity, ovarian malformation, reduced spawning, etc. Therefore, the application provides a novel pest control molecular target based on RNA interference technology, and is expected to provide a new thought for the control of tomato leaf miner so as to achieve an effective control effect.
Disclosure of Invention
The application aims to provide a tomato leaf miner chromatin remodeling factor.
It is still another object of the present application to provide a gene encoding the above-mentioned tomato leaf miner chromatin remodeling factor ISWI.
It is still another object of the present application to provide the use of the above-mentioned coding gene.
According to the specific embodiment of the application, the tomato leaf miner chromatin remodelling factor ISWI is cloned for the first time, and the full-length nucleotide sequence of cDNA is shown as SEQ ID NO. 1:
ATGTCACAACCTGATGAAGCTATGGATGTAGGGGACGTGGAAGAAAACTCTAATGAGTCGTCCAGCGATACCACGTCCTCAAAGGGTAAAGAAGGAGACTTCGAAAGTAAAATTGAGACCGATCGTTCCAAGCGTTTTGATTTTTTGTTGAAACAAACTGAAATATTCTCGCATTTCATGACCAATGCGCCTAAAACCAGTAGTCCTCCTAAGGCTAAAGCCGGTCGACCTAAAAAGGTGAAAGAAGATCTGCCTGAGCAGTCTGAGGATGCTTCTGCAGCAGACCATCGGCACCGCAAGACTGAACAGGAAGAAGATGAGGAACTCCTTGCTGAGACAAACGCTAAGATTAAGCCAATATTTCGCTTTGAAGCATCACCTCCTTACATCAAGAATGGAGAAATGAGAGATTATCAAGTGAGAGGTCTCAACTGGATGATATCTCTCTATGAGAATGGTATTAATGGTATCTTGGCTGATGAGATGGGTCTGGGTAAAACATTACAAACCATTTCTCTTCTTGGCTACATGAAAAATTTCAGAAATATCCCTGGTCCACACATAGTAATTGTGCCAAAATCAACCCTAACCAACTGGATGAATGAGTTCAAAAAATGGTGTCCTTCCCTAAGAGCAGTGTGTCTTATTGGAGATCAGGAAACAAGGAACACATTCATCCGTGAAGTACTGATGCCTGGCAACTGGGATGTGTGCATCACCTCTTACGAGATGATTATCCGTGAGAGATCAGTATTTAAGAAGTTCACTTGGCGCTACATGGTGATTGACGAAGCCCATCGAATCAAGAATGAGAAGTCAAAGTTGTCAGAGCTTCTCCGGGAGTTCAAGAGTATGAACCGGCTGCTGCTCACTGGCACACCGTTGCAAAACAATCTTCACGAGCTGTGGGCACTTCTTAACTTCTTGTTACCAGATGTATTCAACAGCTCTGATGATTTTGACTCTTGGTTCAACACCAATGCAGCTCTCGGTGATAATCAGCTGGTGTCCCGGTTGCATGCTGTGTTGAGACCGTTCTTACTCAGACGTCTCAAATCTGAAGTAGAAAAGAAATTGAAACCCAAAAAGGAACTCAAAGTTTATGTTGGATTGAGTAAGATGCAAAGGGAGTGGTATACTAAAGTACTCATGAAGGATATTGATATTGTAAACGGCGCGGGCAAAGTCGAAAAGATGCGTCTCCAGAACATCCTGATGCAGCTCCGCAAGTGCTGCAACCACCCGTACCTGTTCGACGGCGCGGAGCCCGGCCCGCCCTACACCACGGACGAGCATCTCGTCTACAACTGCGGGAAACTCGCCATACTCGACAAACTGCTGCCCAAGCTGCAGCAGCAGGACTCCAGGGTGCTCATCTTCTCGCAGATGACCAGGATGCTGGATATTCTGGAGGATTATTGCCTGTGGAGGCAGTACAAGTACTGCCGCTTAGACGGTCAGACCCCACATGAAGACCGCAACCGACAGATCGAGGAGTATAACGCGGAAGGCTCCGAGAAGTTCGTGTTCATGTTGTCCACCCGCGCCGGCGGGCTGGGGATCAACCTCACCTCGGCAGATGTCGTCATCATATACGACTCCGACTGGAACCCGCAGATGGACCTGCAGGCGATGGACCGCGCGCATCGTATTGGGCAGATGAAACAAGTGCGCGTATTCAGACTGATCACGGAGAACACGGTGGAAGAGAAGATAGTGGAGCGCGCGGAAGTGAAACTACGCCTAGACAAGCTCGTAATCCAGTCCGGCCGGCTCGTGGACCAGAAGAACCAGCTCAACAAGGACGAAATGCTCAACATGATCAGGCACGGGGCCAACCACGTCTTCTCCTCGAAGGACTCCGAGATCACCGATGAGGATATTGACTCTATTCTAGCCAAAGGAGAGACCAAGACAGAAGAATTGAAACAGAAGTTGGAGAGCCTGGAGGAGTCATCTCTGAGAGCGTTCTCGATGGACACCCCCGGCGCGACCGACTCCGTCTACCAATTCGAAGGCGAGGACTACCGGGAGAAGCAGAAGTCGCACCCGCTGGGCAGCTGGATCGAGCCGCCGAAGCGCGAGCGCAAGGCCAACTACGCGGTGGACGCGTACTTCCGCGAGGCGCTGCGCGTCTCCGAGCCCAAGGCGCCGAAAGTGCAGGCGCCGCGCCCCCCCAAGCAGCCCATCGTGCAGGACTTCCAGTTCTTCCCGCCGAGGCTGTTCGAGCTGCTGGACCAGGAGATCTACCACTACAGAAAGACATTGGGGTACAAAGTGCCGCGTAACCCGGAGCTGGGCCCCGACGCGGCCAAGATACAGAGAGAGGAGCAGAGGAAGATCGACGACGCCGAAGCGCTCACCGAGGAGGAGGTTGCTGAGAAAGAAAACCTTCTCACTCAGGGTTTCACAAACTGGACAAAACGCGACTTCAACCAGTTCATCAAAGCTAATGAGAAGTATGGAAGGGATGACATCGAAAATATTGCAAAAGATGTCGAAGGAAAAACGCCCGAAGAGGTGATGGAATACTCGGCAGTGTTCTGGGAGCGCTGCCACGAGCTGCAGGACGTGGACCGGATCATGGGGCAGATCGAGCGCGGCGAGGCCAAGATACAGCGCCGCGCCTCCATCAAGAAGGCGCTCGACGCCAAGATGGCGCGCTACCGGGCGCCCTTCCACCAGCTCAGGATATCCTACGGGACTAACAAGGGGAAGAACTATGTCGAAGAAGAAGACAGGTTCCTGGTGTGCATGCTGCACAAGCTGGGCTTCGACAAGGAGAACGTGTACGAGGAGCTGCGCGCCGCCGTGCACGCCGCGCCGCAGTTCCGCTTCGACTGGTTCCTCAAGTCGCGCACGGCCGTGGAGCTGCAGCGCAGATGCAACACATTGATCACACTCATCGAAAGAGAGAACCAAGAGCTCGAAGAGAAGGAGCGCGCCGAGAAGAAAAAGAAGAGCGGCAGCGCCAACCAGAACACGCCCGGCGCCGCCAGCAAGGGCGCCGGCGCCGGCAAGCGCAAGGCAGACGCCGCGCAGGACTCCGCGCAGAAACAGAAGAAGAAGAAGAAATGA
the amino acid sequence of the tomato leaf miner chromatin remodelling factor ISW is shown in SEQ ID NO. 2:
MSQPDEAMDVGDVEENSNESSSDTTSSKGKEGDFESKIETDRSKRFDFLLKQTEIFSHFMTNAPKTSSPPKAKAGRPKKVKEDLPEQSEDASAADHRHRKTEQEEDEELLAETNAKIKPIFRFEASPPYIKNGEMRDYQVRGLNWMISLYENGINGILADEMGLGKTLQTISLLGYMKNFRNIPGPHIVIVPKSTLTNWMNEFKKWCPSLRAVCLIGDQETRNTFIREVLMPGNWDVCITSYEMIIRERSVFKKFTWRYMVIDEAHRIKNEKSKLSELLREFKSMNRLLLTGTPLQNNLHELWALLNFLLPDVFNSSDDFDSWFNTNAALGDNQLVSRLHAVLRPFLLRRLKSEVEKKLKPKKELKVYVGLSKMQREWYTKVLMKDIDIVNGAGKVEKMRLQNILMQLRKCCNHPYLFDGAEPGPPYTTDEHLVYNCGKLAILDKLLPKLQQQDSRVLIFSQMTRMLDILEDYCLWRQYKYCRLDGQTPHEDRNRQIEEYNAEGSEKFVFMLSTRAGGLGINLTSADVVIIYDSDWNPQMDLQAMDRAHRIGQMKQVRVFRLITENTVEEKIVERAEVKLRLDKLVIQSGRLVDQKNQLNKDEMLNMIRHGANHVFSSKDSEITDEDIDSILAKGETKTEELKQKLESLEESSLRAFSMDTPGATDSVYQFEGEDYREKQKSHPLGSWIEPPKRERKANYAVDAYFREALRVSEPKAPKVQAPRPPKQPIVQDFQFFPPRLFELLDQEIYHYRKTLGYKVPRNPELGPDAAKIQREEQRKIDDAEALTEEEVAEKENLLTQGFTNWTKRDFNQFIKANEKYGRDDIENIAKDVEGKTPEEVMEYSAVFWERCHELQDVDRIMGQIERGEAKIQRRASIKKALDAKMARYRAPFHQLRISYGTNKGKNYVEEEDRFLVCMLHKLGFDKENVYEELRAAVHAAPQFRFDWFLKSRTAVELQRRCNTLITLIERENQELEEKERAEKKKKSGSANQNTPGAASKGAGAGKRKADAAQDSAQKQKKKKK
the amino acid sequence has typical structural characteristics of ISWI proteins and comprises N-terminal ATPase domains (DEXDc and HELICc) and C-terminal HAND-SANT-SLIDE domains.
The application provides application of the tomato leaf miner chromatin remodelling factor ISWI. RNAi is carried out on the tomato leaf miner, and the result shows that the ovary of the tomato leaf miner eating dsISWI is deformed, the egg laying amount of adults is obviously reduced, which indicates that the ISWI gene plays a key role in reproduction and development of the tomato leaf miner. The dsRNA synthesized based on the tomato leaf miner ISWI gene fragment promotes the ovarian malformation and obviously reduces the oviposition amount of adults and obviously shortens the service life of adults, can be used as a molecular target for RNAi control of the tomato leaf miner, and has important practical significance for controlling the invasion pests.
The application clones and obtains the chromatin remodelling factor ISWI gene from the new important invasive pest tomato leaf miner for the first time, and the invasive pest ovum injection of the gene dsRNA leads to the ovarian malformation, the remarkable reduction of spawning quantity and the remarkable shortening of the adult life. The obtained result provides a new way for preventing and controlling new invasion pests by utilizing RNAi.
Drawings
FIG. 1 shows the variation of female adult ovaries under injection of ISWI gene dsRNA and dsEGFP;
FIG. 2 shows changes in ISWI gene expression profiles at different developmental stages;
FIG. 3 shows changes in ISWI expression levels under injection of ISWI gene dsRNA and dsEGFP;
FIG. 4 shows the variation of life span of tomato leaf miner by dsRNA injection with ISWI gene;
FIG. 5 shows the variation of oviposition amount of adult leaf miner of tomato by dsRNA treatment with ISWI gene;
figure 6 shows the change in hatchability of tomato potential She Eluan from dsRNA treatment with ISWI gene injection.
Detailed Description
Example 1: cloning of tomato leaf miner ISWI gene full-length cDNA sequence
4 heads of the tomato leaf miner larvae are taken and put into a 1.5mL centrifuge tube, frozen by liquid nitrogen, ground into powder by a grinding rod, and RNA is extracted and stored at-80 ℃ for standby. cDNA was synthesized by reverse transcription of the extracted RNA according to the full-scale Jin Fanzhuai recording kit (TransScript All-in-One First-Strand cDNA Synthesis SuperMix for PCR). The cDNA is used as a template, and a primer is designed for PCR amplification. The primers were designed as shown in Table 1:
TABLE 1 primer sequences for cloning full-length cDNA of TaISWI Gene
The full length of cDNA sequence of ISWI gene is 3078bp, and the obtained gene has nucleotide sequence shown as SEQ ID NO. 1, and the gene codes 1025 amino acid sequences shown as SEQ ID NO. 2. Analysis of the conserved domain of the amino acid sequence encoded by the cloned gene shows that it has typical structural features of ISWI proteins: comprises an N-terminal ATPase domain (DEXDc and HELICc) and a C-terminal HAND-SANT-SLIDE domain.
Example 2: analysis of influence of ISWI Gene on reproduction development of tomato leaf miner
1. Synthesis of dsRNA
(1) Primer sequences were designed to synthesize the plus T7 promoter:
T7+dsISWI-F：5’-TAATACGACTCACTATAGGGTATGGATGTAGGGGACG-3’
T7+dsISWI-R：5’-TAATACGACTCACTATAGGGCCAGTTGGTTAGGGTTG-3’。
synthesized by Shanghai Biotechnology services Inc.
(2) Total RNA extraction and cDNA synthesis: as in example 1.
(3) And (3) carrying out PCR amplification on the T7 primer, and purifying the product, wherein the purified PCR product is the template for synthesizing the dsRNA. dsRNA was synthesized and purified using the kit and was performed according to the kit instructions.
2. dsRNA injection method
(1) The mature female pupa before the emergence of the tomato leaf miner is collected and is arranged and adhered on the surface of a cover glass which is adhered with the breathable double-sided adhesive tape in advance. Injection of dsISWI (0.6 μg dsRNA injection) dsEGFP and ddH was performed internode using a Femtojet Express (Eppendorf) microinjection apparatus 2 O (0.1. Mu.l). After injection, female pupae were placed one-piece in a ventilated 1.5mL centrifuge tube, once eclosion, paired with newly eclosion wild type male adults and placed individually in plastic boxes, and enough fresh tomato leaves were provided for feeding, and the spawning quantity and life of the adults were counted. At the same time, adults that emerged for 4 days were randomly picked up, their ovaries were dissected and their morphological features were observed. To test RNAi interference efficiency, 4 tomato leaf miner after 72h injection was used for expression level detection, and 4 biological replicates were set for each treatment. As shown in FIG. 1, the variation of female adult ovaries under the conditions of injection of ISWI gene dsRNA and dsEGFP is shown, and the number of mature ova in female adult ovaries is obviously reduced after the injection of ISWI gene dsRNA compared with the control treatment.
(2) Through 2 -ΔΔCT The method calculates the relative expression quantity of the genes, and the result is shown as figure 2, which shows the variation of the expression profile of the ISWI genes in different development stages, and the expression quantity of the ISWI genes in two development stages of eggs and pupae is the highest. FIG. 3 shows the variation of ISWI expression under the conditions of injection of dsRNA of ISWI gene and dsEGFP, and the result shows that dsRNA injected with dsISWI can significantly knock down the expression of ISWI gene.
Analysis of egg laying amount and female life span of adult tomato leaf miner (fig. 5) after injection of different solutions using SAS 9.4 statistical software showed that total egg laying amount and life span of tomato leaf miner fed dsISWI gene dsRNA was significantly lower than that of dsEGFP group (P < 0.05). Fig. 6 shows the change in the hatchability of tomato latent She Eluan after injection of the ISWI gene dsRNA, which significantly inhibited hatching of tomato latent leaf moth eggs compared to the control.
Meanwhile, BLAST at NCBI (http:// BLAST. NCBI. Ni. Nih. Gov /) shows that the injected target sequence has a sequence specific to the ISWI gene, thereby ensuring that the interference effect is generated by the ISWI gene of the tomato leaf miner, and therefore, the ISWI gene plays a key role in the development and reproduction process of the tomato leaf miner.
The full-length cDNA of the ISWI gene is cloned from tomato leaf miner, and fluorescent quantitative PCR shows that the expression level of the ISWI gene is obviously reduced after double-stranded RNA of the target gene is injected; finally, through injection of ISWI gene dsRNA, the female tomato leaf miner spawning amount and service life are obviously reduced. According to the specific embodiment of the application, the experiment result shows that the ISWI gene plays a key role in the development and reproduction process of the tomato leaf miner in south America. The application lays a foundation for the research of effectively preventing and controlling the tomato leaf miner by utilizing RNAi, and provides a method basis for reducing the damage of the tomato leaf miner through the related research of chromatin remodelling factors in the future.
The above embodiments are only for explaining the technical solution of the present application, and do not limit the protection scope of the present application.
Sequence listing
<110> institute of plant protection of national academy of agricultural sciences
<120> a tomato leaf miner chromatin remodelling factor ISWI, and its coding gene and application
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 3078
<212> DNA
<213> tomato leaf miner (Tuta absorber)
<400> 1
atgtcacaac ctgatgaagc tatggatgta ggggacgtgg aagaaaactc taatgagtcg 60
tccagcgata ccacgtcctc aaagggtaaa gaaggagact tcgaaagtaa aattgagacc 120
gatcgttcca agcgttttga ttttttgttg aaacaaactg aaatattctc gcatttcatg 180
accaatgcgc ctaaaaccag tagtcctcct aaggctaaag ccggtcgacc taaaaaggtg 240
aaagaagatc tgcctgagca gtctgaggat gcttctgcag cagaccatcg gcaccgcaag 300
actgaacagg aagaagatga ggaactcctt gctgagacaa acgctaagat taagccaata 360
tttcgctttg aagcatcacc tccttacatc aagaatggag aaatgagaga ttatcaagtg 420
agaggtctca actggatgat atctctctat gagaatggta ttaatggtat cttggctgat 480
gagatgggtc tgggtaaaac attacaaacc atttctcttc ttggctacat gaaaaatttc 540
agaaatatcc ctggtccaca catagtaatt gtgccaaaat caaccctaac caactggatg 600
aatgagttca aaaaatggtg tccttcccta agagcagtgt gtcttattgg agatcaggaa 660
acaaggaaca cattcatccg tgaagtactg atgcctggca actgggatgt gtgcatcacc 720
tcttacgaga tgattatccg tgagagatca gtatttaaga agttcacttg gcgctacatg 780
gtgattgacg aagcccatcg aatcaagaat gagaagtcaa agttgtcaga gcttctccgg 840
gagttcaaga gtatgaaccg gctgctgctc actggcacac cgttgcaaaa caatcttcac 900
gagctgtggg cacttcttaa cttcttgtta ccagatgtat tcaacagctc tgatgatttt 960
gactcttggt tcaacaccaa tgcagctctc ggtgataatc agctggtgtc ccggttgcat 1020
gctgtgttga gaccgttctt actcagacgt ctcaaatctg aagtagaaaa gaaattgaaa 1080
cccaaaaagg aactcaaagt ttatgttgga ttgagtaaga tgcaaaggga gtggtatact 1140
aaagtactca tgaaggatat tgatattgta aacggcgcgg gcaaagtcga aaagatgcgt 1200
ctccagaaca tcctgatgca gctccgcaag tgctgcaacc acccgtacct gttcgacggc 1260
gcggagcccg gcccgcccta caccacggac gagcatctcg tctacaactg cgggaaactc 1320
gccatactcg acaaactgct gcccaagctg cagcagcagg actccagggt gctcatcttc 1380
tcgcagatga ccaggatgct ggatattctg gaggattatt gcctgtggag gcagtacaag 1440
tactgccgct tagacggtca gaccccacat gaagaccgca accgacagat cgaggagtat 1500
aacgcggaag gctccgagaa gttcgtgttc atgttgtcca cccgcgccgg cgggctgggg 1560
atcaacctca cctcggcaga tgtcgtcatc atatacgact ccgactggaa cccgcagatg 1620
gacctgcagg cgatggaccg cgcgcatcgt attgggcaga tgaaacaagt gcgcgtattc 1680
agactgatca cggagaacac ggtggaagag aagatagtgg agcgcgcgga agtgaaacta 1740
cgcctagaca agctcgtaat ccagtccggc cggctcgtgg accagaagaa ccagctcaac 1800
aaggacgaaa tgctcaacat gatcaggcac ggggccaacc acgtcttctc ctcgaaggac 1860
tccgagatca ccgatgagga tattgactct attctagcca aaggagagac caagacagaa 1920
gaattgaaac agaagttgga gagcctggag gagtcatctc tgagagcgtt ctcgatggac 1980
acccccggcg cgaccgactc cgtctaccaa ttcgaaggcg aggactaccg ggagaagcag 2040
aagtcgcacc cgctgggcag ctggatcgag ccgccgaagc gcgagcgcaa ggccaactac 2100
gcggtggacg cgtacttccg cgaggcgctg cgcgtctccg agcccaaggc gccgaaagtg 2160
caggcgccgc gcccccccaa gcagcccatc gtgcaggact tccagttctt cccgccgagg 2220
ctgttcgagc tgctggacca ggagatctac cactacagaa agacattggg gtacaaagtg 2280
ccgcgtaacc cggagctggg ccccgacgcg gccaagatac agagagagga gcagaggaag 2340
atcgacgacg ccgaagcgct caccgaggag gaggttgctg agaaagaaaa ccttctcact 2400
cagggtttca caaactggac aaaacgcgac ttcaaccagt tcatcaaagc taatgagaag 2460
tatggaaggg atgacatcga aaatattgca aaagatgtcg aaggaaaaac gcccgaagag 2520
gtgatggaat actcggcagt gttctgggag cgctgccacg agctgcagga cgtggaccgg 2580
atcatggggc agatcgagcg cggcgaggcc aagatacagc gccgcgcctc catcaagaag 2640
gcgctcgacg ccaagatggc gcgctaccgg gcgcccttcc accagctcag gatatcctac 2700
gggactaaca aggggaagaa ctatgtcgaa gaagaagaca ggttcctggt gtgcatgctg 2760
cacaagctgg gcttcgacaa ggagaacgtg tacgaggagc tgcgcgccgc cgtgcacgcc 2820
gcgccgcagt tccgcttcga ctggttcctc aagtcgcgca cggccgtgga gctgcagcgc 2880
agatgcaaca cattgatcac actcatcgaa agagagaacc aagagctcga agagaaggag 2940
cgcgccgaga agaaaaagaa gagcggcagc gccaaccaga acacgcccgg cgccgccagc 3000
aagggcgccg gcgccggcaa gcgcaaggca gacgccgcgc aggactccgc gcagaaacag 3060
aagaagaaga agaaatga 3078
<210> 2
<211> 1025
<212> PRT
<213> tomato leaf miner (Tuta absorber)
<400> 2
Met Ser Gln Pro Asp Glu Ala Met Asp Val Gly Asp Val Glu Glu Asn
1 5 10 15
Ser Asn Glu Ser Ser Ser Asp Thr Thr Ser Ser Lys Gly Lys Glu Gly
20 25 30
Asp Phe Glu Ser Lys Ile Glu Thr Asp Arg Ser Lys Arg Phe Asp Phe
35 40 45
Leu Leu Lys Gln Thr Glu Ile Phe Ser His Phe Met Thr Asn Ala Pro
50 55 60
Lys Thr Ser Ser Pro Pro Lys Ala Lys Ala Gly Arg Pro Lys Lys Val
65 70 75 80
Lys Glu Asp Leu Pro Glu Gln Ser Glu Asp Ala Ser Ala Ala Asp His
85 90 95
Arg His Arg Lys Thr Glu Gln Glu Glu Asp Glu Glu Leu Leu Ala Glu
100 105 110
Thr Asn Ala Lys Ile Lys Pro Ile Phe Arg Phe Glu Ala Ser Pro Pro
115 120 125
Tyr Ile Lys Asn Gly Glu Met Arg Asp Tyr Gln Val Arg Gly Leu Asn
130 135 140
Trp Met Ile Ser Leu Tyr Glu Asn Gly Ile Asn Gly Ile Leu Ala Asp
145 150 155 160
Glu Met Gly Leu Gly Lys Thr Leu Gln Thr Ile Ser Leu Leu Gly Tyr
165 170 175
Met Lys Asn Phe Arg Asn Ile Pro Gly Pro His Ile Val Ile Val Pro
180 185 190
Lys Ser Thr Leu Thr Asn Trp Met Asn Glu Phe Lys Lys Trp Cys Pro
195 200 205
Ser Leu Arg Ala Val Cys Leu Ile Gly Asp Gln Glu Thr Arg Asn Thr
210 215 220
Phe Ile Arg Glu Val Leu Met Pro Gly Asn Trp Asp Val Cys Ile Thr
225 230 235 240
Ser Tyr Glu Met Ile Ile Arg Glu Arg Ser Val Phe Lys Lys Phe Thr
245 250 255
Trp Arg Tyr Met Val Ile Asp Glu Ala His Arg Ile Lys Asn Glu Lys
260 265 270
Ser Lys Leu Ser Glu Leu Leu Arg Glu Phe Lys Ser Met Asn Arg Leu
275 280 285
Leu Leu Thr Gly Thr Pro Leu Gln Asn Asn Leu His Glu Leu Trp Ala
290 295 300
Leu Leu Asn Phe Leu Leu Pro Asp Val Phe Asn Ser Ser Asp Asp Phe
305 310 315 320
Asp Ser Trp Phe Asn Thr Asn Ala Ala Leu Gly Asp Asn Gln Leu Val
325 330 335
Ser Arg Leu His Ala Val Leu Arg Pro Phe Leu Leu Arg Arg Leu Lys
340 345 350
Ser Glu Val Glu Lys Lys Leu Lys Pro Lys Lys Glu Leu Lys Val Tyr
355 360 365
Val Gly Leu Ser Lys Met Gln Arg Glu Trp Tyr Thr Lys Val Leu Met
370 375 380
Lys Asp Ile Asp Ile Val Asn Gly Ala Gly Lys Val Glu Lys Met Arg
385 390 395 400
Leu Gln Asn Ile Leu Met Gln Leu Arg Lys Cys Cys Asn His Pro Tyr
405 410 415
Leu Phe Asp Gly Ala Glu Pro Gly Pro Pro Tyr Thr Thr Asp Glu His
420 425 430
Leu Val Tyr Asn Cys Gly Lys Leu Ala Ile Leu Asp Lys Leu Leu Pro
435 440 445
Lys Leu Gln Gln Gln Asp Ser Arg Val Leu Ile Phe Ser Gln Met Thr
450 455 460
Arg Met Leu Asp Ile Leu Glu Asp Tyr Cys Leu Trp Arg Gln Tyr Lys
465 470 475 480
Tyr Cys Arg Leu Asp Gly Gln Thr Pro His Glu Asp Arg Asn Arg Gln
485 490 495
Ile Glu Glu Tyr Asn Ala Glu Gly Ser Glu Lys Phe Val Phe Met Leu
500 505 510
Ser Thr Arg Ala Gly Gly Leu Gly Ile Asn Leu Thr Ser Ala Asp Val
515 520 525
Val Ile Ile Tyr Asp Ser Asp Trp Asn Pro Gln Met Asp Leu Gln Ala
530 535 540
Met Asp Arg Ala His Arg Ile Gly Gln Met Lys Gln Val Arg Val Phe
545 550 555 560
Arg Leu Ile Thr Glu Asn Thr Val Glu Glu Lys Ile Val Glu Arg Ala
565 570 575
Glu Val Lys Leu Arg Leu Asp Lys Leu Val Ile Gln Ser Gly Arg Leu
580 585 590
Val Asp Gln Lys Asn Gln Leu Asn Lys Asp Glu Met Leu Asn Met Ile
595 600 605
Arg His Gly Ala Asn His Val Phe Ser Ser Lys Asp Ser Glu Ile Thr
610 615 620
Asp Glu Asp Ile Asp Ser Ile Leu Ala Lys Gly Glu Thr Lys Thr Glu
625 630 635 640
Glu Leu Lys Gln Lys Leu Glu Ser Leu Glu Glu Ser Ser Leu Arg Ala
645 650 655
Phe Ser Met Asp Thr Pro Gly Ala Thr Asp Ser Val Tyr Gln Phe Glu
660 665 670
Gly Glu Asp Tyr Arg Glu Lys Gln Lys Ser His Pro Leu Gly Ser Trp
675 680 685
Ile Glu Pro Pro Lys Arg Glu Arg Lys Ala Asn Tyr Ala Val Asp Ala
690 695 700
Tyr Phe Arg Glu Ala Leu Arg Val Ser Glu Pro Lys Ala Pro Lys Val
705 710 715 720
Gln Ala Pro Arg Pro Pro Lys Gln Pro Ile Val Gln Asp Phe Gln Phe
725 730 735
Phe Pro Pro Arg Leu Phe Glu Leu Leu Asp Gln Glu Ile Tyr His Tyr
740 745 750
Arg Lys Thr Leu Gly Tyr Lys Val Pro Arg Asn Pro Glu Leu Gly Pro
755 760 765
Asp Ala Ala Lys Ile Gln Arg Glu Glu Gln Arg Lys Ile Asp Asp Ala
770 775 780
Glu Ala Leu Thr Glu Glu Glu Val Ala Glu Lys Glu Asn Leu Leu Thr
785 790 795 800
Gln Gly Phe Thr Asn Trp Thr Lys Arg Asp Phe Asn Gln Phe Ile Lys
805 810 815
Ala Asn Glu Lys Tyr Gly Arg Asp Asp Ile Glu Asn Ile Ala Lys Asp
820 825 830
Val Glu Gly Lys Thr Pro Glu Glu Val Met Glu Tyr Ser Ala Val Phe
835 840 845
Trp Glu Arg Cys His Glu Leu Gln Asp Val Asp Arg Ile Met Gly Gln
850 855 860
Ile Glu Arg Gly Glu Ala Lys Ile Gln Arg Arg Ala Ser Ile Lys Lys
865 870 875 880
Ala Leu Asp Ala Lys Met Ala Arg Tyr Arg Ala Pro Phe His Gln Leu
885 890 895
Arg Ile Ser Tyr Gly Thr Asn Lys Gly Lys Asn Tyr Val Glu Glu Glu
900 905 910
Asp Arg Phe Leu Val Cys Met Leu His Lys Leu Gly Phe Asp Lys Glu
915 920 925
Asn Val Tyr Glu Glu Leu Arg Ala Ala Val His Ala Ala Pro Gln Phe
930 935 940
Arg Phe Asp Trp Phe Leu Lys Ser Arg Thr Ala Val Glu Leu Gln Arg
945 950 955 960
Arg Cys Asn Thr Leu Ile Thr Leu Ile Glu Arg Glu Asn Gln Glu Leu
965 970 975
Glu Glu Lys Glu Arg Ala Glu Lys Lys Lys Lys Ser Gly Ser Ala Asn
980 985 990
Gln Asn Thr Pro Gly Ala Ala Ser Lys Gly Ala Gly Ala Gly Lys Arg
995 1000 1005
Lys Ala Asp Ala Ala Gln Asp Ser Ala Gln Lys Gln Lys Lys Lys Lys
1010 1015 1020
Lys
1025

Claims (6)

1. Chromatin remodeling factor of tomato leaf minerISWIThe amino acid sequence of the polypeptide is shown as SEQ ID NO: 2.
2. A tomato leaf miner chromatin remodeling factor gene, wherein the gene encodes a tomato leaf miner chromatin remodeling factor according to claim 1ISWI。
3. The tomato leaf miner chromatin remodeling factor gene as claimed in claim 2, wherein the nucleotide sequence of the tomato leaf miner chromatin remodeling factor gene is shown in SEQ ID No. 1.
4. A recombinant expression vector comprising the tomato leaf miner chromatin remodeling factor gene of claim 2.
5. A recombinant strain comprising the tomato leaf miner chromatin remodeling factor gene of claim 2.
6. The use of the tomato leaf miner chromatin remodeling factor gene of claim 2 as an RNAi interference target for interfering with the following traits by feeding tomato leaf miner with the dsRNA fragment of the tomato leaf miner chromatin remodeling factor gene of claim 2,
(1) Reducing the spawning quantity of female adults of the tomato leaf miner;
(2) Shortens the service life of female adults of the tomato leaf miner,
the dSRNA fragment of the tomato leaf miner chromatin remodeling factor gene is obtained by the following primers:
T7+dsISWI-F：5’-TAATACGACTCACTATAGGGTATGGATGTAGGGGACG-3’
T7+dsISWI-R：5’-TAATACGACTCACTATAGGGCCAGTTGGTTAGGGTTG-3’。
CN202210050393.1A 2022-01-17 2022-01-17 Tomato leaf miner chromatin remodelling factor ISWI, and encoding gene and application thereof Active CN114437192B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210050393.1A CN114437192B (en) 2022-01-17 2022-01-17 Tomato leaf miner chromatin remodelling factor ISWI, and encoding gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210050393.1A CN114437192B (en) 2022-01-17 2022-01-17 Tomato leaf miner chromatin remodelling factor ISWI, and encoding gene and application thereof

Publications (2)

Publication Number Publication Date
CN114437192A CN114437192A (en) 2022-05-06
CN114437192B true CN114437192B (en) 2023-09-29

Family

ID=81367038

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210050393.1A Active CN114437192B (en) 2022-01-17 2022-01-17 Tomato leaf miner chromatin remodelling factor ISWI, and encoding gene and application thereof

Country Status (1)

Country Link
CN (1) CN114437192B (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107109426A (en) * 2014-12-16 2017-08-29 美国陶氏益农公司 The parental generation RNAi of chromatin remodeling gene for controlling Hemipteran pest suppresses
CN107208098A (en) * 2014-12-16 2017-09-26 美国陶氏益农公司 For controlling coleopteran pest chromatin remodeling gene parental generation RNAI to suppress
CN111763253A (en) * 2020-07-29 2020-10-13 中国农业科学院植物保护研究所 Chromatin remodeling factor ISWI, coding gene and role in diaphorina tabaci MED cryptic temperature tolerance
CN111763252A (en) * 2020-07-29 2020-10-13 中国农业科学院植物保护研究所 Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm2 and coding gene and application thereof
CN111925429A (en) * 2020-07-29 2020-11-13 中国农业科学院植物保护研究所 Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm1 and coding gene application thereof

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107109426A (en) * 2014-12-16 2017-08-29 美国陶氏益农公司 The parental generation RNAi of chromatin remodeling gene for controlling Hemipteran pest suppresses
CN107208098A (en) * 2014-12-16 2017-09-26 美国陶氏益农公司 For controlling coleopteran pest chromatin remodeling gene parental generation RNAI to suppress
CN111763253A (en) * 2020-07-29 2020-10-13 中国农业科学院植物保护研究所 Chromatin remodeling factor ISWI, coding gene and role in diaphorina tabaci MED cryptic temperature tolerance
CN111763252A (en) * 2020-07-29 2020-10-13 中国农业科学院植物保护研究所 Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm2 and coding gene and application thereof
CN111925429A (en) * 2020-07-29 2020-11-13 中国农业科学院植物保护研究所 Bemisia tabaci MED cryptomorphic chromatin remodeling factor Btbrm1 and coding gene application thereof

Also Published As

Publication number Publication date
CN114437192A (en) 2022-05-06

Similar Documents

Publication Publication Date Title
Wang et al. Identification and characterization of transforming growth factor β-activated kinase 1 from Litopenaeus vannamei involved in anti-bacterial host defense
CN104593391B (en) Brown planthopper survival and growth development-associated NlPIK3R1 gene, and coded protein and application thereof
Zhang et al. Ectopic expression of a LEA protein gene TsLEA1 from Thellungiella salsuginea confers salt-tolerance in yeast and Arabidopsis
CN111944824B (en) Tachykinin receptor gene of fall webworm, dsRNA and application in preventing and treating fall webworm
Zhang et al. A transferrin gene associated with development and 2‐tridecanone tolerance in H elicoverpa armigera
Ursic Bedoya et al. Molecular cloning and transcriptional activation of lysozyme‐encoding cDNAs in the mosquito Aedes aegypti
CN114437192B (en) Tomato leaf miner chromatin remodelling factor ISWI, and encoding gene and application thereof
US7473769B2 (en) Insect desiccation resistance genes and uses thereof
CN111763253B (en) Chromatin remodeling factor ISWI, coding gene and role in diaphorina tabaci MED cryptic temperature tolerance
Zou et al. Molecular cloning and characterization of two heat shock proteins in Thitarodes pui (Lepidoptera: Hepialidae)
CN101525617A (en) Eriocheir sinensis Crustin-1 gene and in-vitro recombination expression
CN114380899B (en) Tomato leaf miner chromatin remodelling factor BRM, and encoding gene and application thereof
CN112695045B (en) Lepidoptera insect Hpx12 gene and application thereof
Wang et al. Molecular characterization, expression analysis and RNAi knock-down of elongation factor 1α and 1γ from Nilaparvata lugens and its yeast-like symbiont
CN113150099B (en) Nanmei tomato leaf miner juvenile hormone signal pathway transcription factor Kr-h1 gene and application thereof
Tang et al. MdRDH1, a HSP67B2-like rhodanese homologue plays a positive role in maintaining redox balance in Musca domestica
CN107506616B (en) Elephant&#39;s ear bean root transcriptome database, fusion protein, soaking system and silencing system
Zhou et al. A QM protein from Bombyx mori negatively regulates prophenoloxidase activation and melanization by interacting with Jun protein
Wu et al. The microRNA‐7322‐5p/p38/Hsp19 axis modulates Chilo suppressalis cell‐defences against Cry1Ca: an effective target for a stacked transgenic rice approach
CN111848768B (en) BtISWI gene and application thereof in regulating and controlling cryptogenic temperature preference of bemisia tabaci MEAM1
CN112175967B (en) PEN1 gene for enhancing plant resistance to lepidoptera pests and application thereof
CN111073895B (en) Gene APX1 for enhancing plant resistance to lepidoptera pests and application thereof
Zhou et al. Molecular analysis of the QM gene from Penaeus monodon and its expression on the different ovarian stages of development
Chen et al. Overexpression of seagrass nucleotide exchange factor gene zjfes1 enhances heat tolerance in transgenic Arabidopsis
CN109456977B (en) Gypsy moth BURS gene, encoding protein thereof and application of dsRNA thereof in pest control

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant